VILNIUS UNIVERSITY

INSTITUTE OF BIOTECHNOLOGY

Edita Kriukienė

RESTRICTION ENDONUCLEASE MnlI – A MEMBER OF THE HNH

FAMILY OF NUCLEASES

Summary of doctoral dissertation

Physical sciences, biochemistry (04 P), proteins, enzymology (P 310)

Vilnius, 2007

The work presented in this doctoral dissertation has been carried out at the Institute of Biotechnology from 2002 to 2006. Dissertation is maintained by extern. Scientific consultant:

Dr. Arvydas Lubys (Fermentas UAB, physical sciences, biochemistry 04 P, proteins, enzymology P310).

Evaluation board of dissertation of Biochemistry trend: Chairman:

Prof. Dr. habil. Kęstutis Sasnauskas (Institute of Biotechnology, physical sciences, biochemistry 04 P, proteins, enzymology P310).

Members:

Prof. Dr. habil. Arvydas Janulaitis (Fermentas UAB, physical sciences, biochemistry 04 P, nucleic acids, protein synthesis P320); Prof. Dr. habil. Saulius Klimašauskas (Institute of Biotechnology, physical sciences, biochemistry 04 P, proteins, enzymology P310); Prof. Dr. Vida Kirvelienė (Vilnius University, physical sciences, biochemistry 04 P, nucleic acids, protein synthesis P320); Dr. R. Meškys (Institute of Biochemistry, physical sciences, biochemistry 04 P, proteins, enzymology P310).

Official opponents: Prof. Dr. habil. Virginijus Šikšnys (Institute of Biotechnology, physical sciences, biochemistry 04 P, proteins, enzymology P310); Dr. habil. Rimantas Nivinskas (Institute of Biochemistry, physical sciences, biochemistry 04 P, nucleic acids, protein synthesis P320).

The thesis defence will take place on 30th of October, 2007, 11 A.M. at the Institute of Biotechnology.

Address: Graičiūno 8, LT-02241, Vilnius, Lithuania. The summary of the thesis was distributed on 28th of September, 2007. The thesis is available at the Library of Institute of Biotechnology and at the Library of Vilnius University.

2

VILNIAUS UNIVERSITETAS

BIOTECHNOLOGIJOS INSTITUTAS

Edita Kriukienė

RESTRIKCIJOS ENDONUKLEAZĖ MnlI – HNH NUKLEAZIŲ ŠEIMOS

ATSTOVĖ

Daktaro disertacijos santrauka

Fiziniai mokslai, biochemija (04 P), baltymai, enzimologija (P 310)

Vilnius, 2007

3

Disertacija rengta 2002 – 2006 metais Biotechnologijos Institute. Disertacija ginama eksternu. Mokslinis konsultantas:

Dr. Arvydas Lubys (Fermentas UAB, fiziniai mokslai, biochemija – 04 P, baltymai, enzimologija – P 310).

Disertacija ginama Vilniaus universiteto Biochemijos mokslo krypties taryboje: Pirmininkas:

Prof. habil. dr. Kęstutis Sasnauskas (Biotechnologijos institutas, fiziniai mokslai, biochemija 04 P, baltymai, enzimologija P310).

Nariai:

Prof. habil. dr. Arvydas Janulaitis (Fermentas UAB, fiziniai mokslai, biochemija 04 P, nukleorūgštys, baltymų sintezė P320); Prof. habil. dr. Saulius Klimašauskas (Biotechnologijos institutas, fiziniai mokslai, biochemija 04 P, baltymai, enzimologija P310); Prof. dr. Vida Kirvelienė (Vilniaus Universitetas, fiziniai mokslai, biochemija 04 P, nukleorūgštys, baltymų sintezė P320); Dr. R. Meškys (Biochemijos institutas, fiziniai mokslai, biochemija 04 P, baltymai, enzimologija P310).

Oponentai:

Prof. habil. dr. Virginijus Šikšnys (Biotechnologijos institutas, fiziniai mokslai, biochemija 04 P, baltymai, enzimologija P310); Habil. dr. Rimantas Nivinskas (Biochemijos institutas, fiziniai mokslai, biochemija 04 P, nukleorūgštys, baltymų sintezė P320).

