Virulence Genes of O149 Enterotoxigenic E. Coli

7/31/2019 Virulence Genes of O149 Enterotoxigenic E. Coli

1/15

Veterinary Microbiology 97 (2003) 87101

Virulence genes of O149 enterotoxigenicEscherichia coli from outbreaks of postweaning

diarrhea in pigs

Babak N. Noamania

, John M. Fairbrotherb

, Carlton L. Gylesa,

a Department of Pathobiology, Ontario Veterinary College, University of Guelph,

Guelph, Ont., Canada, N1G 2W1b Department of Pathology and Microbiology, School of Veterinary Medicine, University of Montreal,

St. Hyacinthe, Que., Canada, J2S 7C6

Received 13 January 2003; received in revised form 14 August 2003; accepted 14 August 2003

Abstract

The goal of this research was to determine whether isolates of O149 porcine enterotoxigenic

Escherichia coli (ETEC) recovered from recent outbreaks of severe diarrhea in weaned pigs in On-

tario, Canada, had virulence attributes different from those of isolates of the same serogroup from

diarrhea of pigs in the 1970s and 1980s. Polymerase chain reaction amplification was used to deter-

mine the distribution of 11 virulence-associated genes in recent (100 isolates) and old (35 isolates)

Ontario O149 porcine ETEC. These tests demonstrated that 92% of the recent isolates possessed

the estA gene for STa enterotoxin, whereas none of the old isolates had this gene. H antigen de-

termination showed that all the isolates which lacked the estA gene (all 35 old isolates plus 8 re-

cent isolates) were H43, whereas isolates which had the estA gene were H10. The astA gene for

enteroaggregative heat-stable enterotoxin (EAST1) and the K88ac antigen were present in all 135

isolates. Plasmid analyses identified a cryptic 5.1 kb plasmid in 99% of recent and 60% of old iso-

lates. Suppressive subtractive hybridization associated several types of DNA fragments with therecent O149 ETEC, namely, fragments with no homology to DNA in databases, fragments of LPS

biosynthesis genes, and F plasmid DNA. We conclude that the recent outbreaks of PWD in On-

tario pigs were associated primarily with a new serotype of O149 ETEC and that isolates of this

serotype possessed the estA gene that was not present in old O149 ETEC isolated from pigs in

Ontario.

2003 Elsevier B.V. All rights reserved.

Keywords: Escherichia coli; Enterotoxigenic; O149; H10; H43; Pig; Bacteria; Diarrhea

Corresponding author. Tel.:+1-519-824-4120x4715l; fax: +1-519-767-0809.

E-mail address: [email protected] (C.L. Gyles).

0378-1135/$ see front matter 2003 Elsevier B.V. All rights reserved.

doi:10.1016/j.vetmic.2003.08.006


2/15

88 B.N. Noamani et al. / Veterinary Microbiology 97 (2003) 87101

1. Introduction

Over the past 5 years, there has been a marked increase in frequency and severity of

outbreaks ofEscherichia coli postweaning diarrhea (PWD) in pigs in Ontario and Quebec(J. Fairbrother, personal communication; Josephson and Smart, 1998; Josephson et al.,

1999, 2000). Investigations failed to identify management factors that could be associated

with the severe outbreaks (Amezcua, 2001). The enterotoxigenic E. coli (ETEC) that were

isolated from affected pigs were hemolytic K88-positive organisms that were not otherwise

characterized in diagnostic laboratories. The present study was undertaken to determine

whether the K88-positive ETEC isolated from these outbreaks possess unusual virulence

attributes.

The known virulence factors of ETEC are fimbriae associated with colonization of the

intestine, and enterotoxins which are responsible for inducing diarrhea. The fimbriae that

have been implicated in PWD are F18 and K88 (F4), each of which exists as two major

variants, called ab and ac. Whereas F18 fimbriae are associated almost exclusively with

PWD, K88 fimbriae are implicated in diarrhea of neonatal as well as weaned pigs (Gaastra

and de Graaf, 1982; Wittig and Fabricius, 1992; Nagy and Fekete, 1999). F18ab-positive

ETEC often produce verotoxin 2e (VT2e), are capable of causing edema disease, and are

appropriately referred to as ETEC/VTEC (Nagy et al., 1997; Parma et al., 2000; Fekete

et al., 2002). Typically, ETEC carry only a single type of colonization pilus, but occasionally

isolates carry both F18 and K88 fimbriae (Nagy and Fekete, 1999). Other types of fimbriae,

including 987P (F6) (Moon, 1990), K99 (F5) (Smith and Linggood, 1971; Orskov et al.,

1975) and F41 (Vazquez et al., 1996) are usually found on porcine ETEC isolated fromneonatal pigs (Wilson and Francis, 1986; Harel et al., 1991; Ojeniyi et al., 1994), and are

only occasionally found on ETEC from weaned pigs (Wilson and Francis, 1986; Nagy and

Fekete, 1999; Frydendahl, 2002).

Four enterotoxin genes have been reported in ETEC from pigs with PWD: elt(heat-labile

enterotoxin, LT), estA (heat-stable enterotoxin STa or STI), estB (heat-stable enterotoxin

STb or STII), and astA (the enteroaggregative heat-stable enterotoxin, EAST1). Various

combinations ofelt, estA, and estB genes have been described in ETEC (Mainil et al., 1998;

Osek, 1999; Amezcua et al., 2002; Frydendahl, 2002). The literature on astA genes is very

recent and limited, but these genes have been particularly associated with K88-positive

ETEC (Yamamoto and Nakazawa, 1997; Frydendahl, 2002; Menard and Dubreuil, 2002;Osek, 2003). In the case of O149 ETEC, most reports on isolates have indicated a high

prevalence of the combination of elt and estB genes, but strains with elt, estA, and estB

genes have also been reported (Mainil et al., 1998; Osek, 1999, 2000).

