YAP is essential for Treg mediated suppression of …...2018/06/15 · tumor immunity and the...

1

YAP is essential for Treg mediated suppression of anti-tumor immunity

Xuhao Ni1,2**, Jinhui Tao1,3,6**, Joseph Barbi1,4**, Qian Chen3,7, Benjamin V. Park1,

Zhiguang Li1,8, Nailing Zhang3, Andriana Lebid1, Anjali Ramaswamy1, Ping Wei1, Ying

Zheng1, Xuehong Zhang1,8, Xingmei Wu1,5♯, Paolo Vignali1♮, Cui-Ping Yang1,9, Huabin Li5,

Drew Pardoll1, Ling Lu2*, Duojia Pan3 *♦, Fan Pan1*

1 Immunology and Hematopoiesis Division, Department of Oncology, Bloomberg-Kimmel Institute, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD 21287, USA 2 Translational Medicine Research Center, Affiliated Jiangning Hospital, and Liver Transplantation Center, First Affiliated Hospital, Nanjing Medical University, Nanjing, China. 3 Department of Molecular Biology and Genetics, Howard Hughes Medical Institute, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA 4 Department of Immunology, Roswell Park Comprehensive Cancer Center, Buffalo, NY, 14263, USA 5 Department of Otolaryngology, Head and Neck Surgery, Affiliated Eye, Ear, Nose and Throat Hospital, Fudan University, Shanghai, 200031, China. 6 Department of Rheumatology & Immunology, The First Affiliated Hospital of University of Science and Technology of China, No. 17 LuJiang Road, Hefei 230001, Anhui, China. 7 Thorgene Co., Ltd. 88 Kechuang 6th Street, Yizhuang Biomedical Park, Beijing, China. 8 Center of Genome and Personalized Medicine, Institute of Cancer Stem Cell, Dalian Medical University, Dalian, Liaoning 116044, China 9 Department of Gastroenterology, Rujin Hospital North, Shanghai Jiaotong University School of Medicine, Shanghai 20181, China * To whom correspondence should be addressed: Fan Pan Department of Oncology 1650 Orleans Street, CRB1 Rm452 Baltimore, MD 21287 [email protected] (F.P.) Duojia Pan Department of Physiology Howard Hughes Medical Institute UT Southwestern Medical Center 5323 Harry Hines Blvd. Dallas, TX 75390-9040 [email protected] (D.P.)

Research. on June 1, 2020. © 2018 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on June 15, 2018; DOI: 10.1158/2159-8290.CD-17-1124

mailto:[email protected]%20(F.P.)

http://cancerdiscovery.aacrjournals.org/

2

Ling Lu 300 Guangzhou St, Surgery Bldg, 21 Floor Nanjing, Jiangsu, China [email protected] (L.L.)

** Equal contribution to this work, ♯Current Address: First Affiliated Hospital of Sun Yat-

sen University, ♮Current Address: University of Pittsburgh School of Medicine, ♦Current

Address: UTSouthwestern Medical Centre.

Running title: YAP modulates regulatory T cells activity

Disclosure of potential Conflicts of Interest: No potential conflicts of interest were

disclosed by all authors.



mailto:[email protected]


3

Abstract

Regulatory T cells (Tregs) are critical for maintaining self-tolerance and immune

homeostasis, but their suppressive function can impede effective anti-tumor immune

responses. Foxp3 is a transcription factor expressed in Tregs that is required for their

function. However, the pathways and microenvironmental cues governing Foxp3

expression and Treg function are not completely understood. Herein, we report that Yes-

associated protein (YAP), a co-activator of the Hippo pathway, is highly expressed in

Tregs and bolsters Foxp3 expression and Treg function in vitro and in vivo. This

potentiation stemmed from YAP-dependent upregulation of Activin signaling which

amplifies TGFβ/SMAD activation in Tregs. YAP-deficiency resulted in dysfunctional

Tregs unable to suppress anti-tumor immunity or promote tumor growth in mice.

Chemical YAP antagonism and knockout or blockade of the YAP-regulated Activin

Receptor similarly improved anti-tumor immunity. Thus we identify YAP as an

unexpected amplifier of a Treg-reinforcing pathway with significant potential as an anti-

cancer immunotherapeutic target.

Significance

Tregs suppress anti-tumor immunity, and pathways supporting their function can be

novel immunotherapy targets. Here, the selective expression of YAP by Tregs, its

importance for their function, and its unexpected enhancement of pro-Treg

Activin/SMAD signaling are reported as are validations of potential cancer-fighting

antagonists of YAP and its regulatory targets.




4

INTRODUCTION

Regulatory T cells (Tregs) play critical roles in promoting immunological self-

tolerance and immune homeostasis by suppressing aberrant or excessive immune

responses that could give rise to autoimmune diseases (1). However, their ability to

dampen the activation of other leukocytes also can pose a major barrier to effective anti-

tumor immunity and the sterile cure of chronic infections (2). The signature forkhead

family transcription factor Foxp3 anchors the gene expression profile that is responsible

for the characteristic suppressive function of Tregs. Clearly demonstrating the

importance of this factor, mutations to the gene encoding Foxp3 can lead to fatal

autoimmune disorders in Scurfy mice and in human IPEX patients alike (3,4). Despite

the undeniable importance of Foxp3 for Treg function and immune control, our grasp of

the factors and mechanisms governing its expression remains incomplete.

The signaling pathways triggered in response to certain cytokines (e.g. IL-2 and

TGFβ) can be critical for induction and maintenance of Foxp3 expression in Tregs (5).

TGFβ is a potent inducer of Foxp3 expression in vitro and in vivo, and through activation

of SMAD signaling molecules, which serve as critical facilitators and regulators of TGFβ-

initiated signaling events and downstream gene activation (6,7). TGF- signaling has

also been reported to be critical for maintaining Foxp3 expression and Treg function

(8,9). Likewise SMAD2 and SMAD3 are also apparently needed for the optimal

phenotypic stability of Tregs (10). Importantly, mechanisms for the augmentation or

amplification of TGF/SMAD signaling in Tregs can stabilize or enhance the suppressive

function of these cells (11), and may be crucial determinants of Treg performance in a

variety of microenvironmental niches.




5

YAP (Yes-associated protein) is a transcriptional coactivator that

developmentally regulates organ size (12,13). YAP is frequently elevated in a number of

cancer types such as lung, colorectal, ovarian, liver and prostate cancers, where it acts

as a powerful tumor promoter, and its activation is a frequent event in the tumor

progression (14). The Hippo pathway is believed to be the major regulator of YAP

nuclear localization, activity, and tumorigenic potential (15-17). However, the

physiological role of YAP in immune system is unknown.

Unexpectedly, we found YAP to be highly expressed by Tregs. In this report, we

characterize the role of YAP in these important cellular mediators of immune control. Our

studies revealed that in the absence of YAP, Tregs failed to suppress immune activation

in vitro as well as in vivo. We also found that YAP potentiates the signaling events

triggered by dimeric members of the TGFβ cytokine superfamily known as Activins by

activating expression of a key signaling component of the Activin Receptor complex.

Interestingly, we found that not only is this signaling axis active in Tregs, it also could

effectively amplify TGFβ/SMAD signaling and the promotion of Treg differentiation and

function. Moreover, disrupting this YAP/Activin/SMAD axis dramatically slowed the

growth of tumors in mice including a highly aggressive melanoma model. This

experimental treatment also enhanced the anti-tumor efficacy of an anti-tumor vaccine

suggesting that the targeting of this YAP/Activin/SMAD axis can be used to improve anti-

cancer immunotherapy efficacy

RESULTS

YAP expression is induced by TCR signaling and highly expressed by Tregs and

supports their function




6

YAP is a transcriptional co-activator known for its role in the Hippo signaling

pathway (13). As such, its importance in tumorigenesis and organ size determination is

well recognized (14). However, little is known about the role of the Hippo pathway and

YAP in immune cells. Reports of crosstalk between the Hippo and TGFβ signaling

pathways (18,19) led us to speculate that elements of the former may have a role in the

mechanisms governing immune activation and tolerance.

We therefore screened YAP expression across different subsets of murine CD4+

T cells in order to assess the likelihood that Hippo signaling plays a role in these

functionally distinct T cell lineages. Little-to-no YAP mRNA was detected in naïve CD4+

T cells, but notably, YAP expression was uniquely induced during the early stages of

iTreg differentiation. Meanwhile, other T effector subsets (Th0, Th1, Th2, and Th17 cells)

failed to markedly up-regulate YAP mRNA (Fig. 1A). Interestingly, transient YAP

message accumulation was noted during Th17 skewing. However, after 12 hours post-

stimulation, YAP transcript levels returned to baseline in these T cells (Fig. 1A,

Supplementary Fig. S1A). Importantly, considerable levels of YAP protein were found

in cells of the iTreg subset and not other Thelper lineages (Fig. 1B). Human Tregs

isolated from the peripheral blood of healthy donors also display higher levels of YAP

mRNA than their conventional CD4+ (non-Treg) counterparts (Fig. 1C). These results

implicate YAP as a transcription factor preferentially expressed by developing and

established Tregs of mice and humans.

Since YAP is a major component of the Hippo pathway, we assessed levels of

several Hippo signaling factors known to be upstream of the transcription factor across T

cell subsets to determine if these also are expressed preferentially by Tregs.

Interestingly, we found that LATS1/2 and MST1/2, unlike YAP, were not up-regulated by

iTreg skewing conditions (Supplementary Fig. S1B). These findings suggest that unlike




7

other Hippo pathway factors, YAP is uniquely up-regulated in developing Tregs, and

they imply a role for YAP in the biology of these cells outside of its traditional role.

In order to dissect the potential role of YAP in the biology of CD4+ T cells, including

Tregs, we crossed YAPfl/fl mice to CD4-cre transgenic mice to generate animals with a

T cell-specific deletion of YAP. These conditional knockout mice (YAP cKO) developed

normally without apparent defects in T cell development or peripheral immune cell

populations (Supplementary Fig. S2). Additionally, no obvious spontaneous immune

pathologies were noted in these mice. Likewise the lung, kidney, liver, small intestine

and stomach of mice with Treg-specific YAP deficiency (generated crossing YAPfl/fl

mice to Foxp3Cre+ transgenic mice) appeared comparable to wild type (WT) littermates

(Supplementary Fig. S3). We used both strains to assess the impact of YAP-deficiency

on Thelper cytokine production and lineage commitment. To this end, we isolated naïve

CD4+ T cells from YAP cKO and WT mice for activation under different helper CD4+ T

cell (Th) polarizing conditions for 72 hours. YAP cKO CD4+ T cells express moderately

higher levels of IL-2 and IFN-γ upon unbiased activation (Th0 conditions) (Fig. 2A). YAP

cKO CD4+ T cells also express a greater amount of IL-17A than WT CD4+ T cells under

Th17 polarizing conditions (Fig. 2B), and, consistently, YAP cKO CD4+ T cells

expressed higher levels of il17a mRNA than WT cells (Fig. 2C). A modest decrease in

Foxp3+ cells was also seen in YAP cKO derived T cells cultured under Th17 conditions

(Fig. 2B). These observations, coupled with our earlier discovery that YAP is up-

regulated in iTregs, led us to suspect that YAP positively affects the generation of iTregs

in vitro over other CD4+ T cell fates. In line with this, the percentages of Foxp3+ cells

induced from naïve YAP cKO T cells activated under iTreg skewing conditions were

modestly, yet significantly lower than those seen in polarized WT CD4+ T

(Supplementary Fig. S4). Naïve CD4+ T cells isolated from YAPfl/fl Foxp3Cre+ mice




8

were also consistently less able to up-regulate Foxp3 than WT controls in response to

activation and various concentrations of the Treg-promoting cytokine TGF-β. Here, YAP-

deficiency specifically in T cells having already “turned on” Foxp3 expression reduced

the intensity of signal for the Treg transcription factor (Fig. 2D). Taken together, these

findings suggest that YAP likely plays an important role in the initiation or maintenance

of Treg differentiation.

