VIRUSES OCCURRING IN POTATOES (Solanum tuberosum) IN

MBEYA REGION, TANZANIA.

Evangelista Chiunga

Master’s thesis

University of Helsinki

Department of Agricultural Sciences

Plant Production Science/ Plant Pathology

January, 2013

HELSINGIN YLIOPISTO HELSINGFORS UNIVERSITET UNIVERSITY OF

HELSINKI

Tiedekunta/Osasto Fakultet/Sektion Faculty

Faculty of Agriculture and Forestry

Laitos Institution Department

Department of Agricultural Sciences

Tekijä Författare Author

Evangelista Chiunga

Työn nimi Arbetets titel Title

Viruses occurring in potatoes (Solanum tuberosum) in Mbeya region, Tanzania.

Oppiaine Läroämne Subject

Plant Pathology (Plant Virology)

Työn laji Arbetets art Level

Master’s thesis

Aika Datum Month

and year

December, 2012

Sivumäärä Sidoantal Number

of pages

53

Tiivistelmä Referat Abstract

Potato leaf roll virus (PLRV), Potato virus Y (PVY), Potato virus X (PVX), Potato virus S (PVS),

Potato virus A (PVA), and Potato virus M (PVM) are widely distributed in potato (Solanum

tuberosum) all over the world. This study was conducted to establish if these viruses also infect potato

in Mbeya region, Tanzania. A total of 219 potato leaf samples from 13 farmers’ fields were collected.

Of these, 20 samples were pressed on FTA cards. Samples were screened for viruses by Double

Antibody Sandwich Enzyme Linked Immunosorbent Assay (DAS-ELISA). Those which were pressed

on FTA cards were further analysed by Reverse Transcription Polymerase Chain Reaction (RT-PCR).

Virus-like symptoms such as yellowish-green mosaic, leaf rolling and vein necrosis were observed

and recorded at the time of field sample collection. DAS-ELISA results suggested the occurrence of

all six viruses in samples from Mbeya region. RT-PCR analysis confirmed the presence of these

viruses except PVY. PVS and PLRV were the most prevalent viruses. Complete coat proteins (CP)

encoding sequence of five viruses (PLRV, PVX, PVA, PVS and PVM) were sequenced. Blast

searches detected presence of sequences in the GenBank sharing nucleotide sequence identities of

94%-100% with isolates of viruses sequenced in this study. The complete CP sequences of the

aforementioned viruses from the current study were closely related with virus isolates from different

countries. The Tanzania isolates of PLRV, PVX, PVA, PVS and PVM were each suggested to belong

to the one group as well as one isolate. These results are important in seed potato multiplication

systems in Tanzania for improving seed quality in the local seed potato chain, an important service

currently lacking to potato farmers in Tanzania.

Avainsanat Nyckelord Keywords

Potato, Potato virus S (PVS), Potato virus X (PVX), Potato leafroll virus (PLRV), Potato virus M

(PVM), Potato virus A, Potato virus Y (PVY), Solanum tuberosum, DAS-ELISA, RT-PCR.

Säilytyspaikka Förvaringsställe Where deposited

Department of Agricultural Sciences

Muita tietoja Övriga uppgifter Further information

Supervised by: Prof. Jari Valkonen

Table of Contents

1 INTRODUCTION .............................................................................................................. 4

1.1 Potato viruses in sub-Saharan Africa .......................................................................... 4

1.2 Potato production in Tanzania..................................................................................... 5

1.3 Potato viruses in Tanzania........................................................................................... 5

1.4 Potato viruses .............................................................................................................. 6

1.4.1 Potato virus Y (PVY) ........................................................................................... 6

1.4.2 Potato virus A (PVA) ........................................................................................... 7

1.4.3 Potato leaf roll virus (PLRV) .............................................................................. 8

1.4.4 Potato virus S (PVS) ............................................................................................ 9

1.4.5 Potato virus M (PVM) ......................................................................................... 9

1.4.6 Potato virus X (PVX) ......................................................................................... 10

2 OBJECTIVES ................................................................................................................... 12

3 MATERIALS AND METHODS. .................................................................................... 13

3.1 Sampling locations .................................................................................................... 13

3.2 Sampling in the field ................................................................................................. 14

3.3 ELISA........................................................................................................................ 14

3.4 Primer design............................................................................................................. 15

3.5 Elution and RT-PCR amplification of RNA from FTA cards .................................. 17

3.6 Purification and sequencing of the PCR products ..................................................... 18

3.7 Sequence analysis ...................................................................................................... 18

4 RESULTS ......................................................................................................................... 20

4.1 Virus symptoms observed on potato ......................................................................... 20

4.2 Viruses detected by DAS-ELISA .............................................................................. 21

4.3 Elution of total RNA from FTA cards ...................................................................... 24

4.4 Viruses detected by RT-PCR .................................................................................... 25

4.5 Phylogenetic relationships of virus isolates .............................................................. 27

5 DISCUSSION ................................................................................................................... 33

6 CONCLUSION ................................................................................................................ 38

7 ACKNOWLEDGEMENTS.............................................................................................. 39

8 REFERENCES ................................................................................................................. 40

9 APPENDICES .................................................................................................................. 49

4

1 INTRODUCTION

1.1 Potato viruses in sub-Saharan Africa

Potato (Solanum tuberosum) was introduced to sub-Saharan Africa (SSA) in the 19th

Century (Mih & Atiri 2001). Potato as a food crop ranks third in the world after rice

and wheat and first among root and tuber crops (FAOSTAT 2010a). It has been

known as one of the major crops to alleviate hunger in the world. The crop is

produced by several countries in SSA, with Malawi and South Africa having the

largest production (FAO 2008a). Potatoes are well known for their high quality

carbohydrate content, potassium and vitamins B and C and are a source of both food

and cash income in the densely populated highlands of SSA where rainfall is well

distributed for 3-4 months (Mih & Atiri 2001, FAO 2008b). The double purpose of

potato crop plays a significant role in the improvement of rural livelihood system

(Namwata et al. 2010).

Virus diseases constitute a major biotic constraint to potato production in developing

countries including those of SSA. The potato diseases caused by viruses are often

paid less or no attention because the symptoms are usually not as striking as those

associated by fungi and bacteria (Mih & Atiri 2001). About 40 viruses are known to

affect the potato crop (Valkonen 2007). The six important viruses in many countries

worldwide including those in SSA are Potato leaf roll virus (PLRV, genus

Polerovirus), Potato virus Y (PVY, genus Potyvirus), Potato virus X (PVX, genus

Potexvirus), Potato virus S (PVS, genus Carlavirus), Potato virus A (PVA, genus

Potyvirus), and Potato virus M (PVM, genus Carlavirus) (Singh 1999, Wangai &

Lelgut 2001). Potato viruses cause remarkable reductions in yield quality and

quantity of potato crop and several of them have been reported to infect potato in

SSA including PVY (Kenya, Ethiopia, Uganda and South Africa); PVX and PLRV

(Kenya and Uganda); and PVA (Kenya) (Gildemacher et al. 2009, Ibaba & Gubba

2011)

5

1.2 Potato production in Tanzania

Potato was introduced to Tanzania in the early 1920s. It is an important food and

cash crop, gaining importance both at the farm level and in urban markets

(Andersson 1996). In Tanzania, potato is the third most important food crop after

maize and rice. Potato production is concentrated in the two major growing zones,

the northern (Arusha, Kilimanjaro and Tanga regions) and southern highlands (Iringa

and Mbeya regions). About 90% of potato in Tanzania is produced in the southern

highlands and the remaining 10% is produced in the northern highlands (Namwata et

al. 2010). According to author’s observation, smallholder farmers (both men and

women) are the major producers of potatoes in Tanzania, growing the crop in

plots/fields ranging from 0.5 to 2 ha utilizing family labor.

1.3 Potato viruses in Tanzania

Despite the importance of potato as both a cash and food crop in Tanzania, lower

yields and poor crop quality have been major problems in its production due to lack

of improved agricultural technologies used by potato farmers in Tanzania (Namwata

et al. 2010). Moreover, virus diseases also have a major contribution to reduction of

potato yields in developing countries due to viruses that are passed from one

cropping season to another in tubers through vegetative propagation. Viruses affect

the potato plants in different ways such as rapid degeneration of potato tubers, severe

foliar damage, stunted growth and wilting. Levels of symptom expression depend on

cultivars, environmental conditions, age of crop and virus isolates. Thus, in order to

manage and control viruses, appropriate, sensitive, simple, economical and reliable

virus detection methods are needed (Khan et al. 2003, Mih & Atiri 2001

). Farmers in developing countries such as Tanzania know little about viral diseases

of potato and the symptoms, which makes them less concerned about the control

measures. They are not well informed about the effects of viruses on the quality,

quantity and the size of tubers harvested. This situation may be associated by the lack

of information on the occurrence and distribution of different potato viruses in

Tanzania though this is essential for crop protection and seed potato production.

6

1.4 Potato viruses

1.4.1 Potato virus Y (PVY)

PVY is a type member of genus Potyvirus in the family Potyviridae. The virus

was recognised in the early 20th

century and is transmitted in a non-persistent

manner by a wide range of aphid species as well as by vegetative propagation

of potato. Apart from potato, PVY is also capable of infecting tobacco, tomato

and pepper as well as wild species, especially those in Solanaceae family

(Brunt et al. 1996, Singh 1999). PVY is an economically important plant

pathogen and highly associated with potato degeneration, which causes a

significant loss of crops of up to 90%. The viral particle is non-enveloped,

filamentous, 730-740 nm long with a diameter of 11-12 nm and contains a

single-stranded RNA genome.

Figure 1. A schematic diagram of the PVY genome (polyprotein).

The genome of PVY is a positive-sense single-stranded RNA (+)ssRNA

molecule of about 10 kb in length, with a viral genome-linked protein (VPg)

attached covalently to the 5´ end and a poly(A) tail at the 3´end (Figure 1). The

viral RNA encodes eleven functional proteins: namely the first protein (P1),

helper component proteinase (HC-Pro), third protein (P3), Pretty

interesting Potyviridae ORF (PIPO) that is embedded within P3 cistron, first 6

kilodalton protein (6K1), cylindrical inclusion protein (CI), second 6 kilodalton

protein (6K2), viral genome linked protein (Vpg), nuclear inclusion protein a

(NIa), nuclear inclusion protein b (NIb), and coat protein (CP) (Chung et al.

2008).

PIPO

7

PVY isolates have been categorized into several distinct groups of strains.

