Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA...
Transcript of Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA...
![Page 1: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/1.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Veterinary and Agrochemical Research Centre
Report
Pathogenic E. coli from pigs: virulence genes and antibiotic
resistance, results from 2011
P. Butaye
Introduction
E. coli is still a major pathogen in several animal species, especially in food producing animals. In swine it
may cause neonatal diarrhoea, post weaning diarrhoea and oedema disease. Virulence genes are encoding
for different virulent characteristics. Many are known, though frequently in supposed pathogenic strains,
no virulence genes are found. This may be due to or unknown virulence genes or simply that the E. coli
strain isolated has nothing to do with the pathology or that E. coli is not involved in the pathology seen, but
for example a virus. It is impossible to differentiate between virulent and non-virulent E. coli when
performing general bacteriology (isolation and identification based on biochemical characteristics). For
isolates from pigs, one may rely only in part on haemolysis which is more often associated with
pathogenicity.
Vaccination is far from efficient against E. coli disease. Therefore antibiotic treatment is frequently
necessary. However, antibiotic resistance is an ever increasing problem. Diseases caused by E. coli are
difficult to treat, and this may be, in part due to the high level of resistance.
Due to the problems and the importance of the problems concerning E. coli in swine we are conducting
surveillance on prevalence of virulence genes and types of E. coli circulating, and their associated antibiotic
resistance genes. In this report we show results obtained on E. coli isolated from pigs showing symptoms
compatible with E. coli caused disease of the year 2011. The report contains also the cumulative data from
2005 on.
Materials and methods.
E. coli were isolated from diseased animals, showing symptoms that may be compatible with E. coli
infection. Strains were isolated and identified to the species level by DGZ (Dierengezondheid Vlaanderen)
and ARSIA (Association Régional de Santé et d’Identification Animale). Afterwards strains were sent to
CODA-CERVA for further investigation.
![Page 2: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/2.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
2/12
At CODA-CERVA, a multiplex PCR was performed for virulence genes. DNA was extracted from an overnight liquid culture. The culture was centrifuged at 14000 rpm for 5 min, the supernatant was removed and one ml of sterile distilled water was added. This suspension was heated at 95°C for 5 min, then centrifuged for 5 min at 14000 rpm and kept at –20°C. Table 1 shows the virulence genes tested for and primer sequences used. Amplification was done in
reaction volumes of 20µl containing 2 µl DNA template, 0.5µM of each primer, 2.5 U of Taq polymerase
(Ampli Taq Gold, Perkin Elmer, Norwalk, CT, US), 5 mM of MgCl2 (Perkin Elmer), 1X AmpliTaq gold buffer
(Perkin Elmer) and 0.2 mM of each dNTP (Pharmacia). Amplification was done in a GeneAmp PCR 9600
(Perkin Elmer) machine. PCR conditions were a first denaturation cycle for 3 minutes at 90°C, followed by
30 cycles of 1 minute 90°C, 1 minute 55°C increasing 3 seconds each cycle, 2 minutes 70°C and a final
extension cycle for 10 minutes at 70°C.
Positive control strains were E. coli B41 (F5, F41, Sta), E. coli 987P (F6, Sta, STb), E. coli E68 (F4, LT, STb) and
E. coli 107/86 (F18, Stx2e). E. coli HB101 was used as negative control. PCR products (20 µl PCR product and
3µl blue juice) were run in a 3% Nusieve 3.1 agarose gel in TBE buffer for 90 minutes at 120 Volt. Marker
VIII (Böhringer Ingelham) was used as size standard.
Antibiotic resistance was determined using Rosco tablets and according to the CLSI methods.
![Page 3: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/3.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
3/12
Table1. Primers used and expected size of PCR product.
Gene target Primer name Nucleotide sequence (3’→5’) Size (bp)
STb STb-1 TGCCTATGCATCTACACAAT 133
STb-2 CTCCAGCAGTACCATCTCTA
STaP StaP-1 CAACTGAATCACTTGACTCTT 158
StaP-2 TTAATAACATCCAGCACAGG
F5 (K99) K99-1 AATACTTGTTCAGGGAGAAA 230
K99-2 AACTTTGTGGTTAACTTCCT
LT LT-1 GGCGTTACTATCCTCTCTAT 272
LT-2 TGGTCTCGGTCAGATATGT
F18 F18-1 TGGTAACGTATCAGCAACTA 313
F18-2 ACTTACAGTGCTATTCGACG
F6 (987P) 987P-1 GTAACTCCACCGTTTGTATC 409
987P-2 AAGTTACTGCCAGTCTATGC
F4 (K88) K88-1 GAATCTGTCCGAGAATATCA 499
K88-2 GTTGGTACAGGTCTTAATGG
F41 F41-1 AGTATCTGGTTCAGTGATGG 612
F41-2 CCACTATAAGAGGTTGAAGC
STx2e STx2e-1 AATAGTATACGGACAGCGAT 733
STx2e-2 TCTGACATTCTGGTTGACTC
![Page 4: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/4.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
4/12
Results and discussion
Results are summarised in Table 2 to 5.