In addition to Foxp3 induction, we also hypothesized that YAP might contribute to

the suppressive function of Tregs as well. Indeed, an in vitro suppression assay showed

that while WT Tregs readily dampened the proliferation of naïve T cells, YAP cKO Treg

were much less effective suppressors (Fig. 2E). In all, these findings implicate YAP as a

Treg-associated factor with a role in both the generation and function of these cells.

YAP-deficiency enhances anti-melanoma immunity

While Tregs are necessary to maintain immune homeostasis, they pose an obstacle in

mounting effective anti-tumor immune responses, and their suppressive function

dampens the efficacy of anti-cancer immunotherapies (20). For these reasons, therapies

aimed at inhibiting Treg activity are promising additions to the cancer immunotherapy

arsenal (21). We hypothesized that the apparent loss of Treg suppressive function seen

in the absence of YAP could enhance anti-tumor immune responses. To test this, WT

and YAP cKO mice were challenged with B16-melanoma, an aggressive “non-

immunogenic” cancer model. Tumor growth was measured in these mice over time, and,

strikingly, we found that YAP cKO mice controlled the subcutaneous growth of the

implanted melanoma cells while tumors grow robustly in WT mice (Fig. 3A, B). In line

with our in vitro findings, the activation of CD4+ and CD8+ tumor infiltrating lymphocytes

(TILs) from YAP cKO mice were apparently much less restrained than that of their WT

counterparts. Intracellular cytokine staining revealed these cells produced significantly




9

higher levels of IFNγ and TNFα (Fig. 3C) compared to those from WT tumors. These

results suggest that in the absence of YAP in T cells, a more robust anti-tumor immune

response is mounted.

Tumor challenge of mice with Treg-restricted YAP deficiency yielded similar

results. While WT controls expectedly permitted rapid tumor development, YAPfl/fl

Foxp3Cre+ mice maintained small tumors infiltrated by elevated populations of

inflammatory cytokine producing leukocytes. Specifically, producers of the tumoricidal

Th1 cytokine, IFNγ were found at higher frequencies and in greater numbers in the

tumors of YAPfl/fl Foxp3Cre+ mice than those of WT controls (Fig. 3D, E). Analysis of

Foxp3 expression by CD4+ TILs revealed that deletion of YAP in Tregs reduces the

frequency of suppressive Foxp3+ Tregs in the tumor microenvironment (Fig. 3F, left

and middle). The relative balance (i.e the ratio) of Tregs and potential effector CD8+ T

cells was similarly shifted in the tumors of mice with Treg-specific YAP deficiency

compared to those of WT controls (Fig. 3F, right). Treg-specific YAP-deficiency also

slowed the growth of tumors caused by implanted MC38 adenocarcinoma cells

(Supplementary Fig. S5A, B). Not only were MC38 tumors much smaller in YAPfl/fl

Foxp3Cre+ mice 21 days after injection, the relative proportions of Foxp3+ Tregs among

tumor-infiltrating T cells were reduced compared to WT tumors. In contrast, the

frequencies of intratumoral producers of IFNγ and TNFα were elevated in the absence of

Treg-specific YAP expression (Supplementary Fig. S5C-D). Corroborating results were

seen in the injectable EL4 thymoma model in which Treg-restricted YAP knockout

resulted in dramatically stunted tumor growth relative to WT mice. As with other tumor

models, this derailed tumor progression was concurrent with reduced Treg proportions

and an elevated presence of pro-inflammatory cytokine producing T cells in the tumor

microenvironment (Supplementary Fig. S6A-D). These experiments make a strong




10

case for YAP’s role as both a facilitator of Treg presence in the tumor niche and a potent

and broadly active driver of Treg-enforced inhibition of endogenous anti-tumor immunity.

Some of the most promising immunotherapeutic agents (i.e. PD-1 and CTLA-4

antagonist antibodies) show even greater anti-tumor effect when administered in concert

(22-24) or alongside tumor vaccine strategies (25-28). We therefore tested the

therapeutic potential of YAP targeting as an immunotherapeutic approach to combat

cancer. Administration of a known YAP inhibitor, Verteporfin (VP) (29), to melanoma

bearing mice resulted in modest reduction in tumor size (Fig. 3G). Treatment of

melanoma-bearing YAPfl/fl Foxp3Cre+ mice with VP, on the other hand, failed to alter

the already stunted progression of tumors in these mice (Supplementary Fig. S7A),

suggesting that potential off-target effects of this drug, or any direct effects on tumor

cells are not likely contributing to these in vivo observations. We also tested the effects

of combining VP with the proven immunotherapeutic agents anti-PD1 antibody and GM-

Vac (irradiated GMCSF-producing B16 cells). Both anti-PD1 and GM-Vac treatments

were able to slow tumor growth somewhat as monotherapies. Notably, combinatorial

treatment with VP and anti-PD1 neutralizing antibody suppressed tumor progression to a

greater extent than any monotherapy tested. Even more dramatic was the synergistic

effects of VP and GM-Vac, which prevented the development of tumors beyond a barely

detectable size (Fig. 3G). The decidedly improved anti-tumor efficacy seen upon

combination of either anti-PD1 or GM-Vac treatment with VP was associated with

enhanced proportions of IFNγ-producing CD8+ and CD4+ T cells and a compromised

Treg presence in the tumor microenvironment (Fig. 3H and Supplementary Fig. S7B-

D). These findings strongly suggest a major role for Treg-derived YAP in crafting the

immunosuppressive nature of the tumor microenvironment. They also suggest the

potential of immunotherapeutic approaches that include YAP targeting agents.




11

YAP potentiates expression of genes involved in TGF/SMAD and Activin

signaling

To gain insight into the mechanism by which YAP contributes to Tregs and their

enforcement of immune suppression, we isolated Tregs from mice lacking YAP

specifically in these cells (YAP cKO) and subject them to RNASeq analysis along with

WT Tregs (YAPwt/wt Foxp3cre+) and naïve CD4+ T cells from both mice. The results of

this analysis revealed that YAP-deficient Tregs display reduced expression of several

genes known to be important in the signaling pathway triggered by the anti-inflammatory

cytokine TGF. Interestingly, one of the genes most down-regulated in the absence of

YAP was that encoding the signaling component of the Activin Receptor complex known

as Acvr1c (Fig. 4A and Supplementary Fig. S8A). Confirming a role for YAP in

potentiating Acvr1c expression, we found that WT CD4+ T cells display considerable up-

regulation of the transcript for this receptor subunit during in vitro Treg differentiation

while their YAP-deficient counterparts did not. Interestingly, freshly isolated nTregs

expressed modest levels of Acvr1c. However, upon activation, these Tregs dramatically

activated activin receptor expression in a YAP-dependent manner (Supplementary Fig.

S8B). Since neither nTreg nor differentiating iTregs from YAP fl/fl Foxp3Cre+ mice

expressed considerable ACVR1C mRNA levels, Activin A expression and

responsiveness may have considerable influence over the biology of multiple Treg

populations.

It has been suggested that Activin can promote TGF signaling. Pathway

Analysis of our RNASeq results showed that the gene expression patterns most

impacted by YAP-deficiency in Tregs were highly relevant to immune control and the

diverse autoimmune pathologies resulting from the breakdown of such control. Among




12

these, the genes associated with the TGF signaling cascade were markedly altered

(Supplementary Fig. S8C). Furthermore RT-PCR analysis also showed reduced

transcript levels for several known TGF-responsive genes in Tregs from YAPfl/fl

Foxp3Cre+ mice (Supplementary Fig. S8D). In light of these findings, we suspected

that YAP contributes to Treg-mediated immune control at least in part by bolstering

TGF/SMAD signaling through the Activin/AcVR1C axis in these suppressor cells.

While Activin mRNA levels were low in naïve CD4+ T cells, in vitro differentiating

Tregs (naïve CD4+ T cells activated with anti-CD3/CD28 in the presence of IL-2 and

TGF) up-regulated Activin expression over time (Supplementary Fig. S9A). The

kinetics of this up-regulation paralleled the appearance of Foxp3 expression in these

cells (Supplementary Fig. S9B). qRT-PCR analysis also showed that expression of the

Activin Receptor (AcVR1C) was similarly low in naïve CD4+ T cells, but was robustly up-

regulated under in vitro culture conditions that generate iTreg (Supplementary Fig.

S8B, S9C). We went on to dissect which Treg-inducing stimuli was chiefly responsible

for inducing expression of YAP and elements of Activin/ACVR1C signaling. To this end,

naïve CD4+ T cells were activated in vitro with anti-CD3/CD28 antibodies, either alone

or in the presence of IL-2, TGF, or IL-2 and TGF. As expected, activation alone failed

to induce up-regulation of these genes or the canonical Treg transcription factor, Foxp3.

The cytokine TGF did trigger significant expression of Foxp3, as expected, but YAP as

well. Exposure to IL-2 along with TGF (but not IL-2 alone) greatly augmented

expression of YAP and Foxp3. Of the conditions tested, those up-regulating robust YAP

also brought about expression of Activin and ACVR1C (Supplementary Fig. S9D-G).

These findings further align the up-regulation of YAP expression and Activin signaling

with the Treg lineage, and shed some light on the largely unknown cast of molecular

characters regulating these processes in T cells.




13

To gain further insight into the mechanism of YAP-mediated ACVR1C up-

regulation, we explored the potential involvement of a known YAP-collaborating factor.