These include the common (ordinary) group PVYO (O strains), the tobacco

vein necrosis group PVYN (N strains), the stipple streak group PVY

C (C

strains), PVYZ, PVY

N-Wilga and the tuber necrosis strain group PVY

NTN. PVY

O

and PVYC were classified on the basis of hypersensitive reactions on potato

cultivars bearing the Nytbr and the Nc resistance genes, respectively (Kerlan

2006, Singh et al. 2008). PVYN

induces vein necrosis on Nicotiana tabacum

leaves but does not elicit hypersensitive resistance response in potato. PVYZ,

PVYN-Wilga

and PVYNTN

are known as new pathotypes. PVYZ strains are able to

overcome both Nytbr and Nc resistance genes. PVYN-Wilga

pathothypes are

PVYN

strains serologically related to PVYO but inducing less severe symptoms

in potato than PVYN strains. PVY

NTN pathotypes are the main causal agents of

potato tuber necrotic ringspot disease (PTNRD). They were directly obtained

from tubers exhibiting PTNRD and, apparently, originated from recombination

between PVYO and PVY

N. However, some non-recombinant isolates from

North America (NA-PVYN and NA-PVY

NTN) caused PTNRD when inoculated

to potatoes (Schubert et al. 2007, Singh et al. 2008).

1.4.2 Potato virus A (PVA)

PVA is a member of the genus Potyvirus and occurs worldwide. It infects only

some potato cultivars and can cause a moderate yield loss of up to 40%

(Hooker 1981, Kerlan 2008). However, PVA can cause mild mosaic and a

severe “potato crinkle” disease when co-infectin with Potato virus X (PVX).

PVA is spread by various types of aphids in a non-persistent manner,

vegetative propagation as well as by inoculation of the virus sap (Hooker

1981). At least four strain groups (1, 2, 3 and 4) of the PVA have been

determined on the basis of response of the potato cultivar ‘King Edward’ to

infection of different PVA isolates by side-graft inoculation (Rajamäki et al.

1998, Valkonen et al. 1995). Strain group 1 PVA isolates cause distinct

necrotic lesions, with or without chlorotic margins, in the upper leaves of ‘King

Edward’ while those of strain group 2 cause mottle symptoms and no necrosis

on the leaves of ‘King Edward’. Strain group 3 PVA isolates cause no

symptoms and cannot be detected by ELISA on the upper leaves of ‘King

Edward’. The strain group 4 is proposed for PVA isolates, which cause

8

stunting and yellowing in ‘King Edward’ cultivar (Rajamäki et al. 1998). The

PVA genome organisation is the same as that of PVY (Figure 1).

1.4.3 Potato leaf roll virus (PLRV)

PLRV is a type member of the genus Polerovirus in the family Luteoviridae

and infects potatoes worldwide. The genome of PLRV is monopartite, single

stranded, non-enveloped with a positive sense RNA of 5882 nucleotides in

length (King et al. 2012). The 5' terminus has a genome-linked protein (VPg)

(about 17 kDa): no poly (A) tail is found at the 3´ terminus (Kerlan 2006, King

et al. 2012). The virus host range is restricted to members of the family

Solanaceae. PLRV is transmitted via green peach aphids (Myzus persicae) in a

persistent manner without any evidence for propagation in its invertebrate

vector (Eskandari et al. 1978). Potato plants infected with PLRV exhibit

yellowing and leaf rolling symptoms. Infected tubers show necrotic lesions in

the phloem tissue, and the yield loss is estimated to reach 90% (Kerlan 2008).

The RNA contains six functional open reading frames (ORFs) in the form of

two clusters that are separated by a non-coding region of 197 nucleotides

(Mayo et al. 1989) (Figure 2). ORF0 (28K) encodes a gene for symptom

development, ORF1 (70K) and ORF2 (69K) encode RNA-dependent RNA

polymerase, ORF3 (23K) encodes a coat protein gene, and the most conserved

coding region, ORF4 (17K), encodes a movement protein, while ORF5 (56K)

encodes an aphid transmission factor (Mayo et al. 1989, Keese et al. 1990).

Figure 2. A schematic diagram showing the arrangement of ORFs in the PLRV

genome.

9

1.4.4 Potato virus S (PVS)

PVS belongs to the family Betaflexiviridae and genus Carlavirus. PVS has two

recognized strains, PVSO (Ordinary) and PVS

A (Andean), and has a worldwide

distribution. The virus is transmitted by several aphid species in a non-

persistent manner as well as by contact (Hooker, 1981). PVS has a narrow

natural host range, and is highly restricted to species of Sonalaceae and

Chenopodiaceae. Infection of potato plants is often symptomless, but mild

symptoms can occur. The yield reductions due to PVS are normally considered

moderate, but can be up to 20% (Kerlan 2008). PVS particles are filamentous

(+)ssRNA genome of approximately 8.5 kb. The viral RNA is encapsidated

with a 34 kDa coat protein (CP) (Adams et al. 2004). The PVS genome has six

ORFs, as shown in Figure 3. ORF-1 encodes a polypeptide of 223 kDa that is a

putative PVS replication protein (RPT) (Matoušek, et al. 2005); ORF-2

encodes an NTPase/helicase domain; ORF-3 contains a protein of 12kDa; and

ORF-4, ORF-5 (CP) and ORF-6 encode proteins of 7, 34 and 11 kDa,

respectively (Foster & Mills 1992, Matoušek, et al. 2005).Only ORF-1 is

translated from the full length genomic RNA of PVS. The ORFs following

(3´proximal to) the ORF-1 are translated from 3´-terminal of two subgenomic

RNA (sgRNAs) that can be found in PVS infected plant tissues (Adams et al.

2012a)

Figure 3. A diagram showing a putative PVS genome organisation with six ORFs.

1.4.5 Potato virus M (PVM)

PVM is a member of the genus Carlavirus in the family Flexviridae, has

(+)ssRNA, polyadenylated genomic RNA of approximately 8.5 kb in length

10

(Zavriev et al. 1991). PVM is considered to be one of the most common potato

viruses distributed worldwide and is an economically important pathogen of

potato (Solanum tuberosum). PVM causes a yield reduction in potatoes of 15%

- 45%. The virus is transmitted non-persistently by several aphid species and

by mechanical inoculation with sap from young leaves. PVM causes slight

mottle and mild abaxial rolling of leaves and stunting of shoots (Kerlan 2008).

Symptoms of potato plants caused by PVM infection are similar to those

caused by several other common potato viruses, including PVS, PVX and

PVYO. The severity of symptoms varies greatly depending on the combination

of potato cultivars and PVM isolates (Ruiz de Galarreta at al. 1998). The PVM

genome organisation and replication is the same as that of PVS (Figure 3).

1.4.6 Potato virus X (PVX)

PVX belongs to genus Potexvirus and has particles with a filamentous shape.

The virus is distributed worldwide where potato is cultivated (Kagiwada et al.

2002). PVX is transmitted by contact. Its natural host range is quite narrow;

PVX mainly infects plants in the Sonalaceae family. There are PVXfour

strain groups of PVX (X1, X2, X3 and X4) that differ in virulence towards

HR genes, Nx and Nb (Kerlan 2008). PVX is usually found as a latent infection

but symptoms can become more severe when PVX co-infects plant with other

(+)ssRNA viruses (Ryu & Hong 2008).

Figure 4. Schematic representation of PVX genome organisation.

The PVX genome consists of a single positive sense RNA molecule. The RNA

has five open reading frames (ORFs) with a size of 6435 nucleotides excluding

the poly (A) sequence (Kagiwada et al. 2002), is capped at the 5’ end and

polyadenylated at the 3’ end (Sonenberg 1987) as illustrated in Figure 4. The

11

five ORFs encoding proteins are 165K RNA-dependent RNA polymerase

(RdRp) required for PVX replication, the “triple gene block” (25K, 12K, and

8K) required for virus movement and a coat protein (CP). The 12K overlaps

with the 25K and 8K by 12 and 64 nucleotides, respectively (Verchot et al.

1998, Querci et al. 1993). The overlapping ORFs are expressed through the

production and subsequent translation of appropriate sgRNAs. Two or three 3-

terminal sgRNAs (2.1, 1.2 and 1.0 kb) can be isolated from plants tissues

infected with PVX (Adams et al. 2012b).

12

2 OBJECTIVES

The aim of this study was to determine the occurrence of the six important

potato viruses (PLRV, PVA, PVS, PVM, PVX and PVY) in farmers’ potato

fields in the Mbeya region, Tanzania. The information will provide a platform

for potato virology research and seed potato production projects in Tanzania.

Specific Objectives

i. To establish the status of viruses in potato plants using different detection

methods.

ii. To determine the genetic variability of isolates of different potato viruses in

Tanzania.

13

3 MATERIALS AND METHODS.

3.1 Sampling locations

A total of 13 potato farmer’s fields were selected in 6 locations situated in three

districts of Mbeya region (Mbeya Urban, Mbeya Rural and Rungwe districts)

as indicated on figure 5. The specific locations were Uyole and Uyole

agricultural research station (ARI- Uyole) (Mbeya Urban), Umalila, Kawetele

and Kikondo (Mbeya rural) and Mwakareli (Rungwe). The fields ranged

between 0.2 and 1 ha in size and sometimes contained mixed varieties.

Figure 5. Map of Tanzania showing the Mbeya Region and the location of

surveyed Mbeya districts.

14

3.2 Sampling in the field

A total of 219 potato leaf samples from the varieties Arika, Kikondo, Kiazi

Chekundu, Sasamka, Kagiri and Tigoni were collected from potato crops

ranging 1-3 months in age were selected. The names of varieties were recorded

as identified by the farmers. With clean gloves, young full expanding top

leaves were sampled and plants expressing distinct virus symptoms or very

mild were preferentially sampled. In total, 10 symptomatic and 3 symptomless

potato leaves were sampled from each field and stored in paper bags. In the

farmers’ fields where virus-like symptoms were not observed, potato leaves

were sampled randomly. Potato leaves in the sample bags were immediately

stored in the cool box and later transferred to a freezer (-20 °C) upon arrival at

the laboratory of the Uyole Agricultural Research Institute (ARI Uyole),

Mbeya and used for serological analysis.

Sap from 20 fresh leaf samples collected from Mwakareli and ARI-Uyole was

also absorbed on Flinders Technology Associates (FTA) cards used for reverse

transcription (RT)-PCR upon arrival at the University of Helsinki, Finland.

Sample preparation and application onto the FTA cards was carried out as

described by the manufacturer (Whatman, Kent, UK). Briefly, a 10 cm2 piece

of parafilm was placed over the plant tissue and the rounded end of a test tube

was used to apply moderate downward pressure with a slight twisting action

until sap penetrated the reverse side of the FTA card. The cards were dried at

room temperature overnight and stored in paper bags.