Disertacija bus ginama viešame Biochemijos mokslo krypties tarybos posėdyje 2007 m. spalio mėn. 30 d. 11 val. Biotechnologijos Instituto aktų salėje.

Adresas: Graičiūno 8, LT – 02241, Vilnius, Lietuva. Disertacijos santrauka išsiuntinėta 2007 m. rugsėjo mėn. 28 d. Disertaciją galima peržiūrėti Biotechnologijos instituto ir Vilniaus Universiteto bibliotekose.

4

CONTENTS

INTRODUCTION..............................................................................................................................6 MATERIALS AND METHODS ......................................................................................................8 RESULTS AND DISCUSSION ......................................................................................................15 1. MnlI R-M system and functional analysis of its components ..................................................15

1.1. Gene structure of the MnlI restriction-modification system...................................................15 1.2. Protein sequence analysis and specificity of MnlI methyltransferases...................................16 1.3. A novel subclass of Type IIS restriction endonucleases.........................................................17

1.3.1. Protein sequence analysis of the MnlI REase ..................................................................17 1.3.2. Mutational analysis of MnlI restriction endonuclease .....................................................18 1.3.3. Single-stranded DNA cleavage by MnlI..........................................................................22

2. DNA binding stoichiometry of MnlI restriction endonuclease ................................................24 2.1. Analysis of the MnlI – DNA complex ....................................................................................25 2.2. Trans - stimulation of MnlI cleavage......................................................................................27

3. Domain organization of the MnlI restriction endonuclease.....................................................29 3.1. Proteolysis of MnlI .................................................................................................................30 3.2. Functional domains in MnlI restriction endonuclease ............................................................31 3.3. Analysis of the N-II – DNA complexes..................................................................................33 3.4. Colicin-like nuclease domain of MnlI triggers metal-dependence and substrate specificity of the MnlI restriction endonuclease ............................................................................36

CONCLUSIONS ..............................................................................................................................41 LIST OF PUBLICATIONS ............................................................................................................42 ACKNOWLEDGEMENTS.............................................................................................................43 CURRICULUM VITAE..................................................................................................................43 REZIUMĖ ........................................................................................................................................44

5

INTRODUCTION

Type II restriction endonucleases (REases) cleave palindromic or non-palindromic short sequences of double-stranded DNA (dsDNA), and generally require Mg2+ ions for catalysis. Due to high sequence specificity and relatively simple structure Type II restriction endonucleases provide excellent model systems for studying protein-DNA interactions and evolutionary relationship among different protein groups. Over 3700 REases specific for more than 260 sequences have been assigned into this most numerous group of REases (http://rebase.neb.com, 19.06.2007). A great deal of biochemical and structural data has been obtained during the investigation of DNA recognition and the mode of cleavage that indicate a high diversity among these enzymes (Pingoud et al., 2005). However, comparison of available crystal structures and computational fold-recognition analysis suggests the presence of similar three-dimensional folds among the respective parts of Type II restriction endonucleases (Bujnicki et al., 2001). Most of the Type II REases structurally characterized to date exhibit similar structural core harboring catalytic amino acid residues, which form a weakly conserved sequence pattern, termed the PD-D/ExK motif (Venclovas et al., 1994; Aggarwal, 1995). This catalytic motif is characteristic not only for restriction endonucleases, but also resides in many DNA repair and recombination enzymes, pointing to a presumable evolution of these enzymes from a common ancestor (Pingoud et al., 2005). However, soon after the compelling hypothesis of relationship between all Type II enzymes (Kovall and Matthews, 1999), new studies have emerged that demonstrate convincingly that some Type II REases are evolutionary unrelated and structurally dissimilar to the PD-D/ExK superfamily. The first enzyme that turned out not to be a member of this group was a Type IIS REase BfiI (Sapranauskas et al., 2000). The detailed analysis of the catalytic and structural properties of BfiI has related it to an EDTA-resistant non-specific nuclease Nuc from Salmonella typhimurium, a member of the phospholipase D superfamily (Lagunavicius et al., 2003; Zaremba et al., 2004; Grazulis et al., 2005). The recruitment of the phospholipase-like nucleolytic core by BfiI predicts that catalytic domains from other nuclease families can be used just as well to fulfill the catalytic function of REases. Indeed, bioinformatic analyses and mutagenesis studies suggested that the nuclease folds, designated as the ‘ββα-metal’ (or the HNH) and GIY-YIG folds, may be involved in the catalytic action of restriction endonucleases. The Type IIP REase KpnI (Saravanan et al., 2004) exhibits the catalytic core similar to phage T4 Endo VII, the structure-specific ‘ββα-metal’ nuclease (Raaijmakers et al., 2001). KpnI also shares the peculiar feature of T4 Endo VII, namely the catalytic activity in the presence of Ca2+ (Chandrashekaran et al., 2004). More recently, modeling combined with mutagenesis first confirmed that the Type IIP REase Eco29kI, unlike all other REases studied to date, belongs to the GIY-YIG superfamily of nucleases (Ibryashkina et al., 2007).