Mature YAP protein is known to contain a TEAD-binding domain, and prior studies

(largely conducted in non-T cells) have identified numerous target genes controlled by

the cooperation of these factors. Suggesting that transcription at the AcVR1c locus is

activated through YAP-TEAD interaction, the promoter sequence of this gene was found

to contain two TEAD consensus binding sites (Fig. 5A). To test the importance of TEAD

binding for YAP-dependent AcVR1c expression, we prepared luciferase-based reporter

constructs under the control of wild type murine AcVR1c promoter sequence. Mutant

constructs having either or both of the TEAD sites ablated were also designed (Fig. 5B).

Each AcVR1c-luciferase reporter construct was delivered into Jurkat T cells along with

an expression vector encoding YAP (“YAP1wt”) or a mutant version of this transcription

factor unable to interact with TEAD (“YAP1mut”) owing to an S-to-A mutation at residue

94 (“S94A”). In this system, expression of TEAD1 or YAP1wt alone induced only modest

activation of AcVR1c expression. In contrast, robust luciferase signal was detected when

wild type YAP and TEAD were co-expressed. Mutation of YAP’s TEAD-interaction site,

however, resulted in far less reporter activity (Fig. 5C) supporting the notion that YAP-

TEAD cooperation is necessary for optimal AcVR1c expression. Similarly, loss of a

single TEAD binding site in the promoter sequence reduced YAP-induced transcription

while mutation of both sites resulted in a significant and near complete loss of reporter

signal (Fig. 5D). These results clearly implicate a molecular partnership between YAP

and TEAD in the potentiation of Activin signaling through AcVR1c expression. This point

was further supported by ChIP assays showing both YAP1 and TEAD1 are enriched at

the AcVR1c locus in WT iTreg cells (Fig. 5E). Notably, in YAP cKO derived iTregs,

TEAD1 was still found interacting with the AcVR1c locus despite the absence of YAP

(Fig. 5E). These findings illuminate the mechanism behind YAP’s activation of activin




14

signaling.

Activin enhances SMAD/TGF signaling and Treg differentiation

Since Activin has been reported to promote SMAD signaling in non-T cells (30), we

tested whether Activin signaling in T cells could have a similar effect. SMAD activity was

assessed by western blot analysis of SMAD phosphorylation. Indeed, we found that

while untreated CD4+ T cells did not contain discernable levels of active

(phosphorylated) SMAD molecules, treatment with 5 or 10 ng/ml of Activin A resulted in

elevation of phospho-SMAD levels. As expected, TGF- treatment (0.5 or 2 ng/ml) also

induced SMAD phosphorylation. Importantly, combined Activin and TGF treatment

resulted in even further activation of the SMAD signaling pathway (Fig. 6A). These

findings suggest that Activin signaling can augment signaling along the TGF/SMAD

axis – a signaling pathway crucial for multiple aspects of Treg biology and immune

tolerance (7).

TGF/SMAD mediated events are important during the up-regulation of Foxp3 and the

generation of Tregs from naïve CD4+ T cell precursors. We next investigated whether

YAP-dependent Activin signaling can participate in the driving of this process. Having

shown that YAP plays an important role in promoting or maintaining Foxp3 expression

induced in the presence of various TGF concentrations (Fig. 2D), and having

implicated the transcription factor in the regulation of TGF-sensitive genes (Fig. 4,

Supplementary Fig. S8), we therefore postulated that YAP-mediated up-regulation of

AcVR1C and SMAD signaling might provide a crucial amplification of this important

Treg-supporting signaling pathway that allows for more robust or sustained Foxp3

expression.




15

To explore the involvement of Activin/AcVR1C signaling in the enhancement of Treg

differentiation by YAP, the effects of supplemental Activin A on in vitro Treg commitment

was also investigated. As expected, activation of naïve CD4+ T cells without TGF

yielded little-to-no Foxp3 induction regardless of YAP expression. Strikingly, activation of

WT cells with exogenous Activin A, even in the absence of TGF, generated a

population of Foxp3+ cells. While a suboptimal concentration of TGF resulted in

modest up-regulation of Foxp3 (mirroring the effects on SMAD activation), combined

treatment of WT naïve CD4+ T cells with low doses of TGFβ plus Activin A resulted in

synergistic promotion of Foxp3+ T cell induction. This induction of Tregs by Activin A

treatment alone was largely not seen upon Foxp3-driven knockout of YAP, and while

dual treatment of differentiating YAPfl/fl Foxp3Cre+ iTregs did enhance the generation of

Foxp3+ cells, it was to an extent far less than that seen in their WT counterparts (Fig.

6B). These results suggest that Activin signaling via YAP-dependent AcVR1C

expression on Treg not only augments TGF signaling but also can drive the process of

Foxp3 up-regulation. Supporting this notion, Naïve T cells lacking AcVR1c were found to

be less sensitive to TGFβ-induced iTreg differentiation their WT counterparts, particularly

when TGFβ concentrations were low (Supplementary Fig. S10A, B). Interestingly,

exogenous activin supplementation could do little to rescue the deficient Foxp3 induction

seen in naïve CD4+ T cells lacking either SMAD2 or SMAD3, or, for that matter, the

pronounced defect in iTreg generation seen in T cells genetically lacking both SMAD

molecules (Supplementary Fig. S11). This observation confirms that functional SMAD

signaling is required for activin-mediated enhancement of Treg generation, in agreement

with prior studies (31). In all, these findings are very much in line with a role for YAP-




16

driven Activin signaling in the augmentation of signaling down the SMAD/TGFβ axis in T

cells.

Activin-mediated support of Treg function is YAP/AcVR1C-dependent

YAP deficiency leads to improved anti-tumor immunity and a Treg pool that is insensitive

to an activator of the TGF/SMAD signaling pathway (i.e. Activin). We therefore

hypothesized that YAP facilitates robust Treg function in vivo through the induction of

AcVR1C, which in turn amplifies the pro-Treg signaling cascades. In order to determine

if the Treg-promoting effects of YAP were due to the up-regulation of AcVR1C, we set

out to test whether the defective Treg function seen in YAP knockouts could be restored

by ectopic expression of AcVR1C. In an in vitro suppression assay, as expected,

YAPfl/flFoxp3Cre+ derived Tregs transduced with an empty vector control expressed

reduced levels of ACVR1C protein and were much less efficient suppressors of naïve

CD4+ T cell proliferation than their WT counterparts. However, lentiviral-based delivery

of an ACVR1C-encoding expression construct into YAPfl/fl Foxp3Cre+ derived Tregs

more than rescued receptor expression, which greatly enhanced their suppressive

potency beyond even that of WT Tregs (Fig. 6C). These results support the conclusion

that Activin signaling through AcVR1C (up-regulated by YAP) can amplify the

suppressive potency of established Tregs as well as the TGF-driven differentiation of

iTregs and potentially other facets of this cytokine’s broadly immunosuppressive action.

Importantly, they also suggest that targeting either YAP or Activin signaling is likely to

undermine the tolerance promoting attributes of TGF and both subsets of Foxp3+ Treg

cells in the cancer setting. These approaches may provide avenues to enhanced anti-




17

tumor immunity either as novel treatments on their own or as potent enhancers of other

promising immunotherapeutic agents.

Activin blockade or AcVR1c knockout inhibits tumor growth

As an instigator of an apparent feed-forward loop capable of amplifying TGFβ/SMAD

activity, YAP presents a tempting target for those aiming to break tolerance in the cancer

setting. However, the targeting of YAP in cancer patients may prove problematic owing

to the molecule’s intracellular location and the chemical drawbacks of known inhibitors

(e.g. VP has noted solubility issues (29)). Therefore, the Activin/AcVR1C interaction is

likely to serve as a desirable alternative strategy. Having demonstrated the positive

effects of Activin signaling on the TGF/SMAD signaling pathway and the processes of

Treg generation and function, which can oppose immune-mediated tumor cell killing, we

suspected that disrupting Activin function should enhance anti-tumor immunity. We

therefore tested the potential of Activin targeting as an immunotherapeutic approach to

combat cancer. Administration of anti-activin monoclonal antibody to mice injected

subcutaneously with B16 melanoma markedly stunted the development of tumors

relative to an inert isotype control (Fig. 7A). We also tested the value of combining anti-

activin blocking antibody treatment with the anti-cancer vaccine GM-Vac. Treatment with

GM-Vac alone was able to partially slow the growth of tumors to an extent similar to anti-

activin monotherapy. However, combining anti-activin treatment with GM-Vac was able

to arrest tumor growth at a barely detectable size (Fig. 7A). Anti-activin treatment also

successfully reduced the frequency of Foxp3+ Tregs among TILs, and while GM-Vac -

receiving mice displayed some reduced Treg presence in their tumors, combined GM-

Vac and activin blockade resulted in dramatic loss of these suppressor T cells from the

tumor microenvironment (Fig. 7B). The effect of blocking activin on Tregs coincided with




18

increased frequencies of IFNγ-producing CD8+ and CD4+ T cells, an observation even

more prominent upon combination of GM-Vac and anti-activin treatments (Fig. 7C).

These results demonstrate the susceptibility of the YAP/AcVR1c/Activin axis to

therapeutic targeting at multiple points.

Along this line, B16 tumor growth was also markedly slower in AcVR1c knockout

mice compared to WT controls (Fig. 7D). Correspondingly, the TILs from AcVR1c-

deficient mice contained fewer Foxp3+ Tregs than their WT counterparts and displayed

a selective elevation of IFNγ-producing T cells (Fig. 7E, F). As with chemical YAP

inhibition and antibody-mediated activin blockade, administering GM-Vac to AcVR1c

knockout mice enhanced the already considerable anti-tumor effect of genetic AcVR1c

ablation (Supplementary Fig. S12). From these results it is clear that disrupting any of

the several elements of the YAP/Activin/SMAD axis can undermine immune suppression

and oppose tumor progression in mice.

In all, our findings support the conclusion that signaling along the YAP-regulated

Activin/ACVR1C axis can support Treg generation and function and potentially other

broadly immune-suppressing effects of the TGF/SMAD pathway. Importantly, they also

suggest that targeting this axis is likely to undermine the immune suppressive attributes

of TGF and Foxp3+ Treg cells in the cancer setting - either alone, or in combination

with other promising immunotherapeutic agents (e.g. immune checkpoint blocking

antibodies, anti-cancer vaccines).

DISCUSSION

Tregs are indispensable for restraining potentially lethal self-directed (autoimmune)

responses or over-exuberant ones mounted against normally harmless commensal




19

microbes (IBD) (1). However, in cancer patients, Tregs can be greatly enriched within

tumors and sometimes systemically (32). The suppressive function of these cells in this

setting dampens the effectiveness of tumor-directed immunity and is a major obstacle for

developing effective anti-cancer immunotherapies (21).