3.3 ELISA

The double antibody sandwiched enzyme-linked immunosorbent assay (DAS-

ELISA) was carried out as originally described by Clark & Adams (1977)

except the results based on the colour change were recorded based on visual

observation. The diagnostic reagents were purchased from Scottish

Agricultural Science Agency (SASA, Edinburg, United Kingdom) and used

according to the manufacturer´s instructions. DAS-ELISA was used for

detection of PLRV, PVA, PVS, PVM, PVX and PVY. Coating polyclonal

15

antibody (PAb) was diluted with coating buffer at 1:1000 dilution, dispensed

(200 μl) into the wells of an ELISA plate (Nunc, New York, USA) and

incubated for 4 hours at 37 °C. The washing buffer, extraction buffer and

coating buffer were prepared according to the instructions provided by the

manufacturer (SASA, Edinburg, United Kingdom) (Appendix 2). The ELISA

plates were washed 4 times with wash buffer and blotted dry. While incubating

the ELISA plates, potato leaf samples were weighed and put in sample

polythene bags; 3 ml of extraction buffer was added per 1 g of sample and

grounded. The bags were then left on the bench to allow the sap to clarify for

15 minutes and two aliquots (200 μl) were dispensed into two wells and

incubated overnight at 4°C. ELISA plates were then washed 4 times with

washing buffer and blotted dry. Alkaline phosphatase (AP) conjugated virus

specific monoclonal antibody (for detection of PVX, PVS, PVM and PLRV)

and AP-conjugated PAb (for detection of PVA and PVYall) were diluted at

1:1000 in extraction buffer and loaded into test wells (200 μl), incubated for 2

hours at 37°C. The ELISA plate was washed 4 times and blotted dry. The

freshly prepared p-nitrophenyl phosphate substrate (1 mg/ml in substrate

buffer) was dispensed (200 μl) into test wells and incubated at ambient

temperature for 1-2 hours. The ELISA test was carried out with several

replicates, including positive and negative controls. ELISA results were

recorded by visual observation (colour change) since there was no

spectrophotometer at ARI-Uyole.

3.4 Primer design

Six pairs of degenerate virus-specific RT-PCR primers were designed to a wide

range of strains of PVM, PVS and PVX (Table 1). PVM and PVX primers

were designed according to the conserved nucleotide sequences upstream and

downstream of the coat protein encoding region. To locate conserved

nucleotide sequences, viral sequences were retrieved from the National Center

for Biotechnology Information (NCBI) database

(http://www.ncbi.nlm.nih.gov/) and aligned using ClustalW2-multiple

16

sequence alignment software (http://www.ebi.ac.uk/Tools/msa/clustalw2/). A

total of 13, 18 and 7 sequences for isolates of PVS, PVX and PVM,

respectively, were used for the alignments. For PVS, two pairs of primers that

generate overlapping products were designed; Primers PVSCPF1 and

PVSCPR1 amplify a 232 bp fragment from the 5´ end of the CP gene. Primers

PVSCPF2 and PVSCPR2 amplify a 933 bp fragment from the 3´ end of the CP

gene. The melting temperatures (Tm) of the degenerate primers were

determined using the Finnzymes computer tool Tm Calculator Analyzer

(http://www.finnzymes.fi/tm_determination.html).

Table 1. Degenerate primers designed

Primer 5'-3' Sequence

Genomic position (nt) and

NCBI accession number Product size (bp)

PVSCPF1 TATCTGGGCGTCATGCTC 6950 -6967 (NC007289)

232 PVSCPR1 TTACCTGTGAACCTAAAGG 7162 – 7182 (NC007289)

PVSCPF2 CCTTTAGGTTCACAGGTAA 7166 – 7184 (JQ647830)

933 PVSCPR2 TCATTGGTTGATCGCATT 8090 – 8098 (JQ647830)

PVXCPF TTGARCGGTTAAGTTTCCA 5617 – 5635 (FJ461343)

790 PVXCPR AGAAAATACTATGAAACTGGG 6388 – 6409 (FJ461343)

PLRV3F1 TCCCACGTGCGATCAATTGT 3672- 3691(D00530)

PLRV3R1 AGGCTCTGATCCGGAGTCTA 4321- 4341 (D00530) 670

PVMCPF GCCGTTTGGGTGTGGTTCC 7161 – 7179 (JN835299)

PVMCPR CCRTGGTTACGTSCTTCATT 8122 – 8142 (JN835299) 982

PVYCPF1 GCYTTCACTGAAATGATGGT 8503- 8522 (X97895)

P0TYR2 GGTCGACTGCAGGATCCAAGC(T)15 9677- 9702 (JQ971975) 1200

FO6F3 GTGGTGAAATACTAATCCCA 8188- 8207 (NC004039)

FO29R3 TTCCCACTCAAACTCACTGTTG 9448- 9469 (NC004039) 1280

1PLRV primers designed by Mayo et al. (1989)

2PVY primers designed by Yanping Tian

3PVA primers designed by Tuuli Haikonen

17

3.5 Elution and RT-PCR amplification of RNA from FTA cards

Preparation of samples from FTA cards for RT-PCR analysis was done as

previous described by Ndunguru et al. (2005). Eight discs, 2 mm in diameter

were punched out from the chlorophyll-stained region of each pressed sample

on FTA cards by using a clean Harrison Micro Punch (Whatman) and placed

directly into a sterile 1.5 ml Eppendorf tube. The Micro Punch was cleaned

with a tissue dampened with 70% ethanol and by taking a disc from a blank,

sample-less FTA Card. The cleaning was repeated every time before punching

the next sample in order to avoid contamination. Total RNA from the discs was

eluted by adding 500 μl of RNA processing buffer (10 mM Tris-HCl, pH 8.0,

0.1 mM ethylenediaminetetraacetic acid (EDTA), 800 U/mL RNasin

{Promega, Madison, USA}, 250 μg/mL glycogen and 2 mM dithiothreitol

(DTT) into each Eppendorf tube, incubated for 30 min on ice with mixing

every 5 minutes. Eluted RNA was transferred into new Eppendorf tubes

leaving the paper discs behind. RNA was precipitated using 0.1 volume of 3M

sodium acetate (pH 5.2), an equal volume of ice cold 100% isopropanol and

incubated at 70°C for 30 minutes. The precipitated RNA was pelleted by

centrifugation at 10,000x g for 20 minutes at 4°C. An ice cold 75% ethanol

(500 μ1) was added to pellets followed by centrifugation at 10,000x g for 5

minutes at 4°C. The pellets were air-dried and re-suspended in 11 μ1 of

diethylpyrocarbonate (DEPC) - treated water in order to inhibit RNases. The

concentration of RNA was determined using spectrophotometer (NanoDrop

2000/2000c).

Total RNA was used directly for complementary DNA (cDNA) synthesis. The

cDNA was synthesized in a 20 μ1 reaction using SuperscriptIII reverse

transcriptase (Invitrogen, Carlsbad, USA) according to the manufacturers´

instructions. For PVA, PVY, PVM, PVS and PVX, 43- 459 ng RNA was used

with oligo dT (dT+N) and for PLRV 40-370 ng total RNA was used with

random hexamers as the reverse primers. PCR was used to amplify the

complete coat protein encoding region of each virus using the respective

primers (Table 1).

18

The PCR master mix contained 1X buffer for Dynazyme DNA polymerase

(Finnzymes Oy, Espoo, Finland), 400 µM dNTP mix, 1X (bovine serum

albumin) BSA, 400 nM of primers, 0.2 U/ μ1 of Dynazyme II polymerase

enzyme and 5 μ1 of cDNA template. PCR programme varied according to the

virus tested. The initial denaturation of all viruses tested was at 94°C for 2

minutes followed by 35 cycles of denaturation at 94°C for 30 seconds,

annealing at 55°C (PVS, PVX and PVA) or 58°C (PLRV and PVM) for 30 s

and extension at 72°C for 1 minute. The final extension was carried out at 72°C

for 10 minutes.

PCR programme for PVY was 94°C for 2minutes, 5 cycles of 94°C for 30

seconds, 45°C for 30 seconds , 72°C for 1.5 minutes, 35 cycles of 94°C for 30

seconds, 51°C for 30 seconds, 72°C for 1.5 minutes and the finally at 72°C

for 10 minutes before cooling to 4°C.

The PCR products were separated by electrophoresis on 1% agarose (PVY,

PVA) or 2% agarose gel (PVX, PVM, PVS and PLRV) in 1x TAE buffer with

0.5 µg/ml of ethidium bromide that was added for staining the DNA.

3.6 Purification and sequencing of the PCR products

The PCR products for PVA, PLRV, PVM, PVS and PVX were carefully

excised from gels and DNA extracted from the gel using E.Z.N.A gel

extraction kit (Omega Bio-tek, Norcross GA, USA). The purified PCR

products obtained were sent to Haartman Institute, University of Helsinki for

sequencing.

3.7 Sequence analysis

The CP- encoding sequences obtained in this study were analyzed using Basic

Local Alignment Search Tool (BLAST)

(http://blast.ncbi.nlm.nih.gov/Blast.cgi) to query for their related sequences that

19

have been submitted to and available to users in the database. The related

sequences were retrieved and used in phylogenetic analysis. Multiple

alignment of CP encoding DNA sequences obtained in this study and related

sequences retrieved from GenBank was achieved using the Clustal W program

(Thompson et al. 1994). Phylogenetic relationship between aligned sequences

was analyzed with the neighbor-joining method (Saitou & Nei 1987) and a

bootstrapping of 1000 replicates (Felsenstein 1985). The software used for this

analysis was Molecular Evolutionary Genetics Analysis version 5 software

(MEGA 5) (Tamura et al., 2011). The genetic distances of sequences were

calculated using kimura-2 parameter with a transition /transvertion ratio of 2.

20

4 RESULTS

4.1 Virus symptoms observed on potato

A variety of virus symptoms were observed in the fields from which samples were

collected (Figure 6). The symptoms were noted regardless the potato varieties

because the farmers were mixing a number of varieties randomly in their respective

fields. Observed symptoms included yellowing mosaic, leaf rolling, stunting, curling

leaves and veinal necrosis underneath the rolled leaves (Figure 6).

Figure 6. Symptoms of virus diseases on potato leaves: yellowing mosaic (A and G),

leaf rolling (B and F), stunted plants and curling leaves (C), leaf yellowing (D and

E), vein necrosis underneath the rolled leaves (F) indicated by arrows.

21

4.2 Viruses detected by DAS-ELISA

A total of 219 leaf samples collected from six areas in Mbeya region were

tested for the six viruses. In each location, 30 potato leaf samples were

collected from symptomatic plants except ARI- Uyole where 21 samples were

collected. Nine samples were collected from virus symptomless potato plants,

except for ARI- Uyole where three virus symptomless potato leaf samples were

collected.

All the six important potato viruses (PLRV, PVS, PVY, PVA, PVX and PVM)

were detected (Table 2). PVS and PLRV were the most prevalent viruses,

while PVY and PVA were the least prevalent. PVS and PLRV were detected in

all localities while PVY, PVX, PVA and PVM were detected on some

localities (Table 2). Moreover, different mixed virus infections were observed

in some of the samples collected in all areas (Table 3). PVS, PLRV and PVM

were also detected in leaf samples that were collected from symptomless potato

plants (Table 4). Positive results of DAS-ELISA were judged based on the

development of yellow colour in the wells of ELISA plates (Figure 7).