A two-domain organization is characteristic of the Type IIS group of REases. This feature makes them excellent targets for the study of a presumable evolutionary

6

route of these enzymes through the exchange of structural and functional modules. Despite the existence of more than 380 Type IIS REases, only a few of them are well characterized. According to an asymmetric recognition sequence 5’-CCTC-3’/5’-GAGG-3’ and the cleavage positions downstream of the target site ((N)7/6), the MnlI endonuclease belongs to the Type IIS REase group. Therefore, in order to broaden out our knowledge of the structure and mechanisms of catalysis used by Type IIS enzymes and to better understand their evolutionary implications, we have focused on biochemical characterization of MnlI.

The aims of this study were: 1. Characterize the restriction-modification system MnlI. 2. Identify the active site of MnlI REase. 3. Perform biochemical studies of MnlI in order to correlate structure and function.

Scientific novelty: The MnlI restriction endonuclease is the first enzyme that employs the colicin-

like HNH motif, 306Rx3ExHHx14Nx8H, for cleavage of DNA substrates. The HNH active site identified in the C-terminal part of MnlI assigns the protein into the ‘ββα-metal’ superfamily of nucleases. A two-domain structure of Type IIS REase MnlI has been identified by limited proteolysis. An N-terminal domain of the enzyme mediates the sequence-specific interaction with DNA, whereas a C-terminal domain resembles bacterial colicin nucleases in its requirement for alkaline earth as well as transition metal ions for double- and single-stranded (ss) DNA cleavage activities. Contrary to all characterized Type IIS REases, which dimerise through their catalytic domains, the C-terminal domain of MnlI was determined to be monomeric in solution. The results indicated that the presumable fusion of the non-specific HNH-type nuclease to the DNA binding domain had transformed MnlI into a Mg2+-, Ni2+-, Co2+-, Mn2+-, Zn2+-, Ca2+-dependent sequence-specific enzyme. Nevertheless, MnlI retains a residual non-specific ssDNA cleavage activity controlled by its C-terminal colicin-like nuclease domain. Cleavage of ds- and ssDNA in the presence of different metal ions is unparalleled among restriction endonucleases characterized to date.

Practical value: The non-specific catalytic domain of MnlI could be fused to different DNA-

binding proteins to generate chimeric restriction endonucleases with novel specificities. Such enzymes may be useful in performing targeted genetic manipulations in a variety of organisms or as molecular tools in biotechnology.

The novel findings presented for defense: 1. The MnlI REase possesses a HNH-type active site. 2. MnlI interacts simultaneously with two recognition sequences. 3. MnlI consists of two functional domains. 4. The C-terminal catalytic domain of MnlI resembles bacterial colicin nucleases in

its requirement for alkaline earth as well as transition metal ions for double- and single-stranded DNA cleavage activities.

5. The colicin-like catalytic domain modulates metal-dependence and substrate requirement of the MnlI restriction endonuclease.

