Supplemental Materials:

Materials and Methods

Figures S1-S6

The histone H3.3K27M mutation in pediatric glioma reprograms H3K27 methylation and gene expression

Kui-Ming Chan#1, Dong Fang#1, Haiyun Gan1, Rintaro Hashizume2, Chuanhe Yu1, Mark Schroeder3, Nalin Gupta2, Sabine Mueller2, C. David James2, Robert Jenkins4, Jann

Sarkaria3 and Zhiguo Zhang*1

1Department of Biochemistry and Molecular Biology,2Department of Neurological Surgery, University of California San Francisco

3Department of Radiation oncology 4Department of Laboratory Medicine Pathology

Mayo Clinic, Rochester, MN 55905

# These authors contribute equally to this work

Running title: Effect of H3K27M mutation on H3K27 methylation

*Corresponding authorCorresponding author: Zhang.Zhiguo@mayo.edu

Phone: 507-538-6074, Fax: 507-284-9759

Materials and Methods

AntibodiesH3K27me2 (#9728), H3K27me3 (#9733), EZH2 (#5246), SUZ12 (#3737) were purchased from Cell signaling. H3K4me3 (#07-473) and BMI1 (#05-637) were purchased from Millipore. α-Tubulin (#T9026) and Flag (F1804) antibodies were purchased from Sigma. Nestin antibody (#116066) was purchased from GeneTex. H3K9me3, H3K9Ac, H3K27Ac, histone H3 antibodies have been described(Chan et al. 2011; Chan and Zhang 2012)

ImmunofluorescenceCells grown on chamber slides (Nunc) or cover slips were washed briefly with PBS followed by fixation with 3% paraformaldehyde at room temperature for 12min. Cells were permeablilzed with 0.5% Triton X-100 solution for 5 min at room temperature and then blocked in 5% normal goat serum for1 hour. Primary antibodies with appropriate dilutions (Flag 1:70, H3K27me2 1:100, H3K27me3 1:100, HP1α 1:400, Bmi1 1:50 and Nestin 1: 500) were added to the cells and incubated at 37oC for 20 min or 4oC overnight. Cells were then washed with PBS twice and probed with FITC/Rhodamine-conjugated secondary antibodies at 37oC for 20min. DNA was stained with DAPI and samples were mounted with Gold anti fade reagents (Invitrogen) and examined using a Zeiss Axioplan Fluorescence microscope.

Mononucleosome ImmunoprecipitationCells were fixed with 1% formaldehyde for 3 min at room temperature and then quenched with 125mM glycine for 5min. Cells extracts were prepared following standard procedures. The chromatin was digested by Mnase （ NEB, M0247S ， 1u/1000 cells ） at 37℃ for 20mins. After clarification by centrifugation, the digested nucleosomes were incubated with 30 μl of M2 (anti-FLAG) beads at 4℃ overnight. The beads were then washed using washing buffer (50 mM HEPES-KOH, pH 7.4, 200 mM NaCl, 0.5% Triton X-100, 10% glycerol, 100mM EDTA and proteinase inhibitors) for 5 min × 4 times. Proteins were eluted by 1mg/ml FLAG peptides at 16℃ for 30mins and then concentrated by the TCA precipitation.

Plasmids and shRNAThe shRNAs used to knockdown Ezh2 in mouse cells were purchased from Sigma #TRCN0000039040. Full-length and mutated forms of human H3.1 and H3.3 cDNA were cloned into pQCXIP vector for expression in 293T cells, MEF cells and human astrocytes cells.

Quantitative RT-PCRTotal RNA was extracted using the miRNeasy Mini Kit (Qiagen #217004). cDNA was synthesized using 0.5 μg of total RNA using random hexamer (Invitrogen). Real-rime PCR was performed in a 25 μL reaction containing 0.1μM gene-specific primers and SYBR Green PCR Master Mix (Bio-Rad). Primer sequences for genes tested are: CDK6 MN_001259 F 5’CGGAGAGCCGACTGACACTC, CDK6 MN_001259 R 5’ GAAGCTGGATGGA GAGACCTC, CDK6 MN_001145306 F 5’CTTCAGCCCTGCAG GGAAAG, CDK6 MN_001145306 R 5’CAGAAGCTGGATGGAGAGAC, OLIG2 RT F 5’GACGCCAGCCT GGTGTCCAG, OLIG2 RT R 5’GACGAGGATGACTTGAAGCC.