As part of an ongoing effort to identify precise mechanisms of Treg generation,

maintenance and function in the context of cancer, we have made the surprising

discovery that YAP, a transcription factor critical in developmental regulation of organ

size, is in fact an important factor in the generation and function of Tregs. Deletion of

Yap in T cells somewhat enhances both Th1 and Th17 development but most

impressively diminishes generation of iTreg under conditions of limiting TGFβ. YAP-

deficiency also negatively impacts the suppressive function of Tregs. The inability of

Tregs to suppress immunity in vivo in the absence of YAP was dramatically illustrated by

our B16 melanoma tumor model experiments (Fig. 3). The poorly immunogenic tumor

failed to grow in mice with Treg-specific Yap deletion, which displayed markedly

enhanced indicators of proinflammatory anti-tumor immunity compared to wild type

controls. This improved deployment of anti-tumor immunity was seen alongside a

markedly diminished Treg presence in the tumor microenvironment (Fig. 3E, F) –

observations also seen upon Treg-specific YAP deficiency across other, distinct tumor

models as well. These findings strongly suggest that YAP is important for the

accumulation and suppressive function of Tregs in the tumor microenvironment.

Furthermore, they imply that targeting YAP should be a potent means of overcoming

immune suppression in the cancer setting and improving the efficacy of endogenous and

therapeutically induced tumor killing by leukocyte. Further characterization of YAP

expression by Treg subsets found in different healthy and diseased tissues (including




20

tumors) should more clearly define this factor’s role in immune control in specific

physiological contexts.

Here we present a body of data strongly suggesting a Treg-specific role for YAP

in promoting the immune suppression capable of allowing the persistence and

progression of tumors in the cancer setting. Indeed, YAP-expression patterns and the

dramatically stunted tumor growth seen in YAPfl/fl Foxp3Cre+ mice support this.

However, comparing the degree of anti-tumor effect resulting from T cell- and Treg-

driven YAP deficiency, it appears that a slightly more dramatic effect is seen in the

former case. While the bulk of the effect seen in Fig. 3A is phenocopied by the more

restrictive deletion of YAP in only Foxp3+ cells (Fig. 3D), it is possible that YAP may

play a tumor-abetting role in some other T cell population capable of inducing the factor

in the cancer setting. While such YAP expression appears to have relatively minor

consequences next to Treg-derived YAP at least in the tumor models used in our study,

future work may bring to light additional layers of YAP’s pro-tumor effects involving cells

beyond Foxp3+ Tregs (such as anergized or exhausted T cells, non-Foxp3-expressing

TR1 Treg cells, etc.). These too may be susceptible to YAP-targeting strategies, which,

based on our results, clearly should have potent anti-tumor effects.

Indeed, using a known YAP antagonist with modest inhibitory activity (29) we confirmed

the potential of YAP as a target for Treg-undermining immunotherapies. While inhibiting

YAP alone slightly decreased tumor growth, we observed strong synergy in anti-tumor

activity and immunity boosting effects when the drug was combined with a tumor vaccine

and checkpoint inhibitor treatment that alone possess much less potent effects. These

findings suggest that YAP-targeting approaches should increase the efficacy of current

immunotherapies, potentially by enhancing the presence of activated effector leukocytes

in the tumor microenvironment.




21

Analysis of the downstream targets of YAP activity in Treg identified ACVR1C led to the

finding that the Activin-Activin Receptor signaling axis plays a major role in the

augmentation of TGF-β/SMAD signaling and Treg generation and function (summarized

in Supplementary Fig. S13). This pathway is highly important for the induction of

extrathymic Foxp3+ T cells from naïve CD4+ precursors as SMADS bind critical

enhancer regions for the Foxp3 gene (6,33). It is also important for sustaining Foxp3

expression and suppressive function in Tregs (7), and TGF- has been implicated as a

promoter of survival and phenotypic stabilization of thymic Tregs (34,35). With such

reliance on TGF and SMAD signaling, it stands to reason that Tregs employ

mechanisms to optimize or amplify the downstream signaling events and resultant gene

regulation triggered by this pathway. Such amplification mechanisms can be important

for maintaining the gene expression and phenotype traits underlying the suppressive

function of Tregs. Documented examples include the enzymatic conversion of latent

TGF to its active form (36) and the triggering of SMAD activation by galectin and CD44

(11). The up-regulation of YAP and subsequently ACVR1C – the receptor for a known

enhancer of SMAD signaling (i.e. Activin) in T cells exposed to TGFβ suggests the

existence of a positive feedback loop for this decidedly pro-Treg cytokine where

Activin/ACVR1C signaling can enhance the downstream signaling events triggered by

TGFβ. Reports of Activin expression in several tumor types (37,38) support the notion

that tumor-accumulating Tregs benefit particularly from Activin/ACVR1C signaling

facilitated by YAP induction.

Our proof-of-concept experiments demonstrate that this pro-Treg amplification

mechanism is susceptible to therapeutic disruption. Particularly, our findings suggest




22

that antibody-mediated Activin blockade may prove a most effective means for the

disruption of Treg- and tumor-abetting TGFβ activation in cancer patients. Additionally,

the development and vetting of therapeutic antibodies capable of neutralizing activin,

AcVR1C or blocking its association with AcVR1C in cancer patients may lead to new

and potent immunotherapeutic regimens that prevent anti-tumor immunity from stifling

Treg-enforced tolerance. On the other hand, our findings suggest that supplementation

of activin or other therapeutic enhancements of the Activin/ACVR1C axis could have

considerable potential as a strategy to correct inadequate immune regulation in settings

of autoimmune (e.g. Multiple Sclerosis) or inflammatory disease (e.g. Inflammatory

Bowel Disease). Future application of YAP inhibitors or Activin/ACVR1C ablation in

mouse models relevant to these and other pathologies of immune dysregulation will

shed light on whether this pro-Treg loop is generally important for immune control or if it

is principally operative in the tumor setting.

Our findings are, to our knowledge, the first to implicate YAP as a transcriptional

facilitator of Treg differentiation and function. While this molecule has been previously

studied for its regulation of development, organ size, regeneration, and tumorigenesis

(39), and its role as a transcriptional effector of gene expression downstream of the

Hippo pathway is well established. The importance of the Hippo pathway and its

associated cofactors in Tregs and immune control is only beginning to be understood. A

recent study showed that the Hippo pathway kinase known as Mst1 plays an important

role in stabilizing Foxp3 protein levels and supporting Treg function (40). Our present

findings reveal that YAP potentiates Treg-supporting SMAD activity in T cells through

Activin signaling. Notably though, this unexpected role appears to be independent of

other Hippo factors (i.e. Mst1/2, Lats1/2) as these, unlike YAP, were not highly up-

regulated in developing Tregs. Interestingly, another Hippo effector known as TAZ




23

(regarded to be a YAP paralog) was recently identified as a promoter of Th17

differentiation in naïve CD4+ T cells and an negative regulatory of Foxp3 function and

expression in these cells (41). This role for TAZ in the generation of proinflammatory T

cells was also apparently beyond its traditional Hippo-dependent role. Taken together,

these newly uncovered immunological roles played by YAP and TAZ suggest that

different molecular players in the Hippo pathway can have functionally opposite and

mechanistically distinct roles in determining the balance between inflammation and

tolerance. Further dissection of this pathway in T cells should add considerably to our

understanding of this balance and, based on our current study’s findings, may lead to

potent new immunotherapy approaches.

METHODS

Mice. C57/BL6 YAP fl/fl mice were generous gifts of Dr. Duojia Pan. C57/BL6 AcVR1c

knockout mice were gifts from Dr. Ning Lu. C57/BL6 CD4-cre and Foxp3-YFP-Cre

transgenic mice were purchased from the Jackson Laboratory. SMAD2-/-, SMAD3-/- and

SMAD2/3 double knockout mice on a C57BL/6 background were originally obtained from

Dr. Se-Jin Lee’s laboratory and where previously described (42). All animal experiments

performed where approved by the Johns Hopkins University Institutional Animal Care

and Use Committee (IACUC).

In vitro T-cell differentiation. Naïve CD4+ T cells (CD4+ CD25- CD62LHIGH) were

sorted on a FACS Aria II high-speed sorter. The sorted cells were activated with plate-

bound anti-CD3 (1µg/ml) and soluble anti-CD28 (2 or 4 µg/ml) in a 24-well plate with the

following polarizing conditions: Th1 (IL-12 (10ng/ml), anti-IL-4 (10µg/ml), Th2 (IL-4

(10ng/ml), anti-IFNγ (10µg/ml), anti-IL-12 (10µg/ml)), Th17 (IL-6 (10ng/ml), TGFβ1




24

(1.25ng/ml), IL-23 (10ng/ml), IL-1β (10ng/ml), anti-IFNγ (10µg/ml), anti-IL-4 (10µg/ml),

Treg (TGFβ1 (5ng/ml, or as indicated), IL-2 (100IU/ml) typically for 4 days, unless

otherwise indicated.

Human T cell isolation from Peripheral Blood. De-identified human peripheral blood

was obtained from blood bank in strict accordance with Johns Hopkins University School

of Medicine’s Institutional Review Board guidelines. Samples from a total of ten healthy,

adult volunteers (age range, 30 to 46 years). Peripheral blood mononuclear cells were

extracted from whole blood through a gradient of Ficoll-Paque PLUS (GE Healthcare).

CD4+ T cells were enriched using a Dynabeads Untouched CD4 T-cell isolation kit

(Invitrogen). Regulatory T-cells (Tregs) were identified and flow sorted via the following

staining profile: CD3+/CD4+/CD8–/CD25HIGH/CD127low/CD39+. Non-Treg CD4+ T cells

were sorted as previously described (43).

In vitro suppression assay. 0.1X106 WT naïve CD4+ T cells were labelled with CFSE

and cultured in a 96-well bottom plate with anti-CD3/CD28-conjugated beads at a cell to

bead ratio of 1:1. Serially diluted Treg cells (CD4+ CD25HIGH) were co-cultured for 72hrs

and cellular proliferation by CFSE was measured by flow cytometry.

Lentivirus production and transduction. HEK293T cells were purchased from the

ATCC in 2015 and were kept as a frozen stock. This cell line has not been authenticated

by the laboratory. Recombinant lentiviruses were generated using a three-plasmid

system as described previously (44). The AcVR1c cDNA was cloned into the modified

pLV lentiviral vector carrying CMV driven Thy1.1 as a transduction efficiency marker.

Virus was harvested at 48 and 72 h after transfection and titer was determined based on

percentages of Thy1.1-positive Jurkat T cells after transduction with serially diluted viral




25

supernatant. The titer, calculated as transducing units (TU)/ml of supernatant, was from

2x10^6 to 8x106 TU/ml. The virus-containing supernatant was concentrated using an

Amicon Ultra Concentrator (Millipore) and stored at -80°C. Gene transduction into

CD4+CD25- conventional T cells and CD4+CD25+ Tregs was performed by stimulating

cells with plate-bound anti-CD3 (10μg/ml) and soluble anti-CD28 (1μg/ml) with 60U/ml

human recombinant IL-2 for 16 h. Activated T cells were transduced with viral

supernatants supplemented with 60U/ml IL-2 and 8 μg ml-1 polybrene, followed by

centrifugation for 1h at 2,500 rpm. After transduction, 20U/ml human recombinant IL-2

(eBioscience) was added to the culture. At 40 h after transduction, Thy1.1+ Treg cells

were sorted for western blot, and/or suppression assay as indicated.