Recently, An et al. (1999) described the paa gene which encodes the porcine attaching

and effacing associated (Paa) protein, which is associated with the attaching and effacing

phenotype in certain porcine strains of E. coli. Nothing is known of the prevalence or role

of this gene in the virulence of porcine ETEC.

Two potential advantages that ETEC strains have over non-enterototoxigenic E. coli are

greater dispersion by pigs with diarrhea compared to pigs with normal feces, and greater

opportunity for acquisition of genes due to the massive numbers of the bacteria in theintestinal tracts of affected pigs. It would, therefore, not be surprising if ETEC strains

acquired genes which enhanced their virulence. Enhanced virulence of ETEC in recent


3/15

B.N. Noamani et al. / Veterinary Microbiology 97 (2003) 87101 89

outbreaks of postweaning diarrhea could also be due to the presence of a new clone of O149

E. coli with additional virulence factors. The hypothesis that was tested by experiments

described in this paper was that O149:K88ac ETEC from recent outbreaks of diarrhea

in pigs in Ontario possess genes which have enhanced their virulence compared to olderisolates. A collection of 100 O149 ETEC isolated from pigs with PWD during 19982001

was compared with a collection of 35 O149 ETEC isolated from pigs with PWD in the

period 19741987. The two collections were compared for possession of genes for K88ac,

F18, 987P, and F41 fimbriae; LT, STa, STb, EAST1, and STx2e toxins; and Paa protein.

Subtractive hybridization was also conducted between a recent and an old isolate of O149

ETEC to identify potential virulence or fitness genes that have not previously been associated

with porcine ETEC.

2. Materials and methods

2.1. Bacterial strains

A total of 135 hemolytic O149 ETEC isolates from cases of PWD in pigs in Ontario were

obtained from the Animal Health Laboratories (AHL, Guelph, Ontario) and Gallant Custom

Laboratories (Cambridge, Ontario). The collection consisted of 100 isolates recovered from

pigs with PWD in the period 19982001 (recent isolates) and 35 isolates recovered from

pigs with diarrhea in the period 19741987 (old isolates). All the isolates were streaked on

blood agar, checked for purity, tested biochemically to ensure that they were E. coli, then

frozen at 70

C in a milk-based freezing solution (Harris, 1954).

2.2. Identification of O149 and K88ac antigens

Both O149 and K88ac antigens were identified by slide agglutination tests. A small

portion of a bacterial colony grown on blood agar was suspended in one drop of normal

saline solution on a microscope slide. One drop of antiserum was added and mixed by

gently rocking the slide. Agglutination within 30 s was recorded as a positive reaction. The

O149 antiserum was produced by repeated intravenous inoculation of a rabbit with a strain

of heat-killed ETEC O149:K91 which was negative for the K88ac antigen. The K88ac

antigen was purchased from a commercial source (E. coli laboratory, Facult de mdecinevtrinaire, Service de diagnostic, Universit de Montral, St. Hyacinthe, PQ).

2.3. Hemolysin activity

The growth from the frozen stock was touched with an inoculating loop, streaked on a

blood agar plate (Columbia agar, supplemented with 5% sheep blood, Oxoid), and incubated

overnight at 37 C. Hemolysis was evident as a zone of lysis surrounding the bacterial

growth.

2.4. Antimicrobial sensitivity test

Susceptibility of isolates to nine antibacterial drugs was determined by disc diffusion

as per NCCLS methods, described by the disk manufacturer (BBL, Becton Dickinson


4/15


Microbiology Systems, Franklin Lakes, NJ, USA). The antibacterial drugs that were tested

were ampicillin (Am), apramycin (Ap), ceftiofur (Cef), enrofloxacin (En), gentamicin (G),

neomycin (N), spectinomycin (Sp), tetracycline (Tc), and trimethoprim/sulfamethoxazole

(T/S). These are the antimicrobial agents that are in common use in swine enterprises inOntario and are the agents that are used for routine testing in the Animal Health Laboratory,

Laboratory Services, University of Guelph.

2.5. Multiplex PCR assay for detection of nine virulence genes

The multiplex PCR assay allowed amplification of nine virulence genes associated with

porcine ETEC, namely genes for LT, STa, STb, STx2e, K88, K99, F18, F41 and 987P

(Bosworth and Casey, 1997). DNA template was prepared according to the instructions of

the manufacturer (Instagene, Bio-Rad Lab., Mississauga, ON). Each 25l reaction con-

tained 0.2 mM of each dNTP, 0.5 mM of each primer, 1/10 volume of 10 PCR buffer,3.5 mM MgCl2, 10l template DNA, and 2.5 units of Taq polymerase. The samples were

amplified in a GeneAmp PCR 2400 thermocycler (Perkin-Elmer). The PCR products were

electrophoresed in 1% agarose (Invitrogen Life Technologies, Carlsbad, CA) in 0.5

tris-borate EDTA (TBE) buffer for 1 h at 100 V, stained with ethidium bromide, and pho-

tographed under UV light.

2.6. PCR assays for detection of genes for EAST1 and Paa

The protocols for PCR amplification of the genes for EAST1 and Paa were as described

by Yamamoto and Nakazawa (1997) and An et al. (1999), respectively.

2.7. PCR assays for detection of genes for H10 and H43 antigens

A random sample of five recent and five old isolates were serotyped at the Health Canada

Laboratory for Foodborne Zoonoses to confirm the identity of the O149 antigen and to

determine the H antigen(s) present on the isolates. Subsequently, primers were designed to

specifically amplify sequences of the fliC genes that encode the H10 and H43 flagellins,

and all isolates were tested by PCR to determine whether they possessed the fliCgene that

encodes H10 or H43 antigen. These tests were conducted as individual PCR reactions. The

primers (Table 1) were synthesized by the Guelph Molecular Super Center, LaboratoryServices, University of Guelph. DNA was obtained by boiling the cultures. Each 25l

Table 1

Primers for amplification of the fliCgenes encoding E. coli H10 and H43 antigens

Gene Primer Primer sequence (53) Size of amplicon (bp)

fliCH10a 10F GTAACTACTGTTGGCCGCGATG 171

10R AACACCAGCATCACTGATATTAGCG

fliCH43b 43F AAATCGACTCTTCAACCCTGGG 443

43R CAGTTTCAGGCCACTCGTGTC

a Based on nucleotide sequence in AF169320.b Based on nucleotide sequence in AF169323.