7

MATERIALS AND METHODS Chemicals, enzymes and kits. All chemicals used in this study were ASC-grade commercial products. The nucleotide sequence determination kit „BigDyeTM Terminator v.3.1 Cycle Sequencing Kit“ was obtained from Applied Biosystems, the DNA purification kit „QIAquick®Gel Extraction Kit“ from Qiagen, protease Glu-C from Roche, PVDF membrane from Macherey-Nagel, Superdex 200 HR gel-filtration column was obtained from Amersham-Pharmacia-Biotech, marker proteins „Gel Filtration Standards“ (ferritin (Mr 416,000), aldolase (Mr 176,000), albumin (Mr 64,700), ovalbumin (Mr 45,800), chymotripsinogen A (Mr 19,900), and ribonuclease A (Mr 15,400)) were from Bio-Rad. All other enzymes, kits, DNA substrates, standard sequencing primers and molecular mass standards were obtained from Fermentas UAB. All these products were used according to the vendor’s instructions. Plasmids, bacterial strains and DNA manipulation. pBR-R - ApR; CmR; positive selection cloning vector (Lubys et al., 1996). pACYC184 - TcR; CmR; cloning vector (Chang and Cohen, 1978). pUC19 - ApR; cloning vector (Yanisch-Perron et al., 1985). pET21b - ApR; T7 expression vector (Novagen). pIC19H - ApR; cloning vector (Marsh et al., 1984). pACMnlMM2.65 – the recombinant plasmid (Fig.1) contains the genes for both MnlI methyltransferases (MTases) mnlIM1 and mnlIM2 under the control of the promoter Ptet. This plasmid rendered genomic and plasmid DNA resistant to MnlI cleavage. A wild-type strain Moraxella nonliquefaciens (ATCC 17953) was a source of DNA for cloning of the MnlI restriction-modification (R-M) genes. Escherichia coli K-12 strains RR1 (Bolivar et al., 1977) and ER2267 (New England Biolabs) were used as hosts for cloning and subcloning experiments. A spontaneous mcrBC- mutant HMS174mcrBC (Kriukiene, unpublished) of the E. coli strain HMS174 (Novagen) was isolated for the expression of MnlI mutants. This mutation made the strain tolerant to the presence of plasmids coding for certain 5-methylcytosine MTases, including that from the MnlI R-M system. All strains were grown and E. coli transformations were carried out according to standard protocols (Sambrook and Russell, 2001). All DNA manipulations were carried out using standard techniques (Sambrook and Russell, 2001). Plasmids were purified by the alkaline lysis procedure (Birnboim and Dolly, 1979) which was modified as described (Marko et al., 1982). The nucleotide sequence was determined using “Big-Dye” terminator chemistry (Applied Biosystems, Foster City CA.) driven by standard T7 promoter and terminator primers on an ABI PRISM 377 DNA Sequencer (Applied Biosystems). Oligonucleotides.

Oligonucleotides used in the construction of MnlI mutants*: #R306A 5‘- GATGAACTTCTAAATAATAAGCGTCGC #E310A 5‘- GATGACATGATGAACTGCTAAATAATAAC #H312A 5‘- GATGACATGAGCAACTTCTAAATAATAAC

8

#H313A 5‘- GATGACAGCATGAACTTCTAAATAATAAC #N328A 5‘- GCAAACTTTGACTAAGGCATCAATTTG #H337A 5‘- GCTCAATGCACGAGCACATGTTGG #NII 5’- GAACTCGAGTTATTCATCAATCGTATCATC** Stop

* mutations introduced in the triplet (underlined) coding for the appropriate amino acid are given in italic. ** Translation termination codon (Stop) that was introduced in the oligonucleotide to construct the fragment of mnlIR gene coding for the N-II domain of MnlI is shown in bold.

mnlIR sequencing primers: #1 5’- TTGCCAATGCCAAACCAATC #2 5’- ATCCTCATTAAAGGCTCCACCATTG #3 5’- GCAAGAACAATTTATCACAGGCGAG #4 5’- ATTGCCCAAGAAAGCCGAAC

Oligonucleotides used in the sodium bisulfite treatment experiments: #NG-VP1 5’- GTTGTGTAGATAATTATGATATGGGAGGG (1702-1730 bp*) #NG-VA7 5’- AAACCAAAACTAAATAAAACCATACCAAAC (1968-1997 bp*)

*The annealing positions of the oligonucleotides in pUC19 are given in parentheses. Oligonucleotides used to evaluate the cleavage of ssDNA by MnlI and its N-II

domain: #S-19 5’-CTCATAGCTCACGCTGTAG #S-20 5’-AGTTTTCGCCCCGAAGAACG #S-27 5’-TTTGGTGGTATCCTCTGTAAGCGGCTA #S-35 5’-TGCGGCCCTCGGTCCATTCCGACAGCATCGCCAGT