Table 2. DAS- ELISA results from collected potato leaf samples

Locality

n PVS PVY PVX PVA PLRV PVM

Umalila

39 19 0 6 0 2 0

Kawetele

39 30 4 0 0 25 1

Kikondo

39 15 0 6 7 21 3

Mwakareli

39 10 0 14 2 14 1

Bonde la uyole

39 30 2 2 0 16 5

ARI- Uyole

24 16 0 3 0 7 1

∑

219 120 6 31 9 85 11

n: Total number of potato leaves sampled per locality

∑: Total number of potato leaves detected positive for each virus

22

Table 3. Mixed virus infections in potato plants

Table 4. DAS-ELISA and RT-PCR results on samples stored on FTA cards.

DAS ELISA RESULTS

Locality Sample

number

Leaf sample

status PVS PVX PVM

PVY

all PLRV PVA

Mwakareli 1 S - +* - - - -

Mwakareli 2 S - +* - - - -*

Mwakareli 3 S - -* - - +* -

Mwakareli 4 S - -* - - +* -

Mwakareli 5 N - - - - +* -*

Mwakareli 6 N + * - - - - -*

Uyole 7 N - - - - - -

Uyole 8 S - + - - +* -

Uyole 9 S - - - - - -*

Uyole 10 S - +* - - + -

Uyole 11 S - -* - - +* -

Uyole 12 S + - +* - +* -

Uyole 13 S + - +* - +* -

Uyole 14 S - - - - +* -*

Uyole 15 S - - - - - -

Uyole 16 S +* - - - - -

Uyole 17 S +* - - - - -

Uyole 18 N +* -* +* - - -

Uyole 19 N +* - - - - -

Uyole 20 N +* - - - +* -

*RT-PCR analysis positive samples, S: Symptomatic potato leaf samples, N:

Symptomless potato leaf samples

Locality

S +

LR

S+ X

S +

X

S +

Y

S +

A

S +

M

S +

X +

LR

S +

M +

LR

S+M

+LR

+A

S +

X +

LR

+ A

X +

LR

X +

LR

+ A

X +

M +

LR

Y +

LR

M +

LR

M +

LR

+ A

LR +

A

Umalila 1 1 2 0 0 0 0 0 0 0 1 0 0 0 0 0 1

Kawetele 16 0 0 2 0 0 0 0 0 0 0 0 0 2 1 0 0

Kikondo 9 0 0 0 1 0 1 0 0 1 0 1 1 1 0 1 0

Mwakareli 1 2 0 0 0 0 2 0 1 0 1 0 0 0 0 0 0

Uyole 5 0 0 2 0 1 0 4 0 0 2 0 0 0 0 0 0

ARI-Uyole 6 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0

∑ 38 5 2 4 1 1 3 4 1 1 5 1 1 3 1 1 1

23

Figure 7. DAS-ELISA for detection of PVS (A), PVX (B), PLRV (C), PVA

(D), PVM (E), and PVY (F). The yellow colour in ELISA plates reveals

samples that reacted with their respective antibodies. Samples were tested in

duplicates. Positive control samples are indicated by arrows in the ELISA

plates.

24

4.3 Elution of total RNA from FTA cards

Total RNA was eluted from the 20 samples which were stored on FTA cards

and their concentrations (ng/µl) and purity (260/280) were determined using

spectrophotometer (NanoDrop 2000/2000c) as shown in Table 5.

Table 5. Total RNA eluted from samples pressed on FTA cards

Sample number concentration (ng/µl) Purity (A260/A280)

1 20 1.74

2 32 1.45

3 14 1.52

4 11 1.67

5 34 1.71

6 12 1.58

7 21 1.66

8 35 1.69

9 7 1.47

10 4 1.59

11 21 1.73

12 44 1.62

13 15 1.55

14 39 1.50

15 43 1.71

16 42 1.69

17 28 1.57

18 43 1.60

19 42 1.55

20 46

1.67

Negative control 2 1.36

25

4.4 Viruses detected by RT-PCR

RT-PCR analysis for the detection of six important viruses that infect potato

(PVS, PLRV, PVX, PVM, PVA and PVY) was carried out on 20 leaf sap

samples which were pressed on FTA cards. The samples were selected based

on their positive reactions in DAS-ELISA for at least one virus in the current

study. PVY was not detected in any of these samples by both DAS-ELISA and

RT-PCR. PLRV was detected in 10 samples out of 20 with an observed PCR

product size of approximately 0.6kb (expected size 627 nt) on a 2% agarose gel

following electrophoresis (Figure 8).

Figure 8. RT-PCR detection of PLRV complete coat protein encoding DNA

(627 bp). Lanes 4, 10, 16 and 25 represent 100bp DNA ladder (GeneRuler,

Fermentas); lanes 1, 2, 3, 7, 9, 11, 12,13,14,22: samples positive with PLRV;

lane 24: positive control; lane 23, negative control.

PVX was detected in 6 samples out of 20 tested (Figure 9A) while PVM was

detected in 3 samples (Figure 9B). Whereas DAS-ELISA failed to detect PVA

in any sample, RT-PCR detected it in 6 samples out of 20 (Figure 9C; Table 3).

1000 bp

600bp

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 PLRV

26

Figure 9. Viruses detected in samples stored on the FTA cards by RT-PCR

analysis. (A) Lanes 13, 14, 20: samples positive for PVM; lane 24: positive

control; lane 23: negative control. Lanes 11 and 17; 100 bp DNA ladder

(GeneRuler, Fermentas). (B) Lanes 3, 4, 11, 13, and 21: samples positive with

PVX; lane 24: negative control; lane 25: positive control; lanes 6, 12, and 18:

100 bp DNA ladder. (C) Lanes 2, 5, 7, 10 and 16: samples positive with PVA;

lane 21: negative control; lane 22: positive control; lanes 6, 12, and 23: 1 kb

DNA ladder.

RT-PCR analysis for the detection of PVS is represented in Figure 10. While

DAS-ELISA detected PVS in 8 samples (Table 3), RT-PCR detected it in 6 out

of 20 samples (Figure 10) when observed on 2% agarose gel.

27

Figure 10. RT-PCR amplification of PVS recovered from potato leaves pressed

on FTA cards. (A) Lanes 6, 18-22 samples positive with primer pair PVSCP1;

lane 23: negative control; lane 24: positive control lanes 11, 17 and 25. (B)

Lanes 6, 18-22 samples positive with primer pair PVSCP2; Lane 23: negative

control; lane 24: positive control; lanes 11, 17 and 25: 100 bp DNA ladder

(GeneRuler, Fermentas);

4.5 Phylogenetic relationships of virus isolates

The complete CP-encoding sequences of PVA (5 isolates), PVX (4 isolates),

PVM (3 isolates), PVS (5 isolates), and PLRV (5 isolates) were obtained in

this study and compared to related sequences of virus isolates characterized in

other countries. PVY was not detected by DAS-ELISA and RT-PCR from the

samples stored on FTA cards and thus its sequences were not obtained.

Tanzanian PLRV isolates were 99% identical to each other at CP nucleotide

sequence level. Blast searches detected 100 PLRV isolates that were 97% to

100% identical to Tanzanian isolates (672 nt query length). Three PLRV nt

sequences from Tanzania (TZ:LR12U:11, TZ:LR11U:11 and TZ:LR4M:11)

were 99% identical to the PLRV isolate Yunnan-92 (FJ859016) and PLRV

isolate Inner Mongolia (FJ859025) both from China. Tanzanian PLRV isolates

TZ:LR5M:11 and TZ:LR3M:11Mwere 99% identical to PLRV isolate

PVS1

PVS2

1000 bp

300 bp

1000 bp

500 bp

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

20 21 22 23 24 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

A

B

28

JokerMV10 from Germany (FJ853190), PLRV strain Noir from France

(AF453390) and PLRV isolate Inner Mongolia-196 from China (FJ859025).

Results of the phylogenetic analysis of 24 PLRV CP-encoding sequences (602

nt) is presented in Figure 11. Four out of five potato-infecting Tanzanian

PLRV isolates (TZ:LR12U:11, TZ:LR4M, TZ:LR5M:11 and TZ:LR12U:11)

were observed to form one cluster with other 16 PLRV isolates from different

countries. The Tanzanian isolates are distantly related to South African isolate

(AF022782), one of the only two isolates from Africa included in the analysis.

Figure 11. Phylogenetic tree representing relationships of PLRV isolates from

Tanzania (bolded) and other regions of the world by comparing their partial

CP- encoding sequences (602 nt). PLRV isolates are denoted by the

corresponding GenBank accession number, isolate name and country of origin.

Bootstrap analysis was completed with 1000 replicates and only values higher

than 60 are shown. The evolutionary distances were computed using the

Kimura 2-parameter method. The bar below the tree indicates 0.2 nt

substitutions per site.

29

All the five PVA isolates from Tanzania (TZ:PVA9U:11, TZ:PVA6U:11,

TZ:PVA2M:11, TZ:PVA14U:11 and TZ:PVA5M:11) were identical at

nucleotide CP sequence level (804 query length) and 94% to 99% identical to

56 PVA isolates available in the GenBank database when analysed with

BLAST. The BLAST alignment further showed that the five PVA isolates form

Tanzania were 99% identical to three isolates form Germany (Y10250,

X91966, Y11426) and one isolate from Hungary (Z21670).

Figure 12 shows the phylogenetic relationship of 24 PVA CP-encoding

sequences (804 nt) where by Tamarillo mosaic virus (X54804) was used as an

out group. Tanzanian PVA isolates from potato were identical and supported

with a bootstrap value of 63.

Figure12. Phylogenetic tree depicting the relationship of PVA isolates from

Tanzania (bolded) with other isolates denoted by their accession number,

isolate name and country of origin. The analysis was based on 804 nt of the

CP-encoding region. Bootstrap analysis was completed with 100 replicates and

only values higher than 60 are shown. Tamarillo mosaic virus was used as an

out group. The bar below the tree indicates 0.02 nt substitutions per site

(Kimura 2- parameter).

30

The CP-encoding nucleotide sequences (869 nt) of five Tanzanian PVS isolates

(TZ:PVS16U:11, TZ:PVS18U:11, TZ:PVS6M:11, TZ:PVS17U:11 and

TZ:PVS20U:11) were found to be identical and 99% and 98% identical to PVS

isolates Sam-24-PVS from United Kingdom (GU144330) and KER.SO.21

from Iran (HQ875142), respectively. Analysis on the evolutionary relationships

of 23 PVS isolates based on 869 nt of the CP-encoding sequence also indicated

that the Tanzanian PVS isolates were closest and related to PVS isolates from

United Kingdom (GU144330) and Iran (HQ875142) (bootstrap support 98%

and 91% respectively) (Figure 13).

Figure 13. Phylogenetic analysis based on CP- encoding sequences 804 nt of

PVS isolates from Tanzania (bolded) with other PVS isolates from selected

countries. Bootstrap analysis was completed with 1000 replicates and only

values higher than 60 are shown. The bar below the tree indicates 0.02 nt

substitutions per site (Kimura 2- parameter).