5/15


reaction mixture contained 10l of the template DNA, 0.2 mM de-oxynucleotide triphos-

phates (dNTPs), 0.4 pmol of each primer, 2.5lof10PCR buffer (supplied with Taq poly-

merase), 2.0 mM MgCl2 and one unit ofTaq polymerase (AmpliTaq Gold DNA polymerase,

Perkin-Elmer, Foster City, CA). PCR conditions consisted of a denaturing step at 94 C for3 min, followed by 35 cycles of a denaturing step at 95 C for 45 s, an annealing step at 65C

for 45 s and extension at 72 C for 45 s, followed by a final extension at 72 C for 7 min.

2.8. Plasmid profiles

Plasmid DNA was prepared using the Qiagen Plasmid Mini Kit (Qiagen, Mississauga,

ON). The protocol is based on alkaline lysis, followed by binding of plasmid DNA to Qiagen

anion-exchange resin under low salt and pH conditions, elution, precipitation, and solution

of the precipitated DNA in sterile distilled water. Samples were run on 0.7% agarose gels,

stained with ethidium bromide, and photographed under UV light.

2.9. Subtractive hybridization

One recent isolate (Ro8) and one old isolate (Old82) which had similar plasmid pro-

files and a minimum number of drug resistance markers, were selected for subtractive

hybridization. Isolate Ro82 was an O149:H10 isolate that was resistant to tetracycline only

and possessed genes for LT, STb, STa, K88, and EAST1. Isolate Old 82 was an O149:H43

isolate that was also resistant to tetracycline only and possessed genes for LT, STb, K88,

and EAST1. Genomic DNA preparations from both isolates were isolated using a Qiagen

kit (Qiagen, Tip 100). DNA sequences common to a recent and an old O149:K88ac isolatewere removed and sequences unique to the recent isolate were amplified by two rounds

of PCR, following the instructions of the manual of the Clontech PCR-Select Bacterial

Genome Subtraction Kit (Clontech, Palo Alto, CA, USA). PCR products were ligated to

pGEM T-EASY vector (Promega, Madison, WI, USA) and the ligated products were trans-

formed into XL1-Blue (Stratagene, La Jolla, CA, USA) competent cells (Nishimura et al.,

1990). Transformants were selected for ampicillin resistance. Plasmid DNA was extracted

(Qiagen minikit Tip 20), the concentrations of plasmid DNA were estimated (GeneQuant,

Fisher), and 200g quantities of plasmid DNA were submitted for sequencing (Laboratory

Services, University of Guelph). Primers identical to those used in the nested PCR (Clon-

Tech PCR-Select Bacterial Genome Subtraction Kit, ClonTech) were used for sequencing.The nucleotide sequences of DNA inserted in the plasmid vector were subjected to BLAST

searches (National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov).

The specificity of cloned DNA fragments that did not show homology to E. coli K12 se-

quence was determined by PCR amplification, using primers that hybridized specifically

to the cloned fragments. The PCR amplifications were conducted with the cloned DNA

fragments, genomic DNA of strain Ro8, and genomic DNA of strain Old82 as templates.

3. Results

The slide agglutination tests confirmed that all 100 recent and 35 old isolates belonged

to O149 and were K88ac-positive. The results of H antigen determination by serological
http://www.ncbi.nlm.nih.gov/http://www.ncbi.nlm.nih.gov/


6/15


Fig. 1. PCR identification of genes for K88, LT, STa, and STb in old and new O149 ETEC. Lane 1: molecular weight

markers (bp). Lane 2: PCR products of F41 (612 bp), K88 (499 bp), LT (272 bp), STa (158 bp), and STb (113 bp)

genes. Lane 3: products of STx2e (733 bp), 987P (409 bp), F18 (313 bp), and STa (158 bp). Lane 4: products from

negative control E. coli K12 strain 711. Lane 5: product from strain 711 which received spectinomycin resistancegenes in mating with recent O149 ETEC strain JG280. Lane 6: PCR products from strain JG280. Lane 7: PCR

products from an old O149 ETEC strain.

methods showed that all five old isolates and one new isolate possessed the H43 antigen

and that four recent isolates possessed the H10 antigen. The results of PCR determination

of the H10 and H43 antigens showed that among the 35 old isolates, all possessed the gene

for the H43 antigen, whereas among the recent isolates eight possessed the gene for the

H43 antigen and 92 possessed the gene for the H10 antigen. Hemolytic activity on blood

agar plates was detected in all 135 isolates.The results from multiplex PCR assay (illustrated in Fig. 1) showed that the only re-

markable difference between recent and old isolates was the presence of the gene for STa

heat-stable enterotoxin in 92% of the recent isolates, and its absence from the old isolates.

All 92 recent isolates which possessed the fliC gene for the H10 antigen also possessed

the estA gene. Multiplex PCR amplification demonstrated that all of the isolates carried

the faeG gene for K88 adhesin, and that none carried genes for the F18, F41, or 987P

fimbriae or the STx2e toxin. All of the old isolates and all but one of the recent iso-

lates carried the genes for LT and STb. Single PCR assays showed that the astA gene for

EAST1 was present in all of the isolates. The most common virulence pattern for recent

isolates was K88/EAST1/LT/STa/STb, whereas the most common pattern for old isolateswas K88/EAST1/LT/STb. The porcine attaching and effacing associated gene was present

in 17% of the recent isolates and none of the old isolates.


7/15


Fig. 2. Percentage of old and recent isolates resistant to each of eight antibiotics. All isolates were susceptible to

enrofloxacin. Tc: tetracycline, Sp: spectinomycin, Am: ampicillin, N: neomycin, G: gentamicin, Ap: ampicillin,

T/S: trimethoprim/sulfamethoxazole, and Cef: ceftiofur.