RNASeq Analysis. Spleen and peripheral lymph nodes were harvested from YAPwt/wt;

CD4-Cre- Wild-type (WT) and YAP flox/flox (fl/fl); CD4-Cre+ mice (n=5/group). CD4+ T

cells were magnetically enriched, and naïve (CD4+ CD62L+ CD25-) T cells and natural

Tregs (nTregs, CD4+ CD62L+/- CD25HIGH) cells were flow sorted from each group. For

activation condition, sorted nTreg cells were further activated with 2µg/ml of plate-coated

αCD3 and 2µg/ml of soluble αCD28 with TGF-β1 (5ng/ml) and IL-2 (100U/ml) for 24hrs.

2×106 nTreg (no stimulation or stimulation) from WT and YAP cKO mice were harvested

and washed with 1X PBS twice and immediately snap-frozen until further RNA-seq

analysis.

Construction of RNA-seq libraries. Total RNA was isolated by TRIZOL from naive

CD4+ T cells, or natural Treg cells with or without the stimulation anti-CD3/CD28 for

48hr from wild type or YAP cKO mice. RNA quality was monitored on Bioanalyzer.

Strand-specific RNA-seq libraries were prepared using TruSeq Stranded Total RNA LT

Sample Prep Kit (with Ribo-Zero Gold, RS-122-2301, Illumina) from 322 ng of total RNA




26

by following manufacturer protocols. Briefly, ribosomal RNAs (rRNAs) were depleted

using biotinylated, target-specific oligos combined with Ribo-Zero rRNA removal beads.

After purification, RNA was fragmented using divalent cations under elevated

temperature, and transcribed into first strand cDNA using reverse transcriptase and

random primers, followed by second strand cDNA synthesis using DNA Polymerase I

and RNase H. A single 'A' base was added to these cDNA fragments that were

subsequently ligated with the adapter. The products were enriched with 12-cycle PCR.

The concentration of final cDNA libraries in 30 ul ddH2O reached 24-27 ng/ul as

determined on Qubit 2.0.

Analysis of RNA-seq data. Sequencing was performed on Illumina Hiseq2000 at

Beijing Genomics Institute with the type of paired-end, 100bp. Data quality was

assessed by FastQC software

(http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Mapping to a mouse

reference genome (mm10) was conducted by TopHat. Differentially-Expressed genes

were called by Cuffdiff (45). The genes with p value < 0.05 and absolute values of log2-

transformed fold changes larger than 1.5 between WT and YAP cKO T cells were

considered differentially expressed. A heat map was generated in R statistical software

using the geom_tile function under ggplot2 package. Clustering was done with the

complete linkage and euclidean distance using hclust function in R statistical software.

Pathway Analysis (Ingenuity) was carried out as described previously (46).

Flow cytometry. For extracellular staining, harvested cells were washed and incubated

in PBS containing 1% FBS containing the below fluorochrome-conjugated antibodies in

a U-bottom 96-well plate. For intracellular cytokine staining, harvested cells were re-

stimulated in PMA and Ionomycin in the presence of Golgi-Plug (BD Biosciences). After




27

5 hour incubation, the cells were fixed/permeabilized (eBioscience) and incubated with

antibodies (see Supplementary Table1A for a comprehensive list). For cellular

proliferation, cell Trace CFSE cell proliferation kit (Invitrogen) was used per

manufacture’s manual.

Quantitative Real-Time PCR. RNA was extracted using Trizol (Invitrogen) followed by

cDNA synthesis reaction using SuperScript III (Invitrogen) in a 20ul reaction/well. The

same amount of RNA was used in each cDNA synthesis reaction measured by

NanoDrop Spectrophotometer (ThermoScientific). The same volume of cDNA per

sample was prepared for real-time PCR analysis using SYBR Green (Pierce) and the

indicated primers to assess transcript levels of each gene.

Tumor growth experiments. Murine B16-melanoma cells, MC38-colon cancer, and

EL4 thymoma cell lines were purchased from the ATCC and kept as frozen stock in

2015. These cell lines have not been authenticated by the laboratory. Cells were

cultured in vitro in DMEM plus 10% heat inactivated Fetal Bovine Serum and where

detached by trypsinization and washed prior to subcutaneously (s.c.) injection into the

shaved side flank of the indicated strains of female mice between the ages of 6-8 weeks

on a C57Bl/6 background (1x105 cells). In some experiments, 1-5x104 B16 melanoma

cells were injected each mouse in the footpad. Where indicated, once tumors were

palpable (7-10 days post-injection), 100 ml of 1x106 lethally irradiated (150Gy) B16 GM-

vaccine cells (GM-VAX) were injected s.c. into the contralateral limb. A hybridoma cell

line expressing a blocking anti-PD-1 antibody (clone G4) was obtained from Dr. Charles

Drake (JHH). 100 μg/mouse/injection of anti-PD-1 (G4) was injected intraperitoneally

twice a week once tumors were palpable (7-10 days) in conjunction with vaccine and

Verteporfin (USP, USP-1711461) treatments. Verteporfin was dosed at 2mg/mouse




28

diluted to 200µl with PBS and injected intraperitoneally every two days. Activin

neutralization antibodies and isotype control IgG were purchased from R&D.

100μg/mouse/injection of activin neutralizing antibodies was given intraperitoneally twice

a week. For all these experiments, 5-10 mice were used per group. Tumor progression

was assessed by measuring changes in tumor length (L) and width (W) and tumor

volume (V) over time. Tumor volume was calculated using the formula (L*W2)/2.

Molecular Cloning and Site-Directed Mutagenesis: Mouse AcVR1c promoter (1.2 kb)

was cloned from the genomic DNA of isolated CD4+ T cells and the sequence was

confirmed. The amplified clones were ligated to SacI/XhoI-digested pGL4.1-Basic Vector

(Promega) using the In-Fusion Cloning Kit (Clontech). Site-directed mutagenesis was

carried out using QuikChange Lightning Kit (Agilent Technologies).

Transient Transfection and Luciferase Assay: Jurkat T cells (clone E6-1) were

purchased from the ATCC in 2016 and were kept as a frozen stock. This cell line has not

been authenticated by the laboratory. Jurkat T cells (1.5 × 107) were transfected with 5

μg pGL4.1-AcVR1c, 1 μg of pRL-TK Vector (Promega) and other indicated plasmids by

electroporation using Nucleofector II (Amaxa/Lonza). The cells were rested for overnight

and stimulated with mock or PMA/Ionomycin for 8 hr before harvested and lysed

followed by luminescence measurement using a Dual-Luciferase Assay (Promega) as

per manufacturer’s instructions.

ChIP Assay: ChIP assay was performed according to the manufacturer's guidance

(Invitrogen MAGnify ChIP system). Briefly, sorted CD4+ iTreg cells were activated with

αCD3/αCD28–conjugated beads for overnight and fixed with 2% formaldehyde.

Sonicated DNA was immunoprecipitated with anti-YAP1 (Cell Signaling Technology),




29

and anti-TEAD1 (Santa Cruz Biotechnology). The immunoprecipitated chromatin was

analyzed on Roche LightCycler 480 by SYBR Green using the following primers for

AcVR1c promoter.

Statistical Analyses: Values are presented as means ± SEM where appropriate.

Statistical differences among multiple groups were determined using a two way analysis

of variance (ANOVA) with NewmaneKeuls Multiple Comparison Test, unless otherwise

indicated. Unpaired, two-tailed student’s t-tests were used for single-comparisons. In

general, P values <0.05 were considered significant and are indicated as follows:

*P<0.05, **P<0.01, ***P<0.002, ****P<0.001, ns: not significant. GraphPad Prism 7 was

used to calculate P values.

Data Availability: RNAseq dataset has been uploaded to an appropriate online

repository. The GEO accession number is GSE112593.

ACKNOWLEDGEMENTS

F. Pan’s research is supported by the Bloomberg-Kimmel Institute (Immunometabolism

Program & Immune Modulation Program), the Melanoma Research Alliance, the NIH

(RO1AI099300, RO1AI089830 and R01AI137046), The DoD (PC130767); J. Barbi’s

research is supported by the Melanoma Research Foundation, Phi Beta Psi, the Roswell

Park Alliance Foundation and NCI grant P30CA016056. The Li Lab was supported by

the National Natural Science Committee of China (No. 81725004) and Shanghai

Science and Technology Committee (No.16410723600). L. Lu’s research is supported

by the National Natural Science Fund of China (grants 81571564, grant 81521004 and

81522020) and the Foundation of Jiangsu Collaborative Innovation Center of Biomedical




30

Functional Materials (LL). D. Pan is an investigator of the Howard Hughes Medical

Institute.




31

REFERENCES

1. Sakaguchi S, Yamaguchi T, Nomura T, Ono M. Regulatory T cells and immune tolerance. Cell 2008;133(5):775-87 doi 10.1016/j.cell.2008.05.009.

2. Whiteside TL. What are regulatory T cells (Treg) regulating in cancer and why? Semin Cancer Biol 2012;22(4):327-34 doi 10.1016/j.semcancer.2012.03.004.

3. Bennett CL, Christie J, Ramsdell F, Brunkow ME, Ferguson PJ, Whitesell L, et al. The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat Genet 2001;27(1):20-1 doi 10.1038/83713.

4. Brunkow ME, Jeffery EW, Hjerrild KA, Paeper B, Clark LB, Yasayko SA, et al. Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat Genet 2001;27(1):68-73 doi 10.1038/83784.

5. Josefowicz SZ, Lu LF, Rudensky AY. Regulatory T cells: mechanisms of differentiation and function. Annu Rev Immunol 2012;30:531-64 doi 10.1146/annurev.immunol.25.022106.141623.

6. Zheng Y, Josefowicz S, Chaudhry A, Peng XP, Forbush K, Rudensky AY. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate. Nature 2010;463(7282):808-12 doi 10.1038/nature08750.

7. Tran DQ. TGF-beta: the sword, the wand, and the shield of FOXP3(+) regulatory T cells. J Mol Cell Biol 2012;4(1):29-37 doi 10.1093/jmcb/mjr033.

8. Marie JC, Letterio JJ, Gavin M, Rudensky AY. TGF-beta1 maintains suppressor function and Foxp3 expression in CD4+CD25+ regulatory T cells. J Exp Med 2005;201(7):1061-7 doi 10.1084/jem.20042276.

9. Liu Y, Zhang P, Li J, Kulkarni AB, Perruche S, Chen W. A critical function for TGF-beta signaling in the development of natural CD4+CD25+Foxp3+ regulatory T cells. Nat Immunol 2008;9(6):632-40 doi 10.1038/ni.1607.