31

Results from BLAST searches indicated that the CP-encoding nucleotide

sequences (705 nt) of four Tanzanian PVX isolates (TZ:PVX3M:11,

TZ:PVX4M:11, TZ:PVX10U:11 and TZ:PVX18U:11 ) were identical.

Moreover, the Tanzanian isolates were 94% to 99% identical to 100 PVX

isolates available in GenBank database. The four Tanzanian isolates were 99%

identical to three isolates from China (AF528555, EU031437 and EF6242579).

The phylogenetic analysis of evolutionary relationships based on 705 nt of the

CP- encoding sequence of PVX isolates showed that all the Tanzanian isolates

formed one cluster with a PVX isolate Shandong from China (AF528555)

(Figure 14).

Figure14. Phylogenetic tree depicting evolutionary relationships of PVX

isolates from Tanzania (bolded) with other PVX isolates from selected

countries (identified with their GenBank accession number). The analysis was

done using Neighbour-Joining analysis of 705 nucleotides of the CP-encoding

sequence. Bootstrap analysis was completed with 1000 replicates and only

values higher than 60 are shown. The evolutionary distances were computed

using the Kimura 2-parameter method. The bar indicates 0.002 nt substitutions

per site.

32

The three PVM isolates (TZ:PVM12U:11, TZ:PVM13U:11 and

TZ:PVM18U:11) from Tanzania were 100% identical after alignment using

BLAST. Tanzanian isolates also were observed to have 94% to 99% identity

with 100 other PVM isolates available in the database. In addition, their

nucleotide CP encoding sequences were 99% identical to PVM strain Russian

wild from Russia (D14449) and 98% identical to the Germany PVM isolate

(X57440).

The phylogenetic analysis of evolutionary relationships based on 900 nt of CP-

encoding sequences of PVM isolates, showed that all the Tanzanian isolates

were identical (Figure 15). The Tanzanian PVM isolates were closest and

related to PVM isolates from Russia (D14449)) and Germany (X57440).

Figure 15. Phylogenetic tree constructed with 900 nucleotides of CP- encoding

DNA sequence of PVM isolates from Tanzania (bolded) and the other 16 PVX

isolates. Isolates are indicated in the tree by accession number, isolate name

and country of origin. Bootstrap analysis was completed with 1000 replicates

and bootstrap values higher than 60 are shown. The scale bar indicates 0.005 nt

substitutions per site (Kimura 2- parameter)

33

5 DISCUSSION

The current study was done in order to test the presence of the six most important

potato viruses (PVY, PVX, PVM, PLRV, PVA and PVS) in farmers’ potato fields in

Mbeya Region, Tanzania. The diagnosis and detection of viruses were based on

visual observation and DAS-ELISA, a serological technique which was used to

screen for the viruses in all the potato leaf samples collected for this study. The

presence or absence of viruses in the leaf samples were further confirmed by RT-

PCR for samples that were collected on FTA cards. RT-PCR is a molecular

technique for detection of nucleic acids (including viruses) and is more sensitive than

traditional detection methods and DAS-ELISA. There is scanty information on the

genetic variability of potato virus isolates from Tanzania as much attention appears

to be on cassava and sweet potato viruses. Thus, this study also aimed at

understanding the genetic variability of viruses infecting potato in Mbeya, a region

where over 90% of potato is produced in Tanzania. To our knowledge, there is no

report to date of serological and molecular data of potato viruses’ occurring in

Tanzania despite the fact that potato is the seventh most important crop after banana,

maize, beans, cassava, rice and sorghum (FAOSTAT 2010).

A variety of virus related symptoms were observed in the farmers’ potato fields

where samples were collected. The symptoms observed were yellow mosaic, leaf

rolling, stunted growth, curled leaves and veinal necrosis underneath the potato

leaves (Figure 6). The aforementioned symptoms from this study were also reported

in previous studies done in Bangladesh, Germany and USA (Hooker 1981, Khan et al.

2003, Weidemann 1988).Visual examination or symptomatology is an important and

traditional method of identifying plant pathogens from the fields (Putnam 1995).

However this method is not very efficient and reliable because symptom

development is dependent on several factors such as time of infection, plant variety,

growth stage, virus strain and environmental conditions (Agrios 2005, Batool et al.

2011). In addition, it is often possible to observe disease symptoms in the plants only

after major damage has already been done to the crop and therefore, treatments will

be of limited or no use. In order to save plants from permanent damage by pathogens,

farmers have to be able to identify an infection even before it becomes visible. For

34

diseases that do not have therapeutic treatments such as virus diseases, the farmers

must be aware of them and familiar with their respective control measures.

Six potato viruses (PLRV, PVY, PVX, PVA, PVM and PVS) are known to be widely

distributed all over the world (Khan et al. 2003, Singh 1999). Before this study, there

was no report known to us about presence of these viruses in Tanzania. Findings of

this study have shown that the aforementioned six viruses infect potato in the

southern highlands of Tanzania.

In this study viruses were screened by DAS-ELISA (Table 2). This technique

successfully detected viruses in potato leaf samples even in the leaves that were

asymptomatic (Table 4). This was well in agreement with previous findings that

DAS-ELISA is a reliable method for primary screening of viruses in the fields

(Chinestra et al. 2010, Njukeng et al. 2007, Khan et al. 2003).

The ratio of RNA absorbance at 260nm and 280nm asses the RNA purity. Pure RNA

has an A260/A280 of 2.1 (Glasel 1995). Despite the low quality and quantity of

RNA eluted from samples pressed on FTA cards (Table 5), RT-PCR analysis for the

detection of PVX, PVA, PVM, PVS, and PLRV were successful for all samples

except two PVS samples which were indicated by DAS-ELISA to be positive. Also

the amplification was obtained for some samples indicated to be negative by DAS-

ELISA (Table 4). Taken together, results of this study have demonstrated further the

efficacy of FTA technology for sampling, storage and retrieval of nucleic acid of

pathogens from infected plant tissues as demonstrated previously (Grund et al. 2010,

Leke et al. 2007, Roy & Nassuth 2005, Ndunguru et al. 2005, Natarajan 2000).

Interestingly, the concentrations of total RNA eluted and used for RT-PCR

amplification in this study was higher compared to those reported by Ndunguru et al.

(2005). This may be due to the fact that RNA pellets were re-suspended in a little

amount of DEPC- treated water.

RT-PCR analysis results for the detection of five important viruses that infect potato

(PVS, PLRV, PVX, PVM and PVA) correlated with DAS-ELISA results for samples

collected on FTA cards (Table 4). However, DAS-ELISA failed to detect all PVA

isolates collected also on FTA cards and shown to be positive by RT-PCR. In

35

previous studies, it was shown that PCR based methods are more sensitive than

DAS-ELISA (Martin et al. 2000). Failure to detect all PVA isolates collected on FTA

cards was not expected. This may suggest that the AP-conjugated PAb used for

detection of PVA could not recognize the epitope of Tanzanian PVA isolates.

Moreover, results may also suggest that the particular PVA concentration in the leaf

samples was too low to be detected by DAS-ELISA method. Nevertheless, detection

of PVA with RT-PCR analysis has further proved the higher sensitivity of this

method compared to serological methods as was earlier demonstrated (Webster et al.

2004, López et al. 2003, Martin et al. 2000). This implies that when any potato

program is committed to zero tolerance to introduction of viruses to new locations,

samples primarily screened by DAS-ELISA method have to be checked again using

a more sensitive PCR based method. But even with more sensitive techniques there

is always a chance of getting false negative results. A good example is the failure of

RT-PCR to detect PVS isolates in two samples earlier determined to be positive by

ELISA method. On other hand, the detection of more PVS positive samples by RT-

PCR may as well suggest the presence of other viruses apart from the ones which

were tested in the present study.

Mixed virus infections results were also observed in this study (Table 3) which are in

line with other earlier report (Njukeng et al. 2007).This is possibly associated with

the transmission of the viruses with the aphid vector Myzus persicae (except PVX),

mechanical infection of the plants/ tubers and planting of virus infected tubers

(Hooker 1981). Mixed infections have epidemiological effect because synergism

between some of these viruses may occur and subsequently lead to increased disease

severity and yield loses (Garcia-Marcos et al. 2009, Pourrahim et al. 2007).

Not all the plants that exhibited virus-like symptoms tested virus positive with DAS-

ELISA whereas this could be due to inappropriate antibodies or insensitivity of

DAS-ELISA method. It is also possible that there were other viruses in the leaf

samples not targeted in this study. In these times of next generation sequencing such

viruses could be revealed by, for example, deep sequencing of small interfering

RNAs (Donaire et al. 2009, Kreuze et al. 2009).

36

PVS and PLRV were the most prevalent viruses, while PVY and PVA were the least

prevalent viruses (Table 2). In contrast, in a similar study done in Iran by Puorrahim

(2007) revealed the high prevalence of PVS but lower PLRV prevalence. Another

study done in Kenya revealed the high prevalence of PLRV and PVY (Gildemacher

et al. 2009). This may indicate that the prevalence of potato viruses is not consistent

from one country to another and therefore, it would be useful to conduct further

studies on potato viruses’ prevalence in Tanzania potato major growing regions

(Mbeya, Iringa, Kilimanjaro and Arusha). The information will provide a clear view

of areas with the least potato viruses’ prevalence which will be suitable for potato

seed multiplication. Such information would also be useful in devising strategies for

control of viruses occurring in major potato growing areas. It could as well be used

to in formulation of policies regarding the movement of potato planting material

within and across Tanzanian borders.

Blast search and phylogenetic analysis results of viruses based on their CP-encoding

DNA sequences have for the first time confirmed the presence of PLRV, PVA, PVS,

PVX and PVM in Tanzania. Blast results showed 99%-100% identity of the

aforementioned viruses isolates. Results also showed that the Tanzanian PLRV,

PVA, PVS, PVX and PVM isolates (Figure 11, 12, 13, 14 and 15 respectively) were

identical based on their CP- encoding sequences analysed for relatedness supported

with a bootstrap value higher than 60% except PLRV isolates whose bootstrap value

was lower than 60. The results of this study showed that all virus isolates sequenced

in this study were at least 94% identical at CP encoding sequence level to each other

and to isolates from other parts of the world. The close evolutionary relationship of

Tanzanian virus isolates with other isolates from different countries worldwide may

suggest that the virus isolates from Tanzania are not different from those found in

other countries in the world. This may also indicate that the potato viruses are

efficiently dispersed in potential trade all over the world, a situation which can be

controlled by establishing potato production systems in Tanzania.

The phylogenetic analyses could not give any strong evidence to suggest there could

be a different strain of these viruses in Tanzania. This was possibly because the

Tanzanian virus isolates used in phylogenetic analyses were only from two localities

in Mbeya Region out of five locations selected in this study (Table 4). Nevertheless,

37

observation of identical Tanzanian virus isolates in two locations could evidently

explain the efficiency in virus transmissions between the two locations. However, it

is known that a change, for example, in a single amino acid could affect the ability of

virus isolates to infect and produce symptoms (Lewandowski & Dawson 1993,

Masuta et al. 1999). This study did not attempt to compare biological characteristics

of virus isolates from Tanzania with isolates from other places. Such study, if done

could yield information on disease severity associated with Tanzanian isolates.