Major patterns of resistance of the isolates to the antimicrobial drugs except enrofloxacin

are shown in Fig. 2. All isolates were sensitive to enrofloxacin. Resistance to tetracycline

was present in over 95% of the recent isolates and in 40% of the old isolates. Resistance to

apramycin was not observed in old isolates and was less than 20% in the recent isolates.

The numbers and sizes of plasmids were determined for the 135 isolates. All isolatescarried two to eight plasmids whose sizes varied from 3 kb to greater than 167 kb. Most

recent isolates possessed a cluster of three to five large plasmid bands (90150 kb) and 99%

of these isolates also had a cryptic plasmid of 5.1 kb (Fig. 3). Sixty percent of the old isolates

had a 5.1 kb plasmid band. Southern hybridization showed that the recent ETEC isolates

typically possessed a cluster of plasmid bands in the 7288 kb range that encoded LT, STb,

K88, and STa, and a single band in the range of 5469 kb, which encoded alpha hemolysin

and EAST1 (Gyles, unpublished). Among the old isolates, the cluster or a single band at

7288 kb usually encoded LT, STb, K88, and EAST1, whereas a single band at 5469 kb

encoded alpha hemolysin. Bands in the range of 120167 kb were associated with drug

resistance. The cryptic 5.1 kb plasmid was sequenced and shown to be highly related to theColE1-related ColJs plasmid ofShigella flexneri (Smajs and Weinstock, 2001) except that

the region corresponding to the colicin proteins in pCG7 has no homology with sequences

in the databases. There was no feature of the plasmid profiles that distinguished recent and

old isolates.

Cloning of the secondary PCR products into the pGEM T-EASY vector resulted in 78

colonies on medium containing ampicillin, X-gal, and isopropyl thiogalactoside (IPTG).

White colonies were subcultured on LB agar plus ampicillin and were screened for plasmid

content by the cracking method (Nishimura et al., 1990). Screening showed that 75 of the

colonies contained inserts, whose product sizes ranged from 250 to >724 bp. The plasmids

in 46 randomly selected clones were extracted, and the inserted DNA fragments weresequenced. Data from 31 clones whose inserted DNA sequences showed high homology

with E. coli K12 DNA or were present in both tester and driver genomic DNA are not


8/15


Fig. 3. Plasmid profiles of recent and old O149 ETEC isolates. Lanes 1, 2: marker plasmids. Lanes 14: plasmids

from four recent isolates. The 5.1 kb plasmid (lanes 13) was found in almost all recent isolates. Lanes 58: four

old isolates.

shown. These 31 clones included clones with as many as six identical copies. The results

of BLAST analyses of the remaining 15 sequences are shown in Table 2.

Four clones had high homology with the msbA gene (multicopy suppressor of the HtrBtemperature-sensitive phenotype) (Karow and Georgopoulos, 1993), which is involved in

lipid A biosynthesis, and two clones showed high homology with waaT, another gene

implicated in LPS biosynthesis (Table 2). One clone had an insert whose translated protein

sequence was 50% identical to a putative acetyl transferase, which may be involved in LPS

modification. Five clones contained DNA inserts for which no homology was detected in

a BLAST search. Ten clones showed high homology (9199%) with sequences in the F

plasmid. One clone had homology with the ColIb plasmid; one showed homology with

DNA from the mobile genetic element, Tn1721; and one clone was highly homologous

with a region in the S. flexneri SRL pathogenicity island (PAI). The inserts in clones with

homology to genes in E. coli K12 (msbA and waaT), and clones 13, 22, and 25 (Table 2)were detected in both driver and tester genomic DNA. Inserts in the other clones were

unique to the tester genomic DNA.


9/15


Table 2

Analysis of selected DNA sequences recovered following subtractive hybridization

Clone (insert in bp) Homologous gene (% identity) Homologous protein (% identity)

32, 38, 39, 45 (264) E. coli K12a (1101511272)

msbA (98%)

MsbA (100%)

9, 18 (515) E. coli waaT(99%) UDP-galactose:(glucosyl) LPS alpha1,

2-galactosyltransferase waaT(99%)

3 (501) None Putative acetyltransferase of Actinobacillus

actinomycetemcomitans (50%) (87/169)

1 (>169) None None

2 (190) None None

29 (590) None 110280: Conserved hypothetical protein

ofClostridium perfringens (39%);

137310: Helicobacter pylori putative

protein jhp0462 (43%)33 (420) None 101412: Borrelia burgdorferi plasmid

partition protein (38%)

16 (458) F plasmid genomic DNA

(23642820) (98%)

YacA (81%)

74 (>724) F plasmid genomic DNA

(1034510546 and

1944919573) (92%)

Transposon Tn1000 (405584) (91%);

IncFIB replicon (1135) (96%); unknown

(136404)

27 (616) Transposon Tn1721 (99%)

(gi48194)

Probable methyl accepting chemotaxis

protein (Tn1721) (84%)

7 (268) Shigella flexneri 2a SRL

pathogenicity island (98%)

(gi21450881)

168269 is related to E. coli hypothetical

membrane protein YcdU (96%)

All F plasmid DNA sequences are numbered according to gi:8918823 which lists the 99159 bp of the complete

sequence of the F plasmid.a All E. coli K12 sequences are numbered according to gi:6626251 which lists the 4639221 bp of the complete

sequence of strain MG1655.

4. Discussion

The major difference between recent and old isolates in known virulence genes was that

92% of the recent isolates possessed the estA gene (encoding STa), whereas all the oldisolates lacked this gene. The finding that the recent STa-positive isolates were all H10 and

the other isolates were all H43 was very helpful in clarifying the picture. It appears that the

recent outbreak-associated isolates represent a new serotype and are distinctly different from

the old isolates. To our knowledge, this is the first report of the H43 antigen being associated

with O149 ETEC. Interestingly, the O149 ETEC is frequently identified as STa-negative

(Blanco et al., 1997; Sarrazin et al., 2000; Bischoff et al., 2002; Frydendahl, 2002), but there

are some reports of STa-positive isolates of this serotype (Garabal et al., 1996; Frydendahl,

2002). The findings in the present study underscore the importance of determination of H

antigens in characterizing E. coli.