DNA duplexes (intact or mutated MnlI recognition sequences are underlined)*: sd-31 #S-1: 5’- GATCATTGCCCCCTCGTTCATGATACTCTAC-3‘ #S-2: 3‘- CTAGTAACGGGGGAGCAAGTACTATGAGATG-5‘

sd-31-PTO #Ss-1: 5’- GATCATTGCCCCCTCGTTCATGsATACTCTAC-3‘ #Ss-2: 3‘- CTAGTAACGGGGGAGCAAGTACpTATGAGATG-5‘

nd-31 #N-1: 5‘- GATCATTGCCCACTCGTTCATGATACTCTAC-3‘ #N-2: 3‘- CTAGTAACGGGTGAGCAAGTACTATGAGATG-5‘

*Duplexes were made by annealing the self-complementary oligonucleotides. Annealing was achieved by placing the tubes with the DNA solution into a bath with 95°C water and then allowing them to cool slowly. (s) denotes the position of phosphorothioate substitution in sd-31-PTO duplex. This was necessary in order to protect the duplex from MnlI cleavage.

For DNA-binding experiments and sucrose gradient velocity centrifugation oligonucleotides S-1, Ss-1 and N-1 were 5’-labeled with [γ-33P]ATP (Hartmann Analytic) using T4 polynucleotide kinase, and then annealed with the complementary conterparts. The molar ratio of the components for different DNA strands (only for labeled duplexes) was kept 1:1.2 (the unlabeled strand was always used in excess

9

over the radiolabeled one). All high purity oligodeoxynucleotides were purchased from Metabion or MWG Biotech (Germany). Buffers. MnlI reaction buffer (Buffer G): 10 mM Tris-HCl (pH 7.5), 50 mM NaCl. Storage buffer of wt MnlI, its mutants and the N-II domain: 10 mM Tris-HCl (pH 7.5), 100 mM KCl, 1 mM EDTA, 1 mM DTT, 50% glycerol. Storage buffer of the C-II domain: 10 mM Tris-HCl (pH 7.5), 200 mM NaCl, 1 mM EDTA, 1 mM DTT, 50 % glycerol. Sonication buffer: 10 mM K3PO4 (pH 7.4), 100 mM NaCl, 1 mM EDTA, 7 mM 2-mercaptoethanol. Cloning of the MnlI restriction-modification genes and analysis of the MnlI REase and MTase activities. Genomic DNA was isolated from Moraxella nonliquefaciens essentially as described (Marmur, 1961). It was fragmented by sonication and the blunted sonication products were size-fractionated on the agarose gel. The DNA fragments of 1-4 kb in length were recovered and ligated into the pBR-R, which was cleaved with Eco47III and dephosphorylated. The ligation mixture was used to transform competent E. coli RR1 cells. Two rounds of biochemical selection were carried out in order to enrich the library for the plasmids that were resistant to MnlI cleavage due to the cloned MnlI methyltransferase gene. Screening for restriction-proficient cells was carried out by replicating the transformants onto top-layer agar containing 106 phage λvir particles per plate. Five clones resistant to the phage infection were tested for the MnlI REase and MTase activities. MTase activity was assayed in vitro by incubating isolated plasmid DNA with the MnlI restriction enzyme. Cell-free extracts from individual clones, prepared as described (Whitehead and Brown, 1985), were assayed for the MnlI REase activity. Determination of DNA sequence and comparison of deduced amino acid sequences. The MnlI R-M genes (MluI-Eco32I fragment from pMnlRM5; see Fig.1) were sequenced from a series of deletion plasmids generated with BAL31 nuclease or “ExoIII/S1 Deletion Kit”. Sequencing was performed with “Cycle ReaderTM DNA Sequencing Kit”. Sequence data were compiled and analyzed with the MicroGenie sequence analysis software (Beckman Instruments). Comparison of nucleotide sequences as well as deduced amino acid sequences with entries of the current DNA and protein databases were performed using the FASTA3 program available at the EBI, European Bioinformatics Institute (http://www.ebi.ac.uk). The deduced amino acid sequence of MnlI REase was analyzed using the conserved domain search program PSI-BLAST (National Centre for Biotechnology Information, http://www.ncbi.nlm.nih.gov). Multiple sequence alignments were performed by CLUSTALW program available at the Pôle Bio-Informatique Lyonnais (http://pbil.univ-lyon1.fr). The amino acid sequences of colicins ColE7 and ColE9 were obtained from the Protein Data Bank of three-dimensional structures (Research Collaboratory for Structural Bioinformatics, http://www.rcsb.org/pdb/). The sequences of MnlI R-M genes were deposited in the GenBank under the Accession No. AY615524.