RNA-seq.Total RNA was extracted the same way as Quantitative RT-PCR. RNA-seq libraries were prepared with ovation RNA-seq system v2 kit (NuGEN) and the RNA-seq libraries were analyzed by Solexa/Illumina high-throughput sequencing. Reads from NSC, SF7761 and SF8628 were aligned to the human genome hg19 and to gene annotations from Refseq gene using TopHat v2.05 (Trapnell et al. 2009). Cufflinks v2.0.2(Trapnell et al. 2010) was used to quantify FPKM values. Cuffdiff to perform differential expression analysis use FDR < 0.01.

Chromatin Immunoprecipitation assay. Cells were fixed with 1% formaldehyde for 5 min at room temperature and then quenched with 125mM glycine for 5min. Cells extracts were prepared following standard procedures. The Chromatin was sheared by sonication (bioruptor) to average lengths of 500bp. Chromatin was immunoprecipitated using antibodies against (Histone H3, H3K4me3, H3K27me3, H3K27me3 and EZH2). Chromatin complexes were isolated with protein G beads and after extensive washing steps, the DNA was isolated with 10% Chelex-100 (Bio-Rad). The amount of specific DNA sequences recovered during each ChIP assay was quantified against input DNA (EZH2) or Histone H3 (H3K4me3, H3K27me2 and H3K27me3). Primers used for PCR are: CDK6 locus 1 F 5’CCCTCAGCTGGAAGACATCC, CDK6 locus 1 R 5’CTCCTAGAAGGGGACAAGAAC, CDK6 locus 2 F 5’ GCAGGGCTG AAGCCGTCTTC, CDK6 locus 2 R 5’GGTAGCGGCGCAACACAATG, OLIG2 F 5’CACGGGCG CCCATTGGT TGTG, OLIG2 R 5’GGCAGCGGTGGCGGGGGCGG.

Figures S1-S6

Fig. S1. (A) The H3F3A sequencing results of SF7761 and SF8628 cells. (B) The

expression of Ezh2 and Suz12 in two tumor lines (SF7761 and SF8628), one human

neural stem cell (hNSC) and one adult GBM line (39RG2) was analyzed by Western blot.

Lysates from MEFs infected with non-targeting (NT) shRNA and Ezh2 shRNA serve as

controls to show the specificity of the antibodies. Compared to NSC and GBM line

39RG2, the expressions of Ezh2 and Suz12 in tumor lines were not altered significantly.

(C) The expressions of Ezh2 and Suz12 in mutant 293T cells were not changed

significantly in cells expressing wild type, H3.1 or H3.3 mutant transgene with mutation

indicated above compared to normal 293T cells.

Fig. S2. Histone H3K36 methylation decreased in the ectopic expressed H3.3G34R

mutant histone. Western Blots of whole cell extracts from human astrocytes cells

expressing Flag-tagged, human wild-type (WT) or mutant (K27R, K27M, G34R) histone

H3.3 proteins. H3K36 methylation on the H3.3G34R transgene is reduced.

Fig. S3. H3K27me2 and H3K27Me3 are reduced in the cells expressing H3.1/H3.3

K27M mutant proteins. (A) The total levels of H3K27Me3 and H3K27Me2 were reduced in

293T cells exogenously expressing H3.1 K27M and H3.3 K27M transgene. HP1α was not

changed in all the mutant cells. (B) The H3K27Me3 was reduced in astrocyte cells expressing

the H3.3 K27M transgene. (C) The counting results of A and B. Immunofluorescence

analysis of H3K27me2 and H3K27me3 was described in experimental procedures. Bar chart

showing the percentage ofH3K27Me2 or H3K27Me3 positive cells in the total cells. (n>200).

Scale bar, 5μm.

Fig. S4. H3K27me2 and H3K27me3 are lost in MEFs expressing Histone H3.1 or H3.3

K27M mutant proteins. Histone marks H3K27me2 and H3K27me3 are lost in MEF

expressing H3.1/H3.3 K27M but not WT or G34R mutants. HPα and Bmi1 did not change in

any of these samples.

Fig. S5 Binding profiles EZH2 are shown for regions 20 kb upstream and downstream of all

H3K27me3 peaks in NSC and SF7761. The lower panel shows the Venn diagrams of overlap

between H3K27me3 and EZH2 peaks in NSC (left) and SF7761 (right) peaks.

Fig. S6 Average H3K4me3 occupancy plots for the three group genes from Fig 4a.

Normalized average H3K4me3 levels within 5 kb of the TSS are shown in NSC and SF7761.