In a study in Quebec, STa was also exclusively associated with recent O149porcine ETEC,but the STa-positive isolates constituted a only 48% of the recent isolates (Fontaine et al.,

2001). Sarrazin et al. (2000) found that, as in Ontario, ETEC of serotype O149:K91:K88ac


10/15


were the most prevalent in Swiss pigs. However, these O149 ETEC possessed genes for

LT and STb but not for STa. Interestingly, STa is associated primarily with ETEC that

cause diarrhea in neonatal pigs and calves (Burgess et al., 1978; Fairbrother et al., 1988;

Ojeniyi et al., 1994), but pigs in the postweaning period have a greater susceptibility to thisenterotoxin than do unweaned pigs (Stevens et al., 1972; Mezoff et al., 1991). Because LT,

STb, and STa act on intestinal epithelial cells by different mechanisms (Nataro and Kaper,

1998), it is expected that the presence of the gene for STa would enhance the capacity of

strains to cause diarrhea.

The findings with respect to the astA gene for EAST1 enterotoxin are similar to those

of recent reports in which the gene has been found in a high percentage of porcine ETEC

(Choi et al., 2001; Fontaine et al., 2002; Frydendahl, 2002). In Quebec, over 90% of O149

ETEC from pigs with diarrhea from 1986 to 2000 had the astA gene (Fontaine et al., 2001).

In Denmark, the astA gene was detected in 100% of O149 porcine ETEC (Frydendahl,

2002). These findings suggest that it may be worthwhile to determine the role of EAST1 in

diarrhea caused by porcine ETEC. The gene for Paa was detected in 17% of recent isolates

compared with 67% reported among O149 ETEC in Quebec (Fontaine et al., 2001). In both

studies, there was a much higher prevalence among recent compared with old isolates. Since

the Paa protein is secreted by a type III secretion system (An et al., 1999), it may play a

role in pathogenesis.

The high frequency of resistance to multiple antimicrobials among recent ETEC isolates is

in agreement with recent reports (Fairbrother, 1999; Josephson et al., 1999; Amezcua et al.,

2002). There is no indication that drug resistance enhances the virulence of ETEC, but

virulence genes are sometimes associated with drug resistance genes (So et al., 1976; Gyleset al., 1977; Franklin et al., 1981; Hunter et al., 1994). Conjugation experiments with se-

lected recent isolates showed that drug resistance and enterotoxin genes were co-transferred

(Gyles, unpublished).

Plasmids that carry virulence factors in porcine ETEC vary in size. The genes for LT and

STb are often found on the same plasmid and range from 67 to105 kb (Gyles et al., 1977;

Franklin et al., 1981; Franklin and Mollby, 1983; Wasteson and Olsvik, 1991). The K88

genes are carried on plasmids that range from 75 to 177 kb (Shipley et al., 1978; de Graaf,

1990; Wasteson and Olsvik, 1991; Bertin, 1992; Mainil et al., 1998). Genes for STa have

been reported on plasmids of molecular sizes from 32 to142 kb (Gyles et al., 1974; Harnett

and Gyles, 1985; So et al., 1979; Bertin, 1992). Yamamoto and Nakazawa (1997) showedthat the gene for EAST1 was carried on a 58 kb plasmid in one isolate and on an 85 kb

plasmid in another isolate. The gene for hemolysin in porcine E. coli has been located on

a 50 kb plasmid (Beutin et al., 1986). These findings indicate that it is difficult to associate

specific virulence genes with a certain size of plasmid.

The old O149 ETEC isolates that were available for examination constituted a smaller

collection and had been stored for a longer time compared with recent isolates. One cannot

rule out the possibility that, because of the low numbers examined, O149:H10 isolates were

missed among the old isolates. However, it is clear that O149:H10 isolates were the dominant

serotype among the new and O149:H43 was dominant among the old isolates. Consideration

was also given to the possibility that old isolates may have lost plasmid-encoded estA genesduring storage. While this is possible, it is highly unlikely. The plasmid-encoded genes

for LT, STb, K88, EAST1, and alpha hemolysin were all maintained on the 35 old strains.


11/15


Besides, a similar study of 66 O149 ETEC in Quebec found that the estA gene was absent

from strains in the years 19781989.

Subtractive hybridization identified a number of DNA fragments that may be unique

to the recent O149 isolate. One set of these fragments consisted of sequences that are re-lated to LPS biosynthesis. Four clones had sequences that were 98% identical to that of

E. coli K12 msbA and two had homology to the waaT gene (Heinrichs et al., 1998). The

msbA gene encodes the proposed inner membrane lipid flippase which is an essential trans-

porter involved in LPS biosynthesis (Doerrler and Raetz, 2002). Although it was present

in both tester and driver strains, it is possible that the tester O149 strain, like O157:H7

EHEC, possesses additional plasmid-borne genes homologous to chromosomal genes in-

volved in LPS biosynthesis. Interestingly, Janke et al. (2001) also identified clones with

genes involved in LPS biosynthesis when they conducted subtractive hybridization in-

volving the uropathogenic E. coli strain 536 as tester and E. coli K12 as driver. Perhaps

these pathogenic E. coli possess additional mechanisms for modulation of the LPS that is

produced.

The sequences for four clones had no homology with sequences in the databases. The

translated protein from the insert in one of these clones (#3) was most closely related

to a putative acetyl transferase involved in the serotype-specific polysaccharide antigen

of Actinobacillus actinomycetemcomitans (gi:9309325) and to acetyl transferases impli-

cated in O antigen biosynthesis in other bacteria including Vibrio cholerae (Li et al.,

2002).