10

Identification of methylated cytosine by sodium bisulfite treatment. Identification of methylated cytosine was performed by sodium bisulfite treatment as described previously (Vilkaitis and Klimasauskas, 1999). pUC19 was in vivo methylated by introducing the plasmid into the strain ER2267[pACMnlMM2.65]. Both the methylated and unmodified pUC19 DNAs were linearized, treated with sodium bisulfite and then used separately as templates for PCR with strand-specific primers NG-VP1 and NG-VA7 to generate the 295 bp DNA fragment with a unique MnlI target. Both PCR products were cloned into SmaI-digested pUC19, and the recombinant plasmids were isolated and sequenced. Mutagenesis. Site-directed mutagenesis of MnlI REase was performed by the “megaprimer” method (Barik, 1995) using one of the six oligonucleotides that contained an appropriate mispair and two primers flanking the mnlIR gene in pZAMnlIRlacZ plasmid (Kriukiene, unpublished). The PCR products coding for the full-length MnlI enzyme were digested with XbaI-SmaI and ligated into pET-21b vector prepared with HindIII/T4 DNA polymerase - XbaI. The 5’-terminal part of the mnlIR gene coding for the N-terminal domain N-II was generated by PCR techniques. The resultant product was cleaved by XbaI and XhoI REases and inserted into pET-21b vector that had been cleaved with the same enzymes. The ligation mixtures were used to transform HMS174mcrBC[pACMnlMM2.65] strain. The presence of the required mutations as well as the absence of additional mutations was confirmed by DNA sequencing. Protein expression and purification. The homogeneous preparation of the wt MnlI was a gift of Fermentas UAB. All MnlI mutant proteins and the constructed domain N-II were purified from cultures of HMS174mcrBC[pACMnlMM2.65] cells that harbored the pET-21b derivative with the inserted mnlIR mutant gene. The cell cultures were grown at 37ºC overnight in LB medium. Then, they were diluted 1:50 with the same medium and grown to OD600=0.5 at 37ºC. Induction of protein expression was performed by the addition of 1 mM IPTG and then the cultures were further cultivated at 30ºC (MnlI active site mutants) or 37ºC (N-II) for another 3 h. The cells were harvested, suspended in the sonication buffer, disrupted by sonication and cell debris removed by centrifugation. The extract was subjected to column chromatography using heparinsepharose, AH-Sepharose, Blue-sepharose (Amersham-Pharmacia-Biotech) and phosphocellulose P11 (Whatman). The chromatographic fractions containing the mutant proteins were identified either by the restriction activity assay or by Western blotting with antibodies raised against the MnlI REase (M. Leckiene, unpublished data). Protein-containing fractions were pooled and then dialyzed against storage buffer. Dialyzed fractions were stored at -20°C. Homogeneity of the mutant proteins was >95% as determined by protein SDS-electrophoresis (SDS-PAGE), which was performed according to Laemmli (Ausubel et al., 1992). Isolation of the N-II domain for MALDI-MS experiments upon a 2-hour proteolysis of MnlI (0.14 mg) by Glu-C in the presence of DNA was carried out by gel-filtration. MALDI-MS experiments of N-II were performed in the Institute of Organic