A total of one hundred thirty five pig strains were analysed in 2011, of which 133 were analysed for
virulence characteristics by PCR. In 76 of these (more than half) no virulence genes could be detected. The
most prevalent pathotype was ETEC. Few strains were positive for F41, F5 or F6 fimbrae. F4 was the most
frequently encountered adhesion factor, followed by F18. Of the ETEC associated toxins, STb was the most
prevalent. Haemolysis was seen in a little less than 60% of the strains. In approximately 10% (n=13) of the
haemolytic strains no virulence genes were detected. The other way round, in 7 (approx. 10% also) non
haemolytic strains, virulence genes were detected. There is a disagreement between virulence and
haemolysis, which means that when having a haemolytic strain, this does not necessary corresponds to
pathology, and when finding a non-haemolytic strain, it may be related to the disease anyhow.
The virulence profiles are shown in Table 4.
![Page 5: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/5.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
5/12
Table 2. Pathotypes found in pig E. coli strains in 2011.
Virulence Type N of strains % of strains
Colonising strains 5 3,8
Enterotoxinogene E. coli (ETEC) 35 26,3
Oedema disease (verotoxigenic E. coli, VTEC) 8 6,0
VTEC without attachment factor 0 0,0
No virulence genes detected 76 57,1
ETEC/VTEC 1 0,8
ETEC without attachment factor 8 6,0
Total 133
Table 3. Virulence genes detected in E. coli from diseased pigs in 2011.
Virulence gene Negative Positive % of the strains positive for the
gene
987P FIMBRIAE (F6) 131 2 1,5
F18 FIMBRIAE 106 27 20,3
F41 FIMBRIAE 131 2 1,5
K88 FIMBRIAE (F4) 116 17 12,8
K99 FIMBRIAE (F5) 131 2 1,5
LT TOXIN 112 21 15,8
SLT-IIV TOXIN 124 9 6,8
STb TOXIN 91 42 31,6
STa TOXIN 115 18 13,5
Haemolysis 72 63 46,7
No virulence gene detected 57 76 57,1
![Page 6: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/6.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
6/12
Table 4. Virulence profiles detected amongst the strains analysed in 2011.
Virulence profile Number of strains % of strains
F18 5 3,8
F18 LT STb 1 0,8
F18 STa STb 12 9,0
F18 VT 8 6,0
F18 VT STa STb 1 0,8
F4 LT STa STb 1 0,8
F4 LT STb 16 12,0
F41 LT 1 0,8
F41 LT STa STb 1 0,8
F5 F6 STb 2 1,5
LT STa STb 2 1,5
STa 1 0,8
STb 6 4,5
Negative 76 57,1
Antibiotic resistance in pig strains is shown in Table 5 and multi-resistance is shown in Table 6 and figure1.
Only 10 of the 135 strains tested (7.4%) were completely susceptible to all antibiotics tested (Figure 1,
Table 6). Resistance was lowest to apramycin and florfenicol, followed by the antibiotics gentamicin,
amoxicillin + clavulanic acid, enrofloxacin and neomycin. Ceftiofur resistance reached 17%. Most resistance
was found against ampicillin, tetracycline, and trimethoprim + sulphonamides. Strain resistant to
amoxicillin + clavulanic acid were not always resistant to ceftiofur (data not shown) and ceftiofur resistance
did not always match amoxicillin + clavulanic acid resistance indicating a high diversity and complex
composition of resistance mechanisms.
Most strains are resistant to 5 antibiotics, which represents the mathematical median. Few strains are
resistant to 9 or more antibiotics. One strain, in which no virulence genes were found was resistant to all
antibiotics tested. The most multi-resistant virulent strains were resistant to 9 different antibiotics (all 3
were ETEC).