Two clones contained DNA that is highly related to sequences in the F plasmid (Table 2).

One of these clones encoded a portion of the IncFIB replication region, which is relatedto regions in the F plasmid and the virulence plasmid of E. coli O157:H7. The arrange-

ment is different from that of the F plasmid in which the transposon Tn1000 interrupts

the FIC region, whereas in this clone this transposon is associated with the FIB replica-

tion region. These two replication regions are separated by about 10 kb of DNA in the

F plasmid (Firth et al., 1996). The presence of this transposon in a recent O149 ETEC

could promote cointegrate formation and transposition (Berg and Berg, 1996). It is likely

that the recent isolate possessed an F-related plasmid which was not present in the old

isolate.

One clone (#7) had sequences with high homology to a region of the Shigella resistance

locus (SRL) pathogenicity island, a novel complex of genes which encode a ferric dicitratetransport system and a cluster of multiple antibiotic resistance determinants (Luck et al.,

2001). Although the short sequence available provides no information on the genes encoded

by a potential PAI in the O149 ETEC, it is of interest that the site of insertion, namely the

serX tRNA gene (which is the site of insertion of the SRL PAI) was a part of the sequence

encoded by clone #7.

In conclusion, the O149 E. coli isolated in recent years (19982001) from weaned pigs

with diarrhea possess the gene for one additional enterotoxin (STa) compared with old

isolates which lacked this gene. These STa-positive ETEC belonged to a different serotype

(O149:H10) from the old isolates (O149:H43). A cryptic 5.1 kb plasmid was detected in

99% of recent O149 ETEC isolates but only in 60% of old isolates. Subtractive hybridiza-tion yielded a number of unknown gene sequences and F plasmid-related sequences that

were present in a recent isolate and absent from an old isolate. Genes implicated in LPS


12/15


biosynthesis were also identified, although they were not all unique to the recent isolate.

These studies suggest a possible basis for an increased virulence of recent isolates and have

provided several leads for genes which may contribute to virulence or survival properties of

recent O149 porcine ETEC. Although the estA gene was present in 92% of recent isolatesand absent from the old isolates, the evidence suggests that the estA-positive new isolates

represented a new clone rather than old isolates which had acquired the estA gene. Further-

more, although the estA gene could contribute to enhanced virulence of new isolates there

is presently no evidence to indicate whether it does contribute. Deletion of the estA gene

from a new isolate could allow for tests of virulence of an isogenic pair ofestA-positive and

estA-negative O149:H10 ETEC.

Acknowledgements

The research was supported by the Natural Sciences and Engineering Research Councils

Canadian Research Network on Bacterial Pathogens of Swine. The authors are grateful to

Janet Liao for technical assistance and to Dr. Jan MacInnes for helpful advice.

References

Amezcua, R., 2001. Post-weaning diarrhea and mortality caused by Escherichia coli: investigation of risk factors

and control methods. M.Sc. Thesis, University of Guelph.Amezcua, R., Friendship, R.M., Dewey, C.E., Gyles, C., Fairbrother, J.M., 2002. Prevalence of hemolytic E. coli

serogroups involved, and their antimicrobial resistance patterns. Can. J. Vet. Res. 66, 7378.

An, H., Fairbrother, J.M., Desautels, C., Harel, J., 1999. Distribution of a novel locus called paa (porcine attaching

and effacing associated) among enteric Escherichia coli. Adv. Exp. Med. Biol. 473, 179184.

Berg, C.E., Berg, M.D., 1996. Transposable element tools for microbial genetics. In: Neidhardt, F.C., Curtiss, R.

III, Gross, C., Ingraham, J., Lin, E.C.C., Low, K.B., Magasanik, B., Reznikoff, W.S., Riley, M., Schaechter,

M., Umbarger, H.E. (Eds.), Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology,

vol. 2. American Society for Microbiology, Washington, DC, pp. 25882612.

Bertin, A., 1992. Plasmid content and localisation of the STaI (STaP) gene in enterotoxigenic Escherichia coli

with a non-radioactive polynucleotidegene probe. J. Med. Microbiol. 37, 141147.

Beutin, L., Montenegro, M., Zimmermann, S., Stephan, R., 1986. Characterization of hemolytic strains of

Escherichia coli belonging to classical enteropathogenic O-serogroups. Zentralbl. Bakteriol. Mikrobiol. Hyg.

261, 266279.

Bischoff, K.M., White, D.G., McDermott, P.F., Zhao, S., Gaines, S., Maurer, J.J., Nisbet, D.J., 2002.

Characterization of chloramphenicol resistance in beta-hemolytic Escherichia coli associated with diarrhea in

neonatal swine. J. Clin. Microbiol. 40, 389394.

Blanco, M., Blanco, J.E., Gonzalez, E.A., Mora, A., Jansen, W., Gomes, T.A., Zerbini, L.F., Yano, T., de Castro,

A.F., Blanco, J., 1997. Genes coding for enterotoxins and verotoxins in porcine Escherichia coli strains

belonging to different O:K:H serotypes: relationship with toxic phenotypes. J. Clin. Microbiol. 35, 2958

2963.

Bosworth, B.T., Casey, T.A., 1997. Identification of toxin and pilus genes in porcine E. coli using polymerase

chain reaction (PCR) with multiple primer pairs. In: Proceedings of the Abstracts of the 97th Annual General

Meeting, Abstract B-509. American Society for Microbiology, Miami Beach, FL.Choi, C., Cho, W., Chung, H., Jung, T., Kim, J., Chae, C., 2001. Prevalence of the enteroaggregative Escherichia

coli heat-stable enterotoxin 1 (EAST1) gene in isolates in weaned pigs with diarrhea and/or edema disease.

Vet. Microbiol. 81, 6571.


13/15


de Graaf, F.K., 1990. Genetics of adhesive fimbriae of intestinal Escherichia coli. Curr. Top. Microbiol. Immunol.

151, 2953.

Doerrler, W.T., Raetz, C.R., 2002. ATPase activity of the MsbA lipid flippase of Escherichia coli, J. Biol. Chem.