11

Chemistry (University of Johann W. Goethe, Germany). To isolate the C-terminal domain C-II, 0.14 mg of MnlI was digested with Glu-C for 90 min in the absence of specific DNA. The resultant mixture was loaded onto a Superdex 200 HR column that was pre-equilibrated with 10 mM Tris–HCl (pH 7.5), 300 mM KCl. The fractions that, according to the marker proteins, should represent proteins with apparent molecular masses of 30–10 kDa were tested for the presence of C-II in SDS–PAGE. Fractions containing C-II were pooled and loaded onto the same column. After identification of C-II, homogeneous fractions were pooled, concentrated with Centricon tubes (Millipore), dialyzed against C-II storage buffer and stored at -20oC. The homogeneity of the protein was tested by SDS–PAGE: it was detected to be >95%. Preparation of the divalent metal-free apoenzymes of MnlI and C-II (apo-MnlI and apo-C-II) was assessed by incubation of the proteins with 1 M EDTA at room temperature for 4 hours. Then, EDTA-treated proteins were dialyzed against Buffer G and stored at 4oC. Protein concentrations were determined by measuring light absorbance at 280 nm and using an extinction coefficient of 24,000 M-1cm-1 for the monomer of MnlI, 12,920 M-1cm-1 for the N-II protein, and 11,080 M-1cm-1 for C-II. Extinction coefficients were calculated using the Vector NTI 5.2.1.3 software (Invitrogen). Proteolysis of MnlI by Glu-C. All experimental digestions were performed with endoproteinase Glu-C in Buffer G at 25oC. MnlI–DNA complex cleavage was carried out at a twofold molar excess of specific oligonucleotide sd-31 over the MnlI protein. The ratio of Glu-C to MnlI was 1:20 (w/w). The proteolytic fragments of MnlI were separated by SDS–PAGE and transferred onto a PVDF membrane according to standard protocols (Sambrook and Russell, 2001). The sequences of the first five amino acid residues of the N-termini of particular fragments were determined by Edman sequencing chemistry in WITA GmbH (Germany). Gel-filtration. Gel-filtration of wt MnlI, MnlI mutant proteins, the N-II domain and its complexes with the specific duplex sd-31 was performed at room temperature on an AKTA FPLC system using a Superdex 200 HR column pre-equilibrated with 10 mM Tris–HCl (pH 7.5), 200 mM KCl. The protein or protein-DNA samples were prepared in the same buffer. Protein elution was followed spectrophotometrically by monitoring the absorbance at 280 nm. Apparent molecular masses were calculated from the elution volumes by reference to marker proteins “Gel Filtration Standards”. DNA binding assays. DNA binding by all MnlI forms and the N-terminal domain was analyzed by the gel mobility-shift assay, using the cognate (sd-31 and sd-31-PTO) or non-cognate (nd-31) duplexes. The 33P-labeled duplexes (1 nM) were incubated for 20 min at 25oC with different amounts of proteins in 20 μl of binding buffer (40 mM Tris–acetate (pH 7.0), 0.1 mM EDTA (or 2 mM Ca-acetate), 0.1 mg/ml BSA, 10% glycerol). Samples were loaded onto 8% polyacrylamide gels (29:1 arcylamide/bisacrylamide) in 40 mM Tris–acetate (pH 7.0), 0.1 mM EDTA (or 2 mM Ca-acetate) and electrophoresed at room temperature for 2 hours at 8.5 V/cm. After electrophoresis, gels were dried and analyzed using Cyclone Storage Phosphor

