What Is Microarray A new powerful technology for biological exploration Parallel High-throughput...

32
What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale

Transcript of What Is Microarray A new powerful technology for biological exploration Parallel High-throughput...

Page 1: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

What Is Microarray A new powerful technology for

biological exploration Parallel High-throughput Large-scale Genomic scale

Page 2: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Microarray

Page 3: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.
Page 4: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

ATATCGGCATCAGTCGATCGATCATCGATCGAT

UAUAGCCGUAGUCAGCUAGCUAGUAGCUAGCUA

ATATCGGCATCAGTCGATCGATCATCGATCGAT

DNA

mRNA

cDNA

DNA RNA Protein

Transcription

Reverse transcription

TranslationReplication

Page 5: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.
Page 6: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

What Is Microarray Different Approaches

Stanford/Synteni

Affymetrix

How DNA sequences are laid down

Spotting Photolithography

Length of DNA sequences

cDNA(Complete sequences)

Oligonucleotides

Page 7: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Affymetrix Probe Array (Photolithography)

Synthesis of probe

Hybridization

Page 8: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Stanford Approach Use robot to spot glass slides Able to measure qualitatively relative

expression levels of genes Differential expression by use of simultan

eous, two-color fluorescence hybridisation

Cheaper with DIY ($60,000) Also called home-made system

Page 9: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Life Cycle(cont.)

Cy3(green)

Cy5(red)

Page 10: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Procedures Preparation

Target DNA (reference and test samples) Slides

Reaction(Droplet or Pin Spotting) Hybridization

Scanning Analysis

Image processing Data mining Modeling

ArrayerScanner

Hardware

Software

Page 11: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Instruments Arrayer Scanner

Laser Confocal Microscope

Page 12: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Arrayer

Page 13: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Scanner GenPix 4000

Page 14: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.
Page 15: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.
Page 16: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.
Page 17: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Problems – by direct view

Anti-probe Locally high background Spot overlap

Precipitate Locally low signal Comet-tails (donut hole)

Page 18: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Problems –related wit IP Local problems

Spot position variation Spot shape and size irregularity Spot Overlapping

Global problems High background Low signal White-noise/Speckle effect

(Contamination)

Page 19: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Array Alignment

Good Alignment Bad Alignment

Page 20: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Spot Finding Grid System Determination

Manual Semiautomatic Automatic

Spot Segmentation Space-based Intensity-based Frequency-based Hybrid approach

Page 21: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Grid System Determination

Page 22: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Spot Segmentation

Page 23: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Spot Segmentation(cont.)

Page 24: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Applications Gene expression studies

Gene function for cell state change in various conditions

Disease Diagnosis Pathogen Analysis

Page 25: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Applications(Cont.) Drug Discovery

identify appropriate molecular targets for therapeutic intervention

monitor changes in gene expression in response to drug treatments

Trageted Drug Treatment

Page 26: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Example Images – E. Coli

Page 27: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Example Images – C. Elegan

Page 28: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.
Page 29: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

1.75

…..

Log(R/G)

…..

Gene index

Page 30: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

…..

Log(R/G)

…..

…..

Log(R/G)

…..

…..

Log(R/G)

…..

Page 31: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

N gene

M experiments

…..

Page 32: What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.