![Page 7: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/7.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
7/12
Table 5. Antibiotic resistance in E. coli, isolated from pigs in 2011
Antibiotic Susceptible Resistant Total % Resistant
NEOMYCIN 114 20 134 14,9
TRIMETHOPRIM 45 89 134 66,4
GENTAMICIN 124 11 135 8,1
TETRACYCLINE 35 99 134 73,9
SULPHONAMIDE 32 103 135 76,3
STREPTOMYCIN 69 66 135 48,9
AMOXICILLIN + CLAVULANATE 118 16 134 11,9
APRAMYCIN 126 9 135 6,7
ENROFLOXACIN 117 17 134 12,7
CEFTIOFUR 112 23 135 17,0
FLORFENICOL 125 9 134 6,7
CHLORAMPHENICOL 96 39 135 28,9
AMPICILLIN 35 99 134 73,9
NALIDIXIC ACID 98 37 135 27,4
TRIMETHOPRIM SULPHONAMIDE 52 82 134 61,2
Figuur 1. Multi-resistance in E. coli from pigs in 2011.
0
5
10
15
20
25
30
35
0 1 2 3 4 5 6 7 8 9 10 11 12
![Page 8: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/8.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
8/12
Table 6. Multi-resistance in E. coli strains from pigs in 2011.
Number of antibiotics Number of strains % of strains Cumulative % of strains
0 10 7,4 7,4
1 4 3,0 10,4
2 9 6,7 17,0
3 11 8,1 25,2
4 24 17,8 43,0
5 33 24,4 67,4
6 15 11,1 78,5
7 14 10,4 88,9
8 8 5,9 94,8
9 3 2,2 97,0
10 3 2,2 99,3
11 0 0,0 99,3
12 1 0,7 100,0
Conclusions
A little more than 40% of the strains was proven to be pathogenic. Nearly 90% of these strains were
haemolytic, a characteristic associated with virulence characteristics. Compared to other years, this is a
high number, though it still indicates that haemolysis is not enough as a fast characterisation of virulence.
The other way round, the absence of haemolysis has been more associated with the absence of virulence
characteristics.
Resistance against some antibiotics is substantial. There are few antibiotics left against which resistance is
low. Strains are most frequently resistant to 5 antibiotics. They are rarely resistant to 1 or more antibiotics.
One strain was resistant to all antibiotics tested.
![Page 9: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/9.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
9/12
ADDENDUM: comparison of data obtained from 2005 to 2011
Table 1. Pathotypes found in pig E. coli strains in 2005-2011
% strains
Virulence Type 2005 2006 2007 2009 2010 2011
Colonising strains 8,5 22,3 15,8 10,8 1,8 3.8 Enterotoxinogenic E. coli without adhesines 2,7 0 0 14,7 6,5 6
Enterotoxinogene E. coli (ETEC) 33,7 32,4 36,4 43,1 20,6 26.3
Mixed ETEC / VTEC 2,0 0 0,4 2,9 3,5 0.8
Oedema disease (verotoxigenic E. coli, VTEC) 6,8 4,5 11,0 6,9 6,5 6
VTEC without attachment factor 0 3,6 3,5 0 2,4 0
No virulence genes detected 46,3 37,3 33,3 21,6 59,4 57.1
Total number of strains tested 294 247 228 102 170 133
Table 2. Virulence genes detected in E. coli from diseased pigs in 2005-2011
% strains positive for this gene
2005 2006 2007 2009 2010 2011
987P fimbriae (F6) 0,0 0 0 0,0 0,6 1,5
F18 fimbriae 24,5 33,2 33,2 38,2 8,2 20,3
F41 fimbriae 0,0 0,4 0,4 0,0 0 1,5
K88 fimbriae (F4) 26,5 27,9 27,9 25,5 14 12,8
K99 fimbriae (F5) 0,0 0 0 2,9 0 1,5
LT toxin 26,2 25,9 25,9 34,3 18,1 15,8
SLT-IIV toxin (vt2e) 10,2 8,1 8,1 13,7 6,4 6,8
STa toxin 16,0 10,1 10,1 27,5 28,7 31,6
STb toxin 32,0 29,6 29,6 53,9 11,1 13,5
Haemolysis 85,7 87,9 87,9 81,4 59,1 46,7
No virulence genes detected 46,3 37,3 37,3 21,6 59,4 57,1
There is no real evolution found in the different pathotypes encountered. Neither is there a long term
evolution in the distribution of virulence genes.