10. Takimoto T, Wakabayashi Y, Sekiya T, Inoue N, Morita R, Ichiyama K, et al. Smad2 and Smad3 are redundantly essential for the TGF-beta-mediated regulation of regulatory T plasticity and Th1 development. J Immunol 2010;185(2):842-55 doi 10.4049/jimmunol.0904100.

11. Wu C, Thalhamer T, Franca RF, Xiao S, Wang C, Hotta C, et al. Galectin-9-CD44 interaction enhances stability and function of adaptive regulatory T cells. Immunity 2014;41(2):270-82 doi 10.1016/j.immuni.2014.06.011.

12. Dong J, Feldmann G, Huang J, Wu S, Zhang N, Comerford SA, et al. Elucidation of a universal size-control mechanism in Drosophila and mammals. Cell 2007;130(6):1120-33 doi 10.1016/j.cell.2007.07.019.

13. Yu FX, Zhao B, Guan KL. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell 2015;163(4):811-28 doi 10.1016/j.cell.2015.10.044.

14. Pan D. The hippo signaling pathway in development and cancer. Dev Cell 2010;19(4):491-505 doi 10.1016/j.devcel.2010.09.011.

15. Kapoor A, Yao W, Ying H, Hua S, Liewen A, Wang Q, et al. Yap1 activation enables bypass of oncogenic Kras addiction in pancreatic cancer. Cell 2014;158(1):185-97 doi 10.1016/j.cell.2014.06.003.




32

16. Shao DD, Xue W, Krall EB, Bhutkar A, Piccioni F, Wang X, et al. KRAS and YAP1 converge to regulate EMT and tumor survival. Cell 2014;158(1):171-84 doi 10.1016/j.cell.2014.06.004.

17. Ganem NJ, Cornils H, Chiu SY, O'Rourke KP, Arnaud J, Yimlamai D, et al. Cytokinesis failure triggers hippo tumor suppressor pathway activation. Cell 2014;158(4):833-48 doi 10.1016/j.cell.2014.06.029.

18. Varelas X, Samavarchi-Tehrani P, Narimatsu M, Weiss A, Cockburn K, Larsen BG, et al. The Crumbs complex couples cell density sensing to Hippo-dependent control of the TGF-beta-SMAD pathway. Dev Cell 2010;19(6):831-44 doi 10.1016/j.devcel.2010.11.012.

19. Fujii M, Toyoda T, Nakanishi H, Yatabe Y, Sato A, Matsudaira Y, et al. TGF-beta synergizes with defects in the Hippo pathway to stimulate human malignant mesothelioma growth. J Exp Med 2012;209(3):479-94 doi 10.1084/jem.20111653.

20. Nishikawa H, Sakaguchi S. Regulatory T cells in tumor immunity. Int J Cancer 2010;127(4):759-67 doi 10.1002/ijc.25429.

21. Klages K, Mayer CT, Lahl K, Loddenkemper C, Teng MW, Ngiow SF, et al. Selective depletion of Foxp3+ regulatory T cells improves effective therapeutic vaccination against established melanoma. Cancer Res 2010;70(20):7788-99 doi 10.1158/0008-5472.CAN-10-1736.

22. Curran MA, Montalvo W, Yagita H, Allison JP. PD-1 and CTLA-4 combination blockade expands infiltrating T cells and reduces regulatory T and myeloid cells within B16 melanoma tumors. Proc Natl Acad Sci U S A 2010;107(9):4275-80 doi 10.1073/pnas.0915174107.

23. Snyder A, Wolchok JD, Chan TA. Genetic basis for clinical response to CTLA-4 blockade. N Engl J Med 2015;372(8):783 doi 10.1056/NEJMc1415938.

24. Callahan MK, Postow MA, Wolchok JD. CTLA-4 and PD-1 Pathway Blockade: Combinations in the Clinic. Front Oncol 2014;4:385 doi 10.3389/fonc.2014.00385.

25. Topalian SL, Drake CG, Pardoll DM. Immune checkpoint blockade: a common denominator approach to cancer therapy. Cancer Cell 2015;27(4):450-61 doi 10.1016/j.ccell.2015.03.001.

26. Duraiswamy J, Kaluza KM, Freeman GJ, Coukos G. Dual blockade of PD-1 and CTLA-4 combined with tumor vaccine effectively restores T-cell rejection function in tumors. Cancer Res 2013;73(12):3591-603 doi 10.1158/0008-5472.CAN-12-4100.

27. Sommermeyer D, Hudecek M, Kosasih PL, Gogishvili T, Maloney DG, Turtle CJ, et al. Chimeric antigen receptor-modified T cells derived from defined CD8 and CD4 subsets confer superior antitumor reactivity in vivo. Leukemia 2015 doi 10.1038/leu.2015.247.

28. Jensen MC, Riddell SR. Design and implementation of adoptive therapy with chimeric antigen receptor-modified T cells. Immunol Rev 2014;257(1):127-44 doi 10.1111/imr.12139.

29. Liu-Chittenden Y, Huang B, Shim JS, Chen Q, Lee SJ, Anders RA, et al. Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the




33

oncogenic activity of YAP. Genes Dev 2012;26(12):1300-5 doi 10.1101/gad.192856.112.

30. Schmierer B, Schuster MK, Shkumatava A, Kuchler K. Activin a signaling induces Smad2, but not Smad3, requiring protein kinase a activity in granulosa cells from the avian ovary. J Biol Chem 2003;278(23):21197-203 doi 10.1074/jbc.M212425200.

31. Huber S, Stahl FR, Schrader J, Luth S, Presser K, Carambia A, et al. Activin a promotes the TGF-beta-induced conversion of CD4+CD25- T cells into Foxp3+ induced regulatory T cells. J Immunol 2009;182(8):4633-40 doi 10.4049/jimmunol.0803143.

32. Miller AM, Lundberg K, Ozenci V, Banham AH, Hellstrom M, Egevad L, et al. CD4+CD25high T cells are enriched in the tumor and peripheral blood of prostate cancer patients. J Immunol 2006;177(10):7398-405.

33. Josefowicz SZ, Niec RE, Kim HY, Treuting P, Chinen T, Zheng Y, et al. Extrathymically generated regulatory T cells control mucosal TH2 inflammation. Nature 2012;482(7385):395-9 doi 10.1038/nature10772.

34. Zheng SG, Wang J, Horwitz DA. Cutting edge: Foxp3+CD4+CD25+ regulatory T cells induced by IL-2 and TGF-beta are resistant to Th17 conversion by IL-6. J Immunol 2008;180(11):7112-6.

35. Ouyang W, Beckett O, Ma Q, Li MO. Transforming growth factor-beta signaling curbs thymic negative selection promoting regulatory T cell development. Immunity 2010;32(5):642-53 doi 10.1016/j.immuni.2010.04.012.

36. Worthington JJ, Kelly A, Smedley C, Bauche D, Campbell S, Marie JC, et al. Integrin alphavbeta8-Mediated TGF-beta Activation by Effector Regulatory T Cells Is Essential for Suppression of T-Cell-Mediated Inflammation. Immunity 2015;42(5):903-15 doi 10.1016/j.immuni.2015.04.012.

37. Loomans HA, Andl CD. Intertwining of Activin A and TGFbeta Signaling: Dual Roles in Cancer Progression and Cancer Cell Invasion. Cancers (Basel) 2014;7(1):70-91 doi 10.3390/cancers7010070.

38. Lonardo E, Hermann PC, Mueller MT, Huber S, Balic A, Miranda-Lorenzo I, et al. Nodal/Activin signaling drives self-renewal and tumorigenicity of pancreatic cancer stem cells and provides a target for combined drug therapy. Cell Stem Cell 2011;9(5):433-46 doi 10.1016/j.stem.2011.10.001.

39. Moroishi T, Hansen CG, Guan KL. The emerging roles of YAP and TAZ in cancer. Nat Rev Cancer 2015;15(2):73-9 doi 10.1038/nrc3876.

40. Li J, Du X, Shi H, Deng K, Chi H, Tao W. Mammalian Sterile 20-like Kinase 1 (Mst1) Enhances the Stability of Forkhead Box P3 (Foxp3) and the Function of Regulatory T Cells by Modulating Foxp3 Acetylation. J Biol Chem 2015;290(52):30762-70 doi 10.1074/jbc.M115.668442.

41. Geng J, Yu S, Zhao H, Sun X, Li X, Wang P, et al. The transcriptional coactivator TAZ regulates reciprocal differentiation of TH17 cells and Treg cells. Nat Immunol 2017;18(7):800-12 doi 10.1038/ni.3748.

42. Park BV, Freeman ZT, Ghasemzadeh A, Chattergoon MA, Rutebemberwa A, Steigner J, et al. TGFbeta1-Mediated SMAD3 Enhances PD-1 Expression on Antigen-Specific T Cells in Cancer. Cancer Discov 2016;6(12):1366-81 doi 10.1158/2159-8290.CD-15-1347.




34

43. Miyara M, Yoshioka Y, Kitoh A, Shima T, Wing K, Niwa A, et al. Functional delineation and differentiation dynamics of human CD4+ T cells expressing the FoxP3 transcription factor. Immunity 2009;30(6):899-911 doi 10.1016/j.immuni.2009.03.019.

44. Pan F, Yu H, Dang EV, Barbi J, Pan X, Grosso JF, et al. Eos mediates Foxp3-dependent gene silencing in CD4+ regulatory T cells. Science 2009;325(5944):1142-6 doi 10.1126/science.1176077.

45. Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 2012;7(3):562-78 doi 10.1038/nprot.2012.016.

46. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 2005;102(43):15545-50 doi 10.1073/pnas.0506580102.

47. Dang EV, Barbi J, Yang HY, Jinasena D, Yu H, Zheng Y, et al. Control of T(H)17/T(reg) balance by hypoxia-inducible factor 1. Cell 2011;146(5):772-84 doi 10.1016/j.cell.2011.07.033.

FIGURE LEGENDS

Figure 1. Expression of YAP mRNA and protein by Thelper subsets. Naïve CD4+ T cells

(CD4+ CD25- CD62L+) were isolated from the spleen and lymph nodes of wild-type (WT)

C57BL/6 mice and activated under polarizing conditions to generate the indicated Thelper

subset. The cells were harvested for different time points and mRNA or protein levels of YAP

were assessed by (A) qRT-PCR and (B) western blot. (C) Human Tregs (CD3+/CD4+/CD8–

/CD25HIGH/CD127low/CD39+) and non-Treg CD4+ T cells were obtained from the peripheral

blood of healthy donors by FACS after Ficoll-Paque PLUS gradient centrifugation and magnetic

bead enrichment of CD4+ T cells. YAP mRNA was measured by qRT-PCR. For A and B, shown

are representative findings from at least 3 independent experiments (mean +/-SEM of triplicates

for A). For C, mean expression of YAP mRNA is shown for 10 healthy human donor samples.