38

6 CONCLUSION

The current study has shown the occurrence of six important viruses in potatoes

in Tanzania. Considering the importance potato as a food and cash crop in

Tanzania, results of this study suggest the supply of clean potato seeds to

farmers as well as incorporating control methods in order to reduce re-infection

with viruses. To our knowledge, this is the first report of symptomology,

serological, molecular and evolutionary analysis of viruses that infect potatoes

in Tanzania. Further studies that involve isolates from all major potato growing

areas would generate more information for better understanding of these

aspects with respect to potato viruses.

39

7 ACKNOWLEDGEMENTS

I would like to express my warm and sincere thanks to my supervisor, Prof.

Jari Valkonen for his tireless guidance throughout my study period. I also

appreciate assistance, advices and valuable interaction from KPAT group

members especially Olga Samuilova, Mikko Lehtonen, Yanping Tian, Johanna

Santala, Eeva Marttinen and Delfia Marcenaro whom I worked with closely in

the laboratory in a pleasant atmosphere. I thank my workmate John Kalaye for

helping me in sample collection (Tanzania) and Tuuli Haikonen and Yanping

for kindly providing me with PVA and PVY primers, respectively.

I gratefully acknowledge the Ministry for Foreign Affairs of Finland for

financing my master’s studies through Seed Potato Development Project in

Tanzania coordinated by the International Potato Center (CIP) and University

of Helsinki. I also thank the Ministry of Agriculture, Cooperatives and Food

Security (MAFC) of Tanzania for granting me a study leave.

I also express my appreciation to my MScPPS classmates and all my friends

for giving me courage, motivation as well as giving me emotional support. In a

special way, I thank my dear husband Justine Liberio, for his warm love, care,

encouragements, patience and emotional support which always made me go on.

I am most indebted to my parents Mr and Mrs Chiunga for providing a basic

foundation to my education, to my other family members at large for their

support.

40

8 REFERENCES

Adams, M. J., Antoniw, J. F., Bar-Josepha, M., Brunt, A. A., Candresse, T., Foster,

G. D., Martelli, G. P., Milne, R. G., & Fauquet, C. M. 2004. The new plant

virus family Flexiviridae and assessment of molecular criteria for species

demarcation. Archives of Virology 149: 1045–1060.

Adams, M.J., Candresse, T., Hammond, J., Kreuze, J.F., Martelli, G.P., Namba, S.,

Pearson, M.N., Ryu, K.H., Saldarelli, P. & Yoshikawa, N. 2012a. Family

Betaflexiviridae. In: King, A. M. Q., Adams, M. J., Carstens, E. B &

Lefkowitz, E. J. (Eds). Virus taxonomy. Classification and nomenclature of

viruses. Ninth report of the International Committee on Taxonomy of Viruses

(ICTV). ELSEVIER, Academic press. San Diego, California, USA. 920- 941

pp.

Adams, M.J., Candresse, T., Hammond, J., Kreuze, J.F., Martelli, G.P., Namba, S.,

Pearson, M.N., Ryu, K.H. & Vaira, A.M. 2012b. Family- Alphaflexiviridae. In:

King, A. M. Q., Adams, M. J., Carstens, E. B & Lefkowitz, E. J. (Eds). Virus

taxonomy. Classification and nomenclature of viruses. Ninth report of the

International Committee on Taxonomy of Viruses (ICTV). ELSEVIER,

Academic press. San Diego, California, USA. 904- 919 pp.

Agrios, G.N. 2005. Plant Pathology. Fifth Edition. Elsevier Academic Press. San

Diego. CA. 751-752 pp.

Andersson, J. A. 1996. Potato cultivation in the uporoto mountains, Tanzania: an

analysis of the social nature of agro-technological change. African Affairs 95:

85-106.

Batool, A., Khan, M, A., Farooq, J., Mughal, S. M. & Iftikhar, Y. 2011. Elisa-based

screening of potato germplasm against potato leaf roll virus. Journal of

Agricultural Research 49: 57- 63.

41

Berger, P. H. 2001. Potyviridae. Encyclopedia of Life Sciences. John Wiley & Sons,

Ltd. 5pp.

Brunt, A. A., Crabtree, K., Dallwitz, M. J., Gibbs, A. J., Watson, L. & Zurcher, E. J.

1996. Plant viruses online: Descriptions and lists from the VIDE database.

Version: 20 august 1996 (http://image. fs.uidaho.edu/vide/). Website visited

07.07.2012.

Chinestra, S. C., Facchinetti, C., Curvetto, N. R., & Marinangeli, P. A. 2010.

Detection and frequency of lily viruses in Argentina. Plant Disease 94:1188-

1194.

Chung, B. Y. –W., Miller, W. A., Atkins, J. F. & Firth, A. E. 2008. An overlapping

essential gene in the potyviridae. Proceedings of the National Academy of

Sciences 105: 5897- 5902.

Clark, M. F. & Adams, A. N. 1977. Characteristics of the microplate method of

enzyme linked immunosorbent assay for the detection of plant viruses. Journal

of General Virology 4: 475- 483.

Donaire, L., Wang, Y., Gonzalez-Ibeas, D., Mayer, K. F., Aranda, M. A. & Llave, C.

2009. Deep-sequencing of plant viral small RNAs reveals effective and

widespread targeting of viral genomes.Virology 392: 203–214.

Eskandari, F., Sylvester, E. S. & Richardson, J. 1978. Evidence for lack of

propagation of potato leaf roll virus in its aphid vector, Myzus persicae.

Phytopathology 69: 45-47.

FAO, 2008a. International year of the potato 2008. Potato world.

http://www.potato2008.org/en/world/africa.html. Visited 30.11.2012.

FAO Factsheets, 2008b. International year of the potato 2008. Potatoes, nutrition and

diet. http://www.potato2008.org/en/potato/factsheets.html. Visited 25. 01.

2012.

42

FAOSTAT, 2010a. Food and agricultural commodities. Commodities by regions.

http://faostat3.fao.org/home/index.html#VISUALIZE_TOP_20. Visited 17. 10.

2012.

FAOSTAT, 2010b. Food and agricultural commodities. Commodities by country.

http://faostat.fao.org/site/339/default.aspx. Visited 30. 11. 2012.

Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using the

bootstrap. Evolution 39: 783-791.

Foster, G. D. & Mills, P. R. 1992. The 3′-nucleotide sequence of an ordinary strain

of potato virus S. Virus Genes 6: 213-220.

Garcia-Marcos, A., Pacheco, R., Mortiañez, J., Gonzalez-Jara, P., Diaz-Ruiz, J.R &

Tenllado, F. 2009. Transcriptional changes and oxidative stress associated with

the synergistic interaction between potato virus X and potato virus Y and their

relationship with symptom expression. Molecular Plant-Microbe Interaction.

22 (11):1431-1444.

Glasel, J.A. 1995. Validity of nucleic acid purities monitored by A260/A280

absorbance ratio. Biotechniques 18:62-63.

Gildemacher, P. R., Paul, D., Baker, I., Kaguongo, W., Woldegiorgis, G., Wagoire,

W. W., Wakahiu, M., Leeuwis, C. & Struik, P. C. 2009. A description of seed

potato systems in Kenya, Uganda and Ethiopia. Potato Research 86: 373- 382.

Grund, E., Darissa, O. & Adam, G. 2010. Application of FTA_cards to sample

microbial plant pathogens for PCR and RT-PCR. Phytopathology

158:750–757.

Guyader, S. & Ducray, D.G. 2002. Sequence analysis of Potato leafroll virus isolates

reveals genetic stability, major evolutionary events and differential selection

43

pressure between overlapping reading frame products. Journal of General

Virology. 83:1799-1807.

Hooker, W. J. 1981. In: Compendium of Potato Diseases. Minnesota, USA. The

American Phytopathological Society. 68 -76 pp.

Ibaba, J. D. & Gubba, A. 2011. Diversity of potato virus Y isolates infecting

solanaceous vegetables in the province of KwaZulu.Natal in the Republic of

South Africa. Crop Protection 30: 1404- 1408.

Kagiwada, S.,Yamaji, Y., Nakabayashi, Y., Ugaki, M. & Namba, S. 2002. The

complete nucleotide sequence of potato virus X strain 0S: The first complete

sequence of a Japanese isolate. Journal of General Plant Pathology 68: 94-98.

Keese, P., Martin, R. R., Kawchuk, L. M., Waterhouse, P. M. & Gerlach, W. L.

1990. Nucleotide sequences of an Australian and a Canadian isolate of potato

leafroll lureovirus and their relationships with two European isolates. General

virology 71:719-724.

Kekarainen, T., Savilahti, H. & Valkonen, J.P. T. 2002. functional genomics on

potato virus A:virus genome-wide map of sites essential for virus propagation.

Genome Research 12: 584-594.

Kerlan, C. 2006. Descriptions of Plant Viruses 414.

(http://www.dpvweb.net/index.php). Visited 22. 11. 2012.

Kerlan, C. 2008. Potato viruses. In: Mahy, B.W & Regenmortel, M.H.V (Eds).201

Desk enciclopedia of plant and fungal virology. San Diego, California, USA

458- 47 pp.

Khan, S. M., Hoque, M. I., Sarker, R. H. & Muehlbach, H. P. 2003. Detection of

important plant viruses in in vitro regenerated potato plants by double antibody

sandwich method of Elisa. Plant Tissue Culture 13: 21-29.

44

Khouadja, F. D., Rouzé-Jouan, J., Guyader, S., Marrakchi, M. & Fakhfakh, H. 2005.

Biological and molecular characterization of Tunisian isolates of Potato

leafroll virus. Plant Pathology 87: 91-99.

Kreuze, J. F., Perez, A., Untiveros, M., Quispe, D., Fuentes, S., Barker, I & Simon, R.

2009. Complete viral genome sequence and discovery of novel viruses by

deep sequencing of small RNAs: A generic method for diagnosis, discovery

and sequencing of viruses. Virology 388:1-7.

Leke, W. N., Ramsell, J. N., Njualem, D. K., Titanji, V. P. K., Legg, J. P., Fondong,

V. N., Brown, J. K. & Kvarnheden, A. 2007. FTA technology facilitates

detection and identification of begomoviruses from Okra plants in Cameroon.

African Crop Science Society 8: 655- 660.

Lewandowski, D. J. & Dawson, W. O. 1993. A single amino acid change in tobacco

mosaic virus replicase prevents symptom production. Molecular Plant-Microbe

Interactions 6: 157-160

López, M. M., Bertolin, E., Olmos, E., Caruso, P., Gorris, M.T., Llot, Penyalver, R &

Cambra, M. 2003. Innovative tools for detection of plant pathogenic viruses

and bacteria. International Microbiology 6: 233-243.