Fairbrother, J.M., 1999. Neonatal E. coli diarrhea. In: Straw, B.E., DAllaire, S., Mengeling,W.L., Taylor, D.J.(Eds.), Diseases of Swine. Iowa State University Press, Ames, IA, pp. 433441.

Fekete, P.Z., Gerardin, J., Jacquemin, E., Mainil, J.G., Nagy, B., 2002. Replicon typing of F18 fimbriae encoding

plasmids of enterotoxigenic and verotoxigenic Escherichia coli strains from porcine postweaning diarrhoea

and oedema disease. Vet. Microbiol. 85, 275284.

Firth, N., Ippen-ihler, K., Skurray, R.A., 1996. Structure and function of the F factor and mechanism of conjugation.

In: Neidhardt, F.C., Curtiss III, R., Gross, C., Ingraham, J., Lin, E.C.C., Low, K.B., Magasanik, B., Reznikoff,

W.S., Riley, M., Schaechter, M., Umbarger, H.E. (Eds.), Escherichia coli and Salmonella typhimurium:

Cellular and Molecular Biology, vol. 2. American Society for Microbiology, Washington, DC, pp. 2377

2401.

Fontaine, F., Peres, C., Gyles, C.L., Fairbrother, J.M., 2002. Trends in O149:K91 enterotoxigenic Escherichia coli

from pigs in Quebec. In: Proceedings of the 17th Congress of the International Pig Veterinary Society. Ames,

Iowa, IA, p. 70.Franklin, A., Mollby, R., 1983. Concurrent transfer and recombination between plasmids encoding for heat-stable

enterotoxin and drug resistance in porcine enterotoxigenic Escherichia coli. Med. Microbiol. Immunol. 172,

137147.

Franklin, A., Soderlind, O., Mollby, R., 1981. Plasmids coding for enterotoxins, K88 antigen and colicins in

porcine Escherichia coli strains of O-group 149. Med. Microbiol. Immunol. 170, 6372.

Frydendahl, K., 2002. Prevalence of serogroups and virulence genes in Escherichia coli associated with

postweaning diarrhoea and edema disease in pigs and a comparison of diagnostic approaches. Vet. Microbiol.

85, 169182.

Gaastra, W., de Graaf, F.K., 1982. Host-specific fimbrial adhesins of noninvasive enterotoxigenic Escherichia coli

strains. Microbiol. Rev. 46, 129161.

Garabal, J.I., Gonzalez, E.A., Vazquez, F., Blanco, J., Blanco, M., Blanco, J.E., 1996. Serogroups ofEscherichia

coli isolated from piglets in Spain. Vet. Microbiol. 48, 113123.

Gyles, C., So, M., Falkow, S., 1974. The enterotoxin plasmids of Escherichia coli. J. Infect. Dis. 130, 4049.

Gyles, C.L., Palchaudhuri, S., Maas, W.K., 1977. Naturally occurring plasmid carrying genes for enterotoxin

production and drug resistance. Science 198, 198199.

Harel, J., Lapointe, H., Fallara, A., Lortie, L.A., Bigras-Poulin, M., Lariviere, S., Fairbrother, J.M., 1991. Detection

of genes for fimbrial antigens and enterotoxins associated with Escherichia coli serogroups isolated from pigs

with diarrhea. J. Clin. Microbiol. 29, 745752.

Harnett, N.M., Gyles, C.L., 1985. Linkage of genes for heat-stable enterotoxin, drug resistance, K99 antigen,

and colicin in bovine and porcine strains of enterotoxigenic Escherichia coli. Am. J. Vet. Res. 46, 428

433.

Harris, R.J.C., 1954. Biological Application of Freezing and Drying. Levin and Munksgaard, New York.

Heinrichs, D.E., Yethon, J.A., Amor, P.A., Whitfield, C., 1998. The assembly system for the outer core portionof R1- and R4-type lipopolysaccharides of Escherichia coli. The R1 core-specificbeta-glucosyltransferase

provides a novel attachment site for O-polysaccharides. J. Biol. Chem. 273, 2949729505.

Hunter, J.E., Bennett, M., Hart, C.A., Shelley, J.C., Walton, J.R., 1994. Apramycin-resistant Escherichia coli

isolated from pigs and a stockman. Epidemiol. Infect. 112, 473480.

Janke, B., Dobrindt, U., Hacker, J., Blum-Oehler, G., 2001. A subtractive hybridisation analysis of genomic

differences between the uropathogenicE. coli strain 536 and theE. coli K-12 strain MG1655. FEMS Microbiol.

Lett. 199, 6166.

Josephson, G., Smart, N., 1998. K88 strains of E. coli. AHL Newslett. 2, 45.

Josephson, G., Smart, N., McEwen, B., van Dreumel, T., Gough, J., Hazlett, M., 1999. K88 coliform enteritis in

swine. AHL Newslett. 3, 23.

Josephson, G., Archambeault, M., Gyles, C.L., 2000. Colibacillosis in pigs in 1999. AHL Newslett. 4, 89.Karow, M., Georgopoulos, C., 1993. The essential Escherichia coli msbA gene, a multicopy suppressor of null

mutations in the htrB gene, is related to the universally conserved family of ATP-dependent translocators. Mol.

Microbiol. 7, 6979.


14/15


Li, M., Shimada, T., Morris Jr., J.G., Sulakvelidze, A., Sozhamannan, S., 2002. Evidence for the emergence of

non-O1 and non-O139 Vibrio cholerae strains withpathogenic potential by exchange of O-antigen biosynthesis

regions. Infect. Immun. 70, 24412453.

Luck, S.N., Turner, S.A., Rajakumar, K., Sakellaris, H., Adler, B., 2001. Ferric dicitrate transport system (Fec) ofShigella flexneri 2a YSH6000 is encoded on a novel pathogenicity island carrying multiple antibiotic resistance

genes. Infect. Immun. 69, 60126021.