The data were analyzed using the Student t test and considered significant if *, p<0.05;**,

p<0.01; ****, p<0.001.




35

Figure 2. The effects of YAP-deficiency on CD4+ T cell subsets. (A-C) Naïve CD4+ T cells

(CD4+ CD25- CD62L+) were isolated from wild-type (WT) YAPfl/fl CD4Cre- or YAP fl/fl

CD4Cre+ (YAP cKO) mice (n= 5/group/experiment) and were activated under the indicated

polarizing conditions for 4 days. The cells were harvested and signature cytokines and

transcription factors for each Th subset were assessed by flow cytometry and qRT-PCR. Shown

in A and B are representative flow cytometry results and the mean percentage of cells +/- SEM

from at least 3 independent experiments. C depicts the relative expression level of IL-17A

transcript during the early stages of Th17 cell differentiation for WT and YAP cKO derive cells

+/-SEM. (D) iTreg differentiation of WT (YAPfl/fl Foxp3Cre-), and Foxp3Cre-driven YAP

knockout mice (YAPfl/fl Foxp3Cre+). Naïve CD4+ T cells were isolated from the indicated mice

as above before activation in the presence of IL-2 and varying concentrations of TGFβ. Treg

differentiation was assessed by intracellular staining for Foxp3 and flow cytometry analysis.

Shown are representative histograms (left panels) and the mean fluorescence intensity of Foxp3

staining (MFI) was found in at least 3 independent experiments average MFI +/-SEM are

shown. (E) The suppressive function of WT or YAP cKO derived Tregs (CD4+ CD25HIGH T cells

FACS isolated from lymph node and spleen cell suspensions) was determined using an in vitro

suppression assay. Naïve CD4+ T cells (responders) and Tregs were isolated from the

indicated mice (n= 5/group/experiment). WT responders were pre-stained with CFSE and co-

cultured with WT and YAP cKO derived Tregs at the indicated ratios. The cultures were

activated with anti-CD3/anti-CD28-conjugated beads at a cell to bead ratio of 1:1. The

percentage of proliferating (CFSELOW) responder cells in each culture was determined by flow

cytometry. Shown are representative histograms (upper panel) and the mean percentages of

proliferating cells +/-SEM over at least 3 independent experiments (lower panel). For A-E,

significant differences were determined by the Student t test (*p<0.05; **p<0.02; ***p<0.002; ns:

not significant).




36

Figure 3. The impact of T cell- and Treg- restricted YAP-deficiency and YAP inhibition on

the anti-tumor response. Wild-type (WT; n= 5) or YAP fl/fl CD4Cre+ (YAP cKO; n= 5) mice

were challenged with 5x105 B16-melanoma cells (s.c.) and the tumor dimensions were

measured every 2 days and tumor volume was calculated (A, B). On Day 21, the mice were

euthanized and tumor-infiltrating lymphocytes (TILs) were isolated from the excised tumors. (C)

TILs were gated on CD4+ and CD8+ T cells and effector cytokines IFN-γ and TNF-α levels were

measured by flow cytometry. (D) Tumor challenge of YAPfl/fl Foxp3Cre+ mice (n= 4) and WT

controls (n= 6) was carried out as above, and the frequencies of IFNγ- and IL-17-producing

leukocytes within the B16 TILs of these mice were determined by flow cytometry (E, left). Mean

frequencies of IFNγ+ TILs as well as the number of IFNγ+/CD4+ and IFNγ+/CD8+ per gram of

tumor tissue (+/- SEM) are also shown (E, middle and right panels, respectively) from at least 3

independent experiments. (F) Proportions of Foxp3+ Tregs within the TILs of WT and YAPfl/fl

Foxp3Cre+ mice (left) were also found by intracellular staining followed by flow cytometry

analysis. Average Treg frequencies amongst CD4+ TILs were found as where and the ratio of

tumor CD8+ T cell-to-Foxp3+ Treg numbers are also shown (center and right, respectively). (G)

Targeting YAP improves the anti-tumor effects of immunotherapies. C57BL/6 mice were

challenged with B16-melanoma cells and tumor progression was monitored as above

mentioned. Cohorts of mice were treated with i.p. injected VP, GM-Vac, anti-PD1 antibody, VP

and anti-PD-1, or VP and GM-Vac beginning day 7 post-tumor injection. Control mice were left

untreated (n=5/group). Shown are the mean tumor volumes for the groups +/- SEM. (H)

Characterization of TILs from treated and control mice were also determined by flow cytometry.

The frequencies of IFNγ-producing CD4+ and CD8+ T cells as well as the ratio of tumor CD4+

and CD8+ T cell numbers to Foxp3+ Treg numbers were also. For A, D, and G, the mean tumor

volumes for the groups are shown over time +/- SEM. Bar graphs in C, E, F, and H depict the

mean frequency (%), ratio or absolute number/gram tumor of the indicated immune cell subset

+/- SEM in 3 independent experiments. All other findings are representative of at least two




37

independent experiments. Statistically significant differences were determined by t test for all

panels except for G where a two-way ANOVA was used.

Figure 4. RNASeq analysis of wild type and YAP-deficient Treg transcriptomes. Genes

that had their expression level significantly changed by YAP knockout in naive CD4+ T cells,

unstimulated Tregs, or stimulated Tregs were determined by RNASeq. Results are presented as

a heat map. Genes are arranged based on the Fold Change in expression between WT and

YAP-deficient Tregs (Genes with a Fold Change of more than 3 are shown). The color

representation from green to red denotes log2-transformed FPKM from -2 to 2.

Figure 5. YAP drives ACVR1C transcription through molecular cooperation with TEAD.

(A) Shown is a portion (1.2kb) of the murine AcVR1c promoter with TEAD binding sites

determined by transcription factor prediction software. (B) Design schema of luciferase-based

AcVR1c reporter constructs (C) AcVR1c Reporter Assays. The mAcVR1c-wt reporter construct

was co-transfected into Jurkat T cells along with the indicated YAP and TEAD expression

constructs or an Empty Vector control. Cells were cultured with or without PMA/ionomycin

activation for 8 hrs prior to harvest and cell lysis. Luciferase activity was determined as

previously described (47). (D) As in C, YAP and TEAD expression were delivered to Jurkat T

cells, except cells received variants of the mAcVR1c reporter possessing one, both, or none of

the identified TEAD binding sites. Reporter activity was determined as in C. For both C and D,

the mean relative luciferase values +/-SEM are shown for the results of 3 independent

experiments. (E) A chromatin immunoprecipitation (ChIP) assay was carried out in iTregs

generated from WT- and YAP cKO-derived naïve CD4+ T cells. The ability of antibodies against

TEAD1 and YAP to pull down the indicated factors along with the AcVR1c promoter region was

calculated based upon qPCR relative to a control immunoglobulin G (IgG). The relative




38

enrichment for each factor over 3 experiments are shown (+/-SEM). Significant differences for

all experiments shown were determined by the Student t test.

Figure 6. The YAP/Activin/ACVR1C pathway enhances SMAD activation, Treg generation

and function, and tumor progression. (A) Freshly isolated CD4+CD25- T cells were isolated

from the lymphoid tissues of WT mice (n= 6/experiment), cultured with plate bound anti-CD3

(2µg/ml) and soluble anti-CD28 (2µg/ml) for 24 hrs, followed by treatment with different

concentrations of Activin A and TGFβ as indicated for an additional 12 hours. Cells were

harvested and subjected to SDS-PAGE and Western blot with the indicated antibodies (left

panel). Band densities indicating protein amount were quantified by using Image J software,

normalized to β-actin loading controls, and the mean density +/-SEM across 3 independent

experiments were found (right panel). (B) Naïve CD4+ T cells from YAPfl/fl, Foxp3Cre+ and

YAPwt/wt, Foxp3Cre+ (WT) mice (n= 6/group/experiment) were stimulated with andti-

CD3/CD28 antibodies (1 and 4 µg/ml, respectively) for 3 days in the presence of IL-2 (100U/ml)

and the indicated doses of TGF and exogenous Activin A. Activin was dosed at 50ng/ml on

day 0 and day 2. Treg induction was assessed by flow cytometric detection of intracellular

Foxp3. Shown are representative Foxp3 stainings (left panel) and the mean results of 3

independent experiments +/- SEM (right) (C) Effect of ectopic AcVR1c expression on YAP-

deficient Tregs. As before, WT responder T cells and Tregs were isolated from the indicated

mice (n= 6/group/experiment). Following lentiviral delivery of an ACVR1C over-expression

construct or an empty vector control construct to YAPfl/fl Foxp3Cre+ Tregs (activated ex vivo

overnight with anti-CD3/CD28 antibodies and IL-2), the functional capacity of these cells were

assessed in vitro. The transduced Tregs were co-cultured with CFSE-stained CD45.1+ naïve

CD4+ T cells (responders) at the indicated ratio and antigen presenting cells (T cell-depleted

splenocytes). After 5 days of activation, responder cell proliferation was assessed by flow

cytometry. Shown at left are representative plots of responder cell gated (CD45.1+/CD4+)




39

events from one of two independent experiments with like results. The immunoblot at right

confirms expression levels of AcVR1c in transduced Tregs, and the bar graph (lower right

panel) depicts the mean fraction of proliferating responder cells over all experiments +/-SEM.

Where indicated by asterisks, significant differences were found by the Student t test.

Figure 7. Activin blockade and AcVR1c-deficiency slows B16 tumor growth and

enhances the anti-tumor immune response. (A) B16 melanoma cells were injected into

individual female C57BL/6 mice (8-12 weeks of age). Tumor-bearing mice were randomly

assigned into treatment groups once tumors were palpable ~7 days post-injection. Anti-activin A

antibodies (R&D Systems) were administered (100 µg/mouse/injection) intraperitoneally twice a

week once to one group. Another group received like does of control IgG1. Other cohorts of

tumor-bearing mice received GM-vaccine (100 µl of 1x106 lethally irradiated (150Gy) B16 GM-

vaccine cells or combined anti-Activin/GM-vaccine treatment (n=10 mice per group). (B) Treg

frequencies among the TILs of treated mice. Intracellular staining of Foxp3 in CD4+ TILs from

the indicated treatment groups were determined by flow cytometry. (C) IFNγ-producing CD4+

and CD8+ T cells recovered from tumor cell suspensions were similarly assessed. (D) The right

flank of 8-week WT and AcVR1cKO female mice (C57BL/6 background; n=8/group) were

injected with 4x105 B16 cells in 100 μl PBS. (E) The proportions of IFNγ- and TNFα-expressing

T cells (CD3+) with the TILs of these mice were determined by flow cytometry (F) as where the

frequencies of Foxp3 and IL-17+ CD4+ T cells. For (A) and (D) Tumor development and

changes in tumor volume were recorded for all groups and the mean volume +/-SEM for each

are displayed. For B, C, E and F, representative flow plots from a single mice from each group

are depicted (left panels) alongside the mean cell frequencies across 3 independent

experiments (right panels). All experiments were repeated at least three times. Significant

differences were determined by a Student t test for all panels, except A were a two-way ANOVA

was used.