Martin, R.R., James, D & Lévesque, C.A. 2000 Impacts of molecular diagnostic

technologies on plant disease management. Annual Review of Phytopathology

38: 207-239.

Masuta, C., Nishimura, M., Morishita, H. & Hataya, T. 1999. A single amino acid

change in viral genome-associated protein of potato virus Y correlates with

resistance breaking in ‘virgin a mutant’ tobacco. The American

Phytopathological Society 89: 118- 123.

Matoušek, J., Schubert, J., Ptáček, J., Kozlová, P. & Dědič, P. 2005. Complete

nucleotide sequence and molecular probing of potato virus S genome. Acta

Virologica 49: 195-205.

45

Matoušek, J., Schubert, J., Dědič, P. & Ptáček, J. 2000. Abroad variability of Potato

virus S (PVS) revealed by analysis of virus sequences amplified by reverse

transcriptase- polymerase chain reaction. Canadian Journal of Plant Pathology

22: 29- 37.

Mayo, M. A., Robinson, D. J., Jolly, C.A. & Hyman, L. 1989. Nucleotide sequence

of potato leafroll luteovirus RNA. Journal of General virology 70; 1037- 1051.

McDonald, J. G., Kristjansson, G.T. 1993. Properties of strains of potato virus YN in

North America. Plant Disease 77: 87-89.

Mih, M. & Atiri, G. I. 2001. Overview of irish potato viruses and virus diseases. In:

Hughes, J. d’A. & Odu, B. O. (Eds). Plant virology in sub-Saharan Africa

(Proceedings of a conference organized by IITA, June 4-8 2001, Ibadan,

Nigeria). 334- 341 pp.

Namwata, B. M. L., Lwelamira, J., Mzirai, O. B. 2010. Adoption of improved

agricultural technologies for Irish potatoes (Solanum tuberosum) among

farmers in Mbeya rural district, Tanzania: A case of Ilungu ward. Animal and

Plant Sciences 8: 927- 935.

Natarajan, P.,Trinh, T., Mertz, L., Goldsborough, M & Fox, D. K. 2000. Paper-based

archiving of mammalian and plant samples for RNA analysis. Biotechniques

29:1328-1333.

Ndunguru, J., Taylor, N. J., Yadav, J., Aly, H., Legg, J. P., Aveling, T., Thompson,

G. & Fauquet, C. M. 2005. Application of FTA technology for sampling,

recovery and molecular characterization of viral pathogens and virus-derived

transgenes from plant tissues. Virology Journal 2: 45.

46

Njukeng, A. P., Chewachong, M. G., Chofong, G., Demo, P., Sakwe, P. & Njualem,

K. D. 2007. Determination of virus-free potato planting materials by positive

selection and screening of tubers from seed stores in the western highlands of

Cameroon. In: Ahmed, K. Z., Mahmoud, M, A., Shalabi, S. I., El-Morsi, A.,

Hamady, E. & Ismael, A. M. (Eds). Crop research, technology dissemination

and adoption to increase food supply, reducing hunger and poverty in Africa

(African Crop Science Conference Proceedings, October 27-31 2007, El Minia,

Egypt) 809 – 815 pp.

Pourrahim, R., Farzadfar, S., Golnaraghi, A. R., & Ahoonmanesh, A. 2007.

Incidence and distribution of important viral pathogens in some Iranian potato

fields. Plant Disease 91: 609-615.

Putnam, M. L. 1995. Evaluation of selected methods of plant disease diagnosis. Crop

Protection 14: 517-525.

Puurand, U., Mäkinen, k., Paulin, l. & Saarma, M. 1994. The nucleotide sequence of

potato virus A genomic RNA and its sequence similarities with other

potyviruses. Journal of General Virology 75: 457-461.

Querci, M., Vlugt, R., Goldbach, R. &S alazar, L. F. 1993. RNA sequence of potato

virus X strain HB. Journal of General virology 74: 2251- 2255.

Rajamäki, M., Merits, A., Rabenstein, F., Andrejeva, J., Paulin, L., Kekarainen, T.,

Kreuze, J.F., Forster, L. R. S. & Valkonen, J. P. T. 1998. Biological,

serological, and molecular differences among isolates of potato A potyvirus.

The American Phytopathological Society 88: 311 – 321.

Roy, Y. & Nassuth, A. 2005. Detection of plant genes, gene expression and viral

RNA from tissue prints on FTA cards. Plant Molecular Biology Reporter 23:

383-395.

47

Ruiz de Galarreta, J. I., Carrasco, A., Salazar, A., Barrena, I., Iturritxa, .E,

Marquinez, R., Legorburu, F.J. & Ritter, E. 1998. Wild Solanum species as

resistance against different pathogens of potato. Potato Research 41:57-68.

Ryu, K. H. & Hong, J.S. 2008. Potexvirus. In: Mahy, B.W & Regenmortel, M.H.V

(Eds).201 Desk enciclopedia of plant and fungal virology. San Diego,

California, USA 298-302 pp.

Saitou N. & Nei M. 1987. The neighbor-joining method: a new method for

reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406-425.

Schubert, J., Fomitcheva, V. & Sztangret-Wisniewskab, J. 2007. Differentiation of

Potato virus Y strains using improved sets of diagnostic PCR-primers.

Virological Methods 140: 66-74.

Singh, R. P., Valkonen, J. P. T., Gray, S. M., Boonham, N., Jones, R. A. C., Kerlan,

C. & Schubert J. 2008. Discussion paper: The naming of Potato virus Y strains

infecting potato. Archives of Virology 153: 1–13.

Singh, R. P. 1999. Development of the molecular methods for potato virus and viroid

detection and prevention. Genome 42: 592 – 604.

Sonenberg, N., Shatkin, A.J., Ricciardi, R.P., Rubin, M. & Goodman, R.M. 1978.

Analysis of terminal structures of RNA from potato virus X. Nucleic Acids

Research 5: 2501-2512.

Tamura, K.,Peterson, D.,Peterson, N.,Stecher, G.,Nei, M. & Kumar, S.

2011.MEGA5: Molecular evolutionary genetics analysis using maximum

likelihood, evolutionary distance, and maximum parsimony methods.

Molecular Biology and Evolution 28: 2731-2739.

48

Thompson J.D., Higgins D.G., Gibson T.J., 1994. CLUSTAL W: improving the

sensitivity of progressive multiple sequence alignment through sequence

weighting, position specific gap penalties and weight matrix choice. Nucleic

Acids Research 22: 4673-4680.

Valkonen J. P. T. 2007. Viruses: Economical losses and biotechnological potential.

In: Potato Biology and Biotechnology. Elsevier Academic Press. San Diego.

CA. 619-641 pp.

Valkonen, J. P. T, Puurand, U., Slack, S. A., Mákinen,K. & Saarma, M. 1995.Three

strain groups of potato virus A potyvirus based on hypersensitive responses in

potato, serological properties, and coat protein sequences. Plant Disease

79:748–753.

Verchot, J., Angell, S. M. & Baulcombe, D.C. 1998. In vivo translation of the triple

gene block of potato virus X requires two subgenomic mRNAs. Virology 72:

8316-8320.

Wangai, A. & Lelgut, D. 2001. Status of potato viruses in Africa. 2001. In: Hughes,

J. d’A. & Odu, B. O. (eds). Plant virology in sub-Saharan Africa (Proceedings

of a conference organized by IITA, June 4-8 2001, Ibadan, Nigeria). 458- 465

pp.

Webster, C., Wylie, S.J & Jones, M.G.K. 2004. Diagnosis of plant viral pathogens.

Current Science 86:1604-1607.

Weidemann, H. 1988. Importance and control of potato virus YN (PVY

N) in seed

potato production. Potato Research 31: 85-94.

49

9 APPENDICES

Appendix 1: PVM , PVS and PVX isolates used to design forward and reverse

degenerate primers to amplify complete coat protein encoding regions.