![Page 10: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/10.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
10/12
Table 3. Antibiotic resistance in E. coli, isolated from pigs in 2005-2011
% Resistance Antimicrobial 2005 2006 2007 2009 2010 2011 Amoxicillin + clavulanic acid 1,4 0,4 1,3 2,0 7,6 11.9
Ampicillin 63,1 68,4 75,4 82,4 80,7 73.9
Apramycin 7,8 2,4 7,5 7,8 5,3 6.7
Ceftiofur 0,7 2,0 2,6 9,8 19,3 17
Chloramphenicol 28,7 30,8 27,6 30,4 26,9 28.9
Enrofloxacin 4,1 2,8 6,1 7,8 12,9 12.7
Florfenicol 2,0 1,6 3,8 2,9 4,1 6.7
Gentamicin 2,7 1,6 2,6 10,8 8,8 8.1
Nalidixic acid 22,5 18,2 24,6 32,4 28,1 27.4
Neomycin 6,1 4,5 4,8 19,6 19,3 14.9
Tetracycline 75,4 85,8 79,4 80,4 71,3 73.9
Trimethoprim + Sulphonamide 68,9 62,8 75,9 73,8 75,4 61.2
Streptomycin NT NT NT 65,8 60,8 48.9
Sulphonamide NT NT NT 81,6 83,0 73.6
Trimethoprim NT NT NT 81,6 76,6 66.4
![Page 11: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/11.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
11/12
Figure 1. Evolution of resistance for the different antibiotics (2005-2011).
Figuur 2. Multi-resistance in E. coli from pigs in 2005-2011.
0
10
20
30
40
50
60
70
80
90
100
2005
2006
2007
2009
2010
2011
0
5
10
15
20
25
30
35
40
0 1 2 3 4 5 6 7 8 9 10 11 12
2005% (N=293)
2006% (N=247)
2007% (N=228)
2009% (N=102)
2010% (N=171)
2011 (n=135)
![Page 12: Report Pathogenic E. coli from pigs: virulence genes and ...€¦ · CODA-CODA ---CERVACERVA Veterinary and Agrochemical Research Centre Report Pathogenic E. coli from pigs: virulence](https://reader034.fdocuments.in/reader034/viewer/2022043006/5f8ea3a6054d693899238023/html5/thumbnails/12.jpg)
CODACODACODACODA----CERVACERVACERVACERVA
Scientific research at the service of safe food production and animal health
12/12
Table 5. Multi-resistance in E. coli strains from pigs in 2005-2011
% resistance
N antibiotics 2005 2006 2007 2009 2010 2011
0 8,5 9,7 7,5 5,9 7,6 7,4 1 13,3 10,5 8,8 2,9 2,9 3,0 2 18,4 17 13,6 10,8 2,9 6,7 3 29,4 30,8 35,1 19,6 6,4 8,1 4 16,4 20,6 14,9 16,7 12,9 17,8 5 7,2 7,7 14,0 16,7 25,1 24,4 6 4,8 3,2 3,5 15,7 18,1 11,1 7 1 0 2,2 6,9 10,5 10,4 8 1 0 0,4 2,0 6,4 5,9 9 0 0 0,0 2,0 4,7 2,2 10 0 0,4 0,0 1,0 2,3 2,2 11 0 0 0,0 0,0 0,0 0,0 12 0 0 0,0 0,0 0,0 0,7
After 7 years of surveillance, there is a clear and significant increase in resistance against ceftiofur and
amoxicillin + clavulanic acid (AMC). Because there is only in few cases cross resistance of the ceftiofur
resistant strains with AMC, most of the cephalosporin resistant strains seem to carry ESBLs. Confirmatory
tests are necessary to confirm this. The AMC resistant strains may be strains over-expressing the
chromosomal ampC ß-lactamase or may carry IRTs. A study on the genetic background of this resistance is
warranted.
For the fluoroquinolones, the aminoglycosides gentamicin and neomycin, and florfenicol a trend towards
higher resistance is obvious, although the resistance remains low. Statistical analysis of the data is
necessary. Against three, for pig industry therapeutically important antibiotics (ampicillin, tetracyclines and
sulfa-trimethoprim), resistance remains high with more than three quarter of the strains resistant. The
number of strains completely susceptible stays low and multi-resistance is at raise. Over a nearly 7 year
period, tendencies in resistance become clearer. Some antibiotics became more resistant, and the multi-
resistance has clearly increased from a median of 3 to 5 antibiotics. This urges for appropriate use of
antibiotics, in order to prevent an increase in resistance.