A B

Figure 1

Th1 Th2 Treg Th17

Anti-YAP

anti-actin

C

YAP

mR

NA

exp

ress

ion

****

N a iv e T h 0 T h 1 T h 2 T h 1 7 T r e g

0

2 0

4 0

6 0

8 0

1 0 0

**

CD4+Non Treg Treg

YAP

mR

NA

exp

ress

ion




A B

C

D

E

Figure 2

WT

YAP cKO

CFSE

8:1 4:1 2:1 1:1 Unstimulated 1:0 Teff:Treg

1 :1 2 :1 4 :1 8 :1

0

2 0

4 0

6 0

8 0

1 0 0

% P

rolif

erat

ion

Teff:Treg

*

****

****

ns WT YAP cKO

Foxp3

Co

un

t

0 0.05 0.1 0.5 5 TGF-β (ng/ml)

WT

YAP fl/fl Foxp3Cre+

Isotype control

0 0 .0 5 0 .1 0 .5 5

0

1 0 0

2 0 0

3 0 0

4 0 0

Foxp

3 M

FI

TGF-β (ng/ml)

* *

* ns ns

WT YAP fl/fl Foxp3Cre+

IL -2 IF N -

0

2 0

4 0

6 0

8 0

1 0 0

ns

*

% c

ells

WT YAP cKO

WT YAP cKO

IL-2

IFN

-

CD4+ WT YAP cKO

Foxp3

IL-1

7A

CD4+

IL -1 7 A F o x p 3

0

1 0

2 0

3 0

4 0

5 0WT YAP cKO

*

***

% c

ells

W T N a iv e 6 h r s 1 2 h r s

0

1 0 0

2 0 0

3 0 0

4 0 0

5 0 0

IL-1

7A

Rel

ativ

e Ex

pre

ssio

n

**

*** WT YAP cKO




D E

F G

H

IL-17

IFNγ

WT

YAP fl/fl Foxp3Cre+

CD4+ TILs

WT

YAP fl/fl Foxp3Cre+

CD4

Foxp

3

0

500

1000

1500

2000

2500

3000

4 7 10 13 16 17 19 21

YapFl/Fl Foxp3Cre-

YapFl/Fl Foxp3Cre+

Tum

or

Vo

lum

e (m

m^3

)

Days post-injection

*

*

A B C

Figure 3

0

2

4

6

8

CD

4+

Fo

xp

3-/

CD

4+

Fo

xp

3+

* *

* *

CD

4+F

oxp

3-/

CD

4+Fo

xp3+

0

2

4

6

8

1 0

1 2

CD

8+

/C

D4

+F

ox

p3

+

* *

* *

CD

8+/

CD

4+F

oxp

3+

0

1 0

2 0

3 0

4 0

%IF

N-

+C

D4

+

* *

* *

%C

D4

+IFN

γ

0

1 0

2 0

3 0

4 0

5 0

6 0

7 0

%IF

N+

CD

8+

*

* *

%C

D8

+IFN

γ

0

2

4

6

8

10

12

14

16

18

% T

ILs IFNγ+

** **

**


****

0

5

10

15

20

25

30

35*

% F

oxp

3+

of

CD

4+

TILs

0

1

2

3

4

5

6

7

8

CD

8+/

Treg

Rat

io

*

WT YAP fl/fl Foxp3cre+

C D 8+

IF N +

T N F+

C D 4+ I

F N +

T N F+

0

1 0

2 0

3 0

4 0

% c

ells

WT YAP cKO

* *

CD8+IFN-γ+

TNF-α+ CD4+IFN-γ+

TNF-α+

WT

YAP cKO

1 1 1 3 1 5 1 7 1 9 2 1

0

4 0 0

8 0 0

1 2 0 0

Tum

or

Vo

lum

e (m

m3)

*

****

ns ns ns

WT YAP cKO

Days

0

1

2

3

4

5

6

Nu

mb

er o

f IF

NΥ+

CD

4+

ce

lls/

g

of

tum

or

(x1

0^4

)

0

5

10

15

20

25

Nu

mb

er o

f IF

NΥ+

CD

8+

cel

ls/

g o

f tu

mo

r (x

10

^4)

Tum

or

Vo

lum

e (m

m3)

Days post-injection

*

*

*




B

WT YAP cKO WT WT YAP cKO YAP cKO

Naïve T cells Unstim nTreg Stim nTreg

log2(fold change) KO Treg/WT Treg

Figure 4

A




TEAD Consensus Binding Sites: CATTCC

Partial mouse AcVR1c promoter sequence

TGAGCAAT//TACCTCCCTCCTCCAGTTGCTAACTC

TGTAACTGCAGAGATACCTTCTACGTGTCTGTGTCT

GTGTCTGGTCCTTTACTTCCATTCCTCATTATAGAT

GGCTATGCCACCTGGCACAGTTGTCTCAGCTTTGTG

CATCGTTTTTATAGGGCACATGAAGTCTTGAGATGA

GGACAGGAATGAATGGAGTTTGTTTGGTAAAACAGA

GCTGTGTGGTCTGAAGGCAATGGTGCTTGGGGTCCT

TTTCAGGGAGTCACAGAGAGAGAGAGC//TGTCAGG

GTGGGGCAGGTCTGGAGGAACAGCCTGTGGTGTTGT

A B

Figure 5

C

E

D

0

20

40

60

80

100

120

140

160

180

200

mock

PMA/Iono

Rel

ativ

e Lu

cife

rase

Val

ue

EV

TEAD1

YAP1 WT

YAP1 Mut S94A

+ +

+ + + +

+

_ _ _ _

_ _ _ _

_ _ _ _

_

*** ***

0

50

100

150

200

250

Mock

PMA/Iono

Rel

ativ

e Lu

cife

rase

Val

ue

AcVR1c-Luc WT

AcVR1c-Luc Mut1

AcVR1c-Luc Mut2

AcVR1c-Luc Muts

+

+

+

+

_ _ _

_ _ _

_

_ _ _

_ _

**

***

***

0

5

10

15

20

25

Rel

ativ

e en

rich

me

nt

IgG TEAD1 YAP1 IgG TEAD1 YAP1

WT YAP cKO

**

**

**




A

C

B

Figure 6 C

ou

nt

CFSE (Teff)

YAP fl/fl Foxp3Cre+ LV-Ctrl

YAP fl/fl Foxp3Cre+ LV-AcVR1c

WT

1:2 1:4 1:8 1:16 Treg:Teff

Foxp3


+act./-TGF-β +act./+ TGF-β (0.075 ng/ml) -act./- TGF-β -act./+ TGF-β (0.075 ng/ml)

+ a c t ./ -T

GF -

+ a c t ./ + T G

F -

-ac t .

/ -TG

F -

-ac t .

/ + T GF -

0

1 0 0

2 0 0

3 0 0

4 0 0

Foxp

3 M

FI


****

*

ns *

WT YAP fl/fl Foxp3Cre+ LV-Ctrl

1 :2 1 :4 1 :8 1 :1 6

0

2 0

4 0

6 0

8 0

1 0 0

YAP fl/fl Foxp3Cre+ LV-AcVR1c

% P

rolif

erat

ion

****

ns ****

ns ****

** *

****

Activin A

P-Smad2/3

Total-Smad2/3

β-Actin

TGF-β

0

0 0

5

0.5

0

0.5

5

0

10

2

0

2

10 (ng/ml)

Activin A

TGF-β

0

0 0

5

0.5

0

0.5

5

0

10

2

0

2

10

(ng/ml) 0

5 0

1 0 0

1 5 0

*

*

P-S

mad

2/3

/Act

in




A

C

B

D

Figure 7

E

Days

Tu

mo

r V

olu

me

(mm

3)

0

100

200

300

400

500

600

7 9 11 13 15 17 19 21 23 25

IgG1

anti-activin A

anti-activin A+GM-Vac

GM-Vac

* *

*

*

CD3+ TIL

lgG

1

a nt i

-ac t i

v inA

GM

-Va c

a nt i

-ac t i

v inA

+ GM

-Va c

0

2 0

4 0

6 0

8 0*

ns

**

ns

ns

*

% F

oxp

3+

of

CD

4+

lgG1 anti-activinA GM-Vac anti-activinA+GM-Vac

C D 3+

C D 8+

C D 3+

C D 4+

0

2 0

4 0

6 0

% IF

N-γ

*

*

ns

ns ns ns

** **

**** **

ns *

F

IFN

-γ

CD4

IFN

-γ

CD8

lgG1 anti-activin A GM-Vac anti-activin A+GM-Vac

CD3+CD4+ TIL

Foxp

3

CD4

Foxp

3

CD4

lgG1 anti-activin A

GM-Vac anti-activin A+GM-Vac

% IF

N-γ

+

WT AcVR1c KO

*

*

C D 3+

C D 4+

C D 3+

C D 8+

0

2 0

4 0

6 0

8 0

CD3+CD4+ CD3+CD8+

CD3+ TIL

IFN

-γ

TNF-α

WT AcVR1c KO

*

% F

oxp

3+

of

CD

4+

W t K o

0

1 0

2 0

3 0

4 0

5 0

WT AcVR1c KO

Foxp

3

IL-17

WT AcVR1c KO CD4+

1 3 1 5 1 7 1 9 2 1 2 3

0

5 0 0

1 0 0 0

1 5 0 0

Tum

or

Vo

lum

e (m

m3)

*

**

ns ns

ns

WT

AcVR1c KO

Days

*




Published OnlineFirst June 15, 2018.Cancer Discov Xuhao Ni, Jinhui Tao, Joseph Barbi, et al. immunityYAP is essential for Treg mediated suppression of anti-tumor

Updated version

10.1158/2159-8290.CD-17-1124doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerdiscovery.aacrjournals.org/content/suppl/2018/06/15/2159-8290.CD-17-1124.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerdiscovery.aacrjournals.org/content/early/2018/06/15/2159-8290.CD-17-1124To request permission to re-use all or part of this article, use this link



http://cancerdiscovery.aacrjournals.org/lookup/doi/10.1158/2159-8290.CD-17-1124

http://cancerdiscovery.aacrjournals.org/content/suppl/2018/06/15/2159-8290.CD-17-1124.DC1

http://cancerdiscovery.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerdiscovery.aacrjournals.org/content/early/2018/06/15/2159-8290.CD-17-1124


YAP is essential for Treg mediated suppression of …...2018/06/15 · tumor immunity and the...

Documents

Transcript of YAP is essential for Treg mediated suppression of …...2018/06/15 · tumor immunity and the...