Mainil, J.G., Daube, G., Jacquemin, E., Pohl, P., Kaeckenbeeck, A., 1998. Virulence plasmids of enterotoxigenic

Escherichia coli isolates from piglets. Vet. Microbiol. 62, 291301.

Menard, L.P., Dubreuil, J.D., 2002. Enteroaggregative Escherichia coli heat-stable enterotoxin 1 (EAST1): a new

toxin with an old twist. Crit. Rev. Microbiol. 28, 4360.

Mezoff, A.G., Jensen, N.J., Cohen, M.B., 1991. Mechanisms of increased susceptibility of immature and weaned

pigs to Escherichia coli heat-stable enterotoxin. Pediatr. Res. 29, 424428.

Moon, H.W., 1990. Colonization factor antigens of enterotoxigenic Escherichia coli in animals. Curr. Top.

Microbiol. Immunol. 151, 147265.

Nagy, B., Fekete, P.Z., 1999. Enterotoxigenic Escherichia coli (ETEC) in farm animals. Vet. Res. 30, 259284.

Nagy, B., Whipp, S.C., Imberechts, H., Bertschinger, H.U., Dean-Nystrom, E.A., Casey, T.A., Salajka, E., 1997.Biological relationship between F18ab and F18ac fimbriae of enterotoxigenic and verotoxigenic Escherichia

coli from weaned pigs with oedema disease or diarrhoea. Microb. Pathog. 22, 111.

Nataro, J.P., Kaper, J.B., 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11, 142201.

Nishimura, A., Morita, M., Nishimura, Y., Sugino, Y., 1990. A rapid and highly efficient method for preparation

of competent Escherichia coli cells. Nucleic Acids Res. 18, 6169.

Ojeniyi, B., Ahrens, P., Meyling, A., 1994. Detection of fimbrial and toxin genes in Escherichia coli and their

prevalence in piglets with diarrhoea. The application of colonyhybridization assay, polymerase chain reaction

and phenotypic assays. Zentralbl. Veterinarmed. 41, 4959.

Orskov, I., Orskov, F., Smith, H.W., Sojka, W.J., 1975. The establishment of K99, a thermo-labile, transmissible

Escherichia coli K antigen, previously called Kco, possessed by calf and lamb enteropathogenic strains.

Acta Pathol. Microbiol. Scand. 83, 3136.Osek, J., 1999. Prevalence of virulence factors of Escherichia coli strains isolated from diarrheic and healthy

piglets after weaning. Vet. Microbiol. 68, 209217.

Osek, J., 2000. Clonal analysis of Escherichia coli strains isolated from pigs with post-weaning diarrhea by

pulsed-field gel electrophoresis. FEMS Microbiol. Lett. 186, 327331.

Osek, J., 2003. Detection of the enteroaggregativeEscherichia coli heat-stable enterotoxin 1 (EAST1) gene and its

relationship with fimbrial and enterotoxin markers in E. coli isolates from pigs with diarrhoea. Vet. Microbiol.

91, 6572.

Parma, A.E., Sanz, M.E., Vinas, M.R., Cicuta, M.E., Blanco, J.E., Boehringer, S.I., Vena, M.M., Roibon, W.R.,

Benitez, M.C., Blanco, J., Blanco, M., 2000. Toxigenic Escherichia coli isolated from pigs in Argentina. Vet.

Microbiol. 72, 269276.

Sarrazin, E., Fritzsche, C., Bertschinger, H.U., 2000. Main virulence factors inEscherichia coli isolates from swine

over two weeks old with edema disease and/or E. coli diarrhea. Schweiz. Arch. Tierheilkd. 142, 625630.Shipley, P.L., Gyles, C.L., Falkow, S., 1978. Characterization of plasmids that encode for the K88 colonization

antigen. Infect. Immun. 20, 559566.

Smajs, D., Weinstock, G.M., 2001. Genetic organization of plasmid ColJs, encoding colicin Js activity, immunity,

and release genes. J. Bacteriol. 183, 39493957.

Smith, H.W., Linggood, M.A., 1971. Observations on the pathogenic properties of the K88, Hly and Ent plasmids

ofEscherichia coli with particular reference to porcine diarrhoea. J. Med. Microbiol. 4, 467485.

So, M., Heffron, F., McCarthy, B.J., 1979. The E. coli gene encoding heat stable toxin is a bacterial transposon

flanked by inverted repeats of IS1. Nature 277, 453456.

Stevens, J.B., Gyles, C.L., Barnum, D.A., 1972. Production of diarrhea in pigs in response to Escherichia coli

enterotoxin. Am. J. Vet. Res. 33, 25112526.

Vazquez, F., Gonzalez, E.A., Garabal, J.I., Blanco, J., 1996. Fimbriae extracts from enterotoxigenic Escherichiacoli strains of bovine and porcine origin with K99 and/or F41 antigens. Vet. Microbiol. 48, 231241.

Wasteson, Y., Olsvik, O., 1991. Specific DNA fragments coding for ST1 and LT1 toxins, and K88 (F4) adhesin in

enterotoxigenic Escherichia coli. Zentralbl. Veterinarmed. 38, 445452.


15/15


Wilson, R.A., Francis, D.H., 1986. Fimbriae and enterotoxins associated withEscherichia coli serogroups isolated

from pigs with colibacillosis. Am. J. Vet. Res. 47, 213217.

Wittig, W., Fabricius, C., 1992. Escherichia coli types isolated from porcine E. coli infections in Saxony from

1963 to 1990. Zentralbl. Bakteriol. 277, 389402.

Yamamoto, T., Nakazawa, M., 1997. Detection and sequences of the enteroaggregativeEscherichia coli heat-stable

enterotoxin 1 gene in enterotoxigenic E. coli strains isolated from piglets and calves with diarrhea. J. Clin.

Microbiol. 35, 223227.

Virulence Genes of O149 Enterotoxigenic E. Coli

Documents

Transcript of Virulence Genes of O149 Enterotoxigenic E. Coli