PVM

gi|72257063|ref|NC_001361.2| TGAGTTCGGAAGTGTGCTATCAAAATTGAAGCCGTTTGGGTGTGGTTCCT 7192

gi|71003496|dbj|D14449.2|PTMPV TGAGTTCGGAAGTGTGCTATCAAAATTGAAGCCGTTTGGGTGTGGTTCCT 7192

gi|192758576|gb|EU604672.1| TGAATTCGGAAGTGTGCTATCAAAATTGAAGCCGTTTGGGTGTGGTTCCT 7183

gi|32351297|gb|AY311394.1| TGAATTCGGAAGTGTGCTATCAAAGTTAAAGCCGTTTGGGTGTGGTTCCT 7181

gi|32351304|gb|AY311395.1| TGAATTCGGAAGTGTGCTATCAAAGTTGAAGCCGTTTGGGTGTGGTTCCT 7181

gi|361071296|gb|JN835299.1| TGAATTCGGAAGTGTGCTGTCAAAGTTGAAGCCGTTTGGGTGTGGTTCCT 7180

gi|312191361|gb|HM854296.1| TGAATTCGGAAGTGTGCTATCAAAATTGAAGCCGTTTGGGTGTGGTTCCT 7157

*** ************** ***** ** **********************

Forward primer (PVMCPF) GCCGTTTGGGTGTGGTTCC

gi|72257063|ref|NC_001361.2| ATGGTCCGGAGCTCACTAGAGATTATGTAAAGTCTAATAGAAAATGAAGG 8142

gi|71003496|dbj|D14449.2|PTMPV ATGGTCCGGAGCTCACTAGAGATTATGTAAAGTCTAATAGAAAATGAAGG 8142

gi|192758576|gb|EU604672.1| ATGGTCCGGAACTCACTAGGGATTATGGAAAGTCGAATAGAAAATGAAGC 8133

gi|32351297|gb|AY311394.1| ATGGTCCAGAGCTCACTAGGGATTATGGAAAGTCGAATAGAAAATGAAGC 8131

gi|32351304|gb|AY311395.1| ATGGTCCGGAGCTCACTAGGGATTATGGAAAGTCGAATAGAAAATGAAGC 8131

gi|361071296|gb|JN835299.1| ATGGCCCGGAGCTCACTAGGGATTATGGAAAGTCGAATAGAAAATGAAGC 8130

gi|312191361|gb|HM854296.1| ATGGTCCGGAGCTCACTAGGGATTATGGAAAGTCGAATAGGAAATGAAGC 8107

**** ** ** ******** ******* ****** ***** ********

Reverse primer (PVMCPR) CCRTGGTT

gi|72257063|ref|NC_001361.2| ACGTAACCAAGGTGGCTTTACTTATAGCGAGAGCTATGTGTGCCTCTTCA 8192

gi|71003496|dbj|D14449.2|PTMPV ACGTAACCAAGGTGGCTTTACTTATAGCGAGAGCTATGTGTGCCTCTTCA 8192

gi|192758576|gb|EU604672.1| ACGTAACCAAGGTGGCTTTACTTATAGCGAGAGCTATGTGTACTTCTTCA 8183

gi|32351297|gb|AY311394.1| ACGTAACCAGGGTGGCTTTAATTATAGCGAGAGCTATGTATACTTCTTCA 8181

gi|32351304|gb|AY311395.1| ACGTAACCAGGGTGGCCTTAATAATAGCGAGAGCTATGTGTACTTCTTCA 8181

gi|361071296|gb|JN835299.1| ACGTAACCAGGGTGGCTTTAATTATAGCAAGAGCTATGTGTACTTCTTCA 8180

gi|312191361|gb|HM854296.1| ACGTAACCAGGGTGGCTTTACTTATAGCGAGAGCTATGTGTACTTCTTCA 8157

********* ****** *** * ***** ********** * * ******

ACGTSCTTCATT

PVS1

gi|281200009|gb|GU144326.1| --------------------------------------------------

gi|281200001|gb|GU144322.1| --------------------------------------------------

gi|281200007|gb|GU144325.1| --------------------------------------------------

50

gi|281200011|gb|GU144327.1| --------------------------------------------------

gi|281200005|gb|GU144324.1| --------------------------------------------------

gi|226359395|gb|FJ813513.1| TCTGCTTGTCAGGGCGTCATGCTCCACGCTGTCCAAGGTGCAACCGAGTG 7000

gi|281200017|gb|GU144330.1| --------------------------------------------------

gi|281200013|gb|GU144328.1| --------------------------------------------------

gi|281200015|gb|GU144329.1| --------------------------------------------------

gi|71609013|emb|AJ863509.1| TCTGCTTATCAGGGCGTCATGCTCCATGCTGTCCAAGGTGCAACCGAGTG 6993

gi|71849435|ref|NC_007289.1| TCTGCTTATCAGGGCGTCATGCTCCATGCTGTCCAAGGTGCAACCGAGTG 6993

gi|71609021|emb|AJ863510.1| TCTGTCTATCCGGGCGTCATGCTCAATGCTGCCCAAGATGCAACCGAGTG 6988

gi|386762717|gb|JQ647830.1| TTTGTCTATCTGGGCGTCATGCTCAATGTTGCCCAAGGTGCAATCGAGTG 6996

Forward primer (PVSCPF1) TATCTGGGCGTCATGCTC

gi|281200009|gb|GU144326.1| --------CCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 42

gi|281200001|gb|GU144322.1| -------------------CCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 31

gi|281200007|gb|GU144325.1| -------GCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 43

gi|281200011|gb|GU144327.1| ---------------AGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 35

gi|281200005|gb|GU144324.1| -------------------CCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 31

gi|226359395|gb|FJ813513.1| CATTGGGGCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 7200

gi|281200017|gb|GU144330.1| -------GCCGTTGAAACACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 43

gi|281200013|gb|GU144328.1| -----TGGCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 45

gi|281200015|gb|GU144329.1| -----TGGCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 45

gi|71609013|emb|AJ863509.1| CATTGGGGCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 7193

gi|71849435|ref|NC_007289.1| CATTGGGGCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 7193

gi|71609021|emb|AJ863510.1| --CTAAGGCCGTTGAAACACCTTTAGGTTCACAGGTAAAAGCTCGAATAT 7185

gi|386762717|gb|JQ647830.1| CACTAAGGCCATTGAAACACCTTTAGGTTCACAGGTAAAAGCTCGAATAA 7196

******************* ** ***** *

Reverse primer (PVSCPR1) TTACCTGTGAACCTAAAGG

PVS 2

gi|281200009|gb|GU144326.1| --------CCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 42

gi|281200001|gb|GU144322.1| -------------------CCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 31

gi|281200007|gb|GU144325.1| -------GCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 43

gi|281200011|gb|GU144327.1| ---------------AGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 35

gi|281200005|gb|GU144324.1| -------------------CCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 31

gi|226359395|gb|FJ813513.1| CATTGGGGCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 7200

gi|281200017|gb|GU144330.1| -------GCCGTTGAAACACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 43

gi|281200013|gb|GU144328.1| -----TGGCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 45

gi|281200015|gb|GU144329.1| -----TGGCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 45

gi|71609013|emb|AJ863509.1| CATTGGGGCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 7193

gi|71849435|ref|NC_007289.1| CATTGGGGCCGTTGAAGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAA 7193

gi|71609021|emb|AJ863510.1| --CTAAGGCCGTTGAAACACCTTTAGGTTCACAGGTAAAAGCTCGAATAT 7185

gi|386762717|gb|JQ647830.1| CACTAAGGCCATTGAAACACCTTTAGGTTCACAGGTAAAAGCTCGAATAA 7196

51

******************* ** ***** *

Forward primer (PVSCPF2) CCTTTAGGTTCACAGGTAA

gi|281200009|gb|GU144326.1| GGATGCTTGGCGCTGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 941

gi|281200001|gb|GU144322.1| GGATGCTTGGCGCTGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 930

gi|281200007|gb|GU144325.1| GGATGCTTGGCGCTGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 942

gi|281200011|gb|GU144327.1| GGATGCTTGGCGCTGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 934

gi|281200005|gb|GU144324.1| GGATGCTTGGCGCTGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 930

gi|226359395|gb|FJ813513.1| GGATGCTTGGCGCTGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 8099

gi|281200017|gb|GU144330.1| GGATGCTTGGCGCCGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 942

gi|281200013|gb|GU144328.1| GGATGCTTGGCGCTGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 944

gi|281200015|gb|GU144329.1| GGATGCTTGGCGCTGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 944

gi|71609013|emb|AJ863509.1| GGATGCTTGGCGCTGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 8092

gi|71849435|ref|NC_007289.1| GGATGCTTGGCGCTGAGATTGTGCGCAATCACCGTAATGCGATCAACCAA 8092

gi|71609021|emb|AJ863510.1| GCATGCTCGGTGCTGAGATTGTGCGTAATCATCGGAATGCAATAAACCAA 8081

gi|386762717|gb|JQ647830.1| GCATGCTCGGCGCTGAGGTCGTGCGTAACCATCGGAATGCAGCAAATCAA 8095

* ***** ** ** *** * ***** ** ** ** ***** ** ***

Reverse primer (PVSCPR1) TCATTGGTTGATCGC

gi|281200009|gb|GU144326.1| TGAAGGCAGACCGTTTAGACCTGTTAC----------------------- 968

gi|281200001|gb|GU144322.1| TGAAGGCAGACCG------------------------------------- 943

gi|281200007|gb|GU144325.1| TGAAGGCAGACCGTTTAGACCTGTTA------------------------ 968

gi|281200011|gb|GU144327.1| TGAAGGCAGACCGTTTAGACCT---------------------------- 956

gi|281200005|gb|GU144324.1| TGAAGGCAGACCGTTTA--------------------------------- 947

gi|226359395|gb|FJ813513.1| TGAAGGCAGACCGTTTAGCCACGTTATTATTGTGTGTCCATCGACTGGGA 8149

gi|281200017|gb|GU144330.1| TGAAGGCAGACCGTTTAGACCTGTTACAA--------------------- 971

gi|281200013|gb|GU144328.1| TGAAGGCAGACCGTTTAGACCTGTTACA---------------------- 972

gi|281200015|gb|GU144329.1| TGAAGGCAGACCGTTTAGACCTGTTACA---------------------- 972

gi|71609013|emb|AJ863509.1| TGAAGGCAGACCGTTTAGCCACGTTATTATTGTGTGTCCATCGACTGGGT 8142

gi|71849435|ref|NC_007289.1| TGAAGGCAGACCGTTTAGCCACGTTATTATTGTGTGTCCATCGACTGGGT 8142

gi|71609021|emb|AJ863510.1| TGAAAGCGGAACGTTTAGAAATGTTACTGTTGTGTGTTTACAGGCTGGGT 8131

gi|386762717|gb|JQ647830.1| TGAGAGCAGAACGTCTAAATATGTTACTTCTGTGTGTTTACCGACTGGGT 8145

*** ** ** **

ATT

PVX

gi|215513426|gb|FJ461343.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|145588167|gb|EF423572.1| GCCATTGCCGATCTCAAACCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|333502|gb|M38480.1|PVXGEN GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5639

52

gi|309910|gb|M72416.1|PVXCG GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|340774928|gb|JF430080.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|301171106|dbj|AB195999.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|73746007|gb|AF272736.2| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|18147722|dbj|AB056718.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|70994249|dbj|AB056719.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|301171112|dbj|AB196000.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|301171118|dbj|AB196001.1| GCTATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|315112371|gb|HQ450388.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5637

gi|315112365|gb|HQ450387.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5637

gi|215481430|ref|NC_011620.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|189909170|gb|EU571480.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTG 5638

gi|154816334|gb|EU021215.1| GCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTA 5638

gi|9622343|gb|AF172259.1| GCTCTGGCTAACCTCAAACCACTCTCACTTGAGCGGTTAAGTTTCCAGTG 5638

gi|333488|gb|M63141.1|PVXCGA GCTCTGGCTAATCTCAAACCACTCTCACTTGAGCGGTTAAGTTTCCAGTG 5638

** * ** * ***** ******** **** ************** *

Forward primer (PVXCPF) TTGARCGGTTAAGTTTCCA

gi|215513426|gb|FJ461343.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|145588167|gb|EF423572.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|333502|gb|M38480.1|PVXGEN CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6436

gi|309910|gb|M72416.1|PVXCG CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAATGGA 6438

gi|340774928|gb|JF430080.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|301171106|dbj|AB195999.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|73746007|gb|AF272736.2| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAATAAA 6438

gi|18147722|dbj|AB056718.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|70994249|dbj|AB056719.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|301171112|dbj|AB196000.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|301171118|dbj|AB196001.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|315112371|gb|HQ450388.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAATAA- 6436

gi|315112365|gb|HQ450387.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAATAA- 6436

gi|215481430|ref|NC_011620.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|189909170|gb|EU571480.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|154816334|gb|EU021215.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6435

gi|9622343|gb|AF172259.1| CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAATAAA 6435

gi|333488|gb|M63141.1|PVXCGA CCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAAT--- 6432

***********************************************

Reverse primer (PVXCPR) AGAAAATACTATGAAACTGGG

53

Appendix 2: Buffers used for DAS-ELISA

Coating buffer

Substance Amount

Na2CO3 0.8g

NaHCO3 1.4g

1% NaN3 10 ml

H2O 500 ml

pH 9.6

Washing buffer

Phosphate Buffered Saline + 0.05% Tween 20

E

Extraction buffer

Substance Amount

Polyvinyl pyrrolidone 10g

Bovine serum albumin 1g

1% NaN3 10 ml

Wash buffer 500 ml

pH 7.4

Substrate buffer

Substrate buffer

Substance Amount

Diethanolamine 48.5 ml

1% Sodium azide 10 ml

H2O 500 ml

pH 9.8

p-nitrophenyl phosphate 500 mg