12

System and OptiQuantTM Image Analysis Software (version 3.0 from Packard Instruments). In DNA displacement experiments, [33P]sd-31-PTO duplex (1 nM) was mixed with wt MnlI (25 nM) in binding buffer (40 mM Tris-acetate, (pH 7.0), 2 mM Ca-acetate, 0.1 mg/ml BSA, 10% glycerol) and incubated for 20 min at 25oC. Then, varying amounts of the unlabeled 418 bp DNA fragment, containing a single site for MnlI, were added. The mixtures were analyzed by electrophoresis in buffer (40 mM Tris-acetate (pH 7.0), 2 mM Ca-acetate) as described above, except the electrophoresis was run for 3 hours to ensure better separation of the MnlI-DNA complexes. Sucrose gradient velocity centrifugation. wt MnlI (500 nM of monomer), or the N-II domain (40 μM) in a total volume of 100 μl was layered on a 12-ml of 5-20% (w/w) linear sucrose concentration gradient in 40 mM Tris-acetate (pH 7.0), 2 mM Ca-acetate. The tubes were then centrifuged at 20oC in a SW-41-Ti rotor using a Beckman L8-70 ultracentrifuge at 40,000 rpm for either 18.5 hours (wt MnlI) or 20 hours (N-II). After centrifugation, 500 μl fractions were taken starting from the top and analyzed by SDS-PAGE. Centrifugation experiments of the MnlI – DNA and N-II – DNA complexes were performed essentially as described above. In these experiments, either 400 nM of wt MnlI (in terms of monomer) was combined with 400 nM of [33P]sd-31-PTO duplex, or 40 μM of N-II was mixed with 1 μM of [33P]sd-31. To investigate the sedimentation of free DNA, the same amount of labeled duplexes was centrifuged separately. Protein – DNA complexes were detected by applying different detection methods: SDS-PAGE (for detection of proteins) and spotting onto a Hybond N+ (Amersham Biosciences) membrane (detection of free DNA and DNA bound in complexes). Additionally, the fractions containing protein - DNA complexes were analyzed by the identification of DNA bound in complexes after loading the samples of fractions onto 8% non-denaturing polyacrylamide gels in the same buffer as that used in centrifugation experiments. Gels were analyzed using Cyclone Storage Phosphor System. The standard protein curve was derived from the peak positions of the marker proteins that were achieved from analysis of fractions by SDS–PAGE. The following marker proteins were used: aldolase (Mr 176,000), albumin (Mr 64,700), ovalbumin (Mr 45,800), chymotripsinogen A (Mr 19,900), and ribonuclease A (Mr 15,400). dsDNA cleavage assay. All DNA cleavage reactions were performed in Buffer G supplemented with different divalent metal ions, or without any metal ions as described below. Specific activities of the wt MnlI and its mutants were determined by incubating different amounts of the proteins with 1 μg λ DNA at 37°C for 1 hour in 50 μl of Buffer G supplemented with 10 mM MgCl2 and 0.1 mg/ml BSA. The incubation was followed by electrophoresis in 1.4% agarose gels. Before electrophoresis, the reactions were stopped by adding 0.2 volumes of gel loading buffer (10 mM Tris-HCl (pH 7.6), 60 mM EDTA, 0.1% SDS, 60% glycerol, 0.03% bromophenol blue, 0.03% xylene cyanol FF) and heated at 70oC for 10 min. One unit of the endonuclease was defined as the protein amount required to hydrolyze 1 μg of λ DNA in 1 h at 37°C.

13

Cleavage of plasmid DNA was assessed by adding either 30 nM apo-MnlI (monomer) or 5 nM apo-C-II to 11.4 nM pUC19 DNA in Buffer G supplemented with divalent metal ions (Ca2+, Mg2+, Ni2+, Co2+, Mn2+, Zn2+) at a concentration range of 10 μM–5 mM, or without any divalent metal ions. After 30 min at 37oC, the reactions were stopped as described above and fractionated by 1.6% agarose gel electrophoresis. For DNA fragment cleavage by MnlI, the [33P]5’-end labeled 418-bp DNA fragment containing one MnlI recognition site in the middle of the fragment was used. Reactions, which contained 1 nM of the 418-bp fragment and 4 nM of MnlI dimer, were conducted at 25oC in Buffer G, supplemented with 10 mM MgCl2. The cognate duplex sd-31 was added to a final concentration of 4 nM for the MnlI cleavage activation experiment. Aliquots were removed at timed intervals and quenched with 0.2 volume of gel loading buffer, and then samples were applied to a 8% polyacrylamide in 89 mM Tris-borate, 2 mM EDTA buffer. Gels were analyzed using Cyclone Storage Phosphor System as above to determine the amount of 418 bp DNA fragment. The rate constants were determined by fitting of single exponentials to the decay of DNA fragment using KyPlot 2.0 software (Yoshioka, 2002). ssDNA cleavage assay. For cleavage of radioactively labeled ssDNA, single-stranded oligonucleotides S-19, S-20, S-27 ir S-35 at 5 nM concentration were mixed with either 80 nM (in terms of monomer) of MnlI, or one of the mutant proteins E310A, H313A and H337A in Buffer G supplemented with different divalent metal ions at either 10 µM or 100 μM concentration, or 10 mM (for MgCl2), or without any divalent metal ions. The reactions were carried out for at least 12 hours at 37°C. Cleavage of non-labeled ssDNA was carried out by mixing 5.6 μM S-27 with 4 μM (monomer) apo-MnlI, or 80 nM apo-C-II in Buffer G containing Mg2+ or Ni2+, Mn2+, Zn2+, Ca2+ at a concentration of 100 μM. The reaction mixtures were incubated for 1-18 hours at 37oC. All ssDNA cleavage reactions were terminated by the addition of 0.5 volume of a ‘‘stop’’ solution (95% (v/v) formamide, 0.01% bromophenol blue), heated for 2 min at 95oC and subjected to denaturing gel electrophoresis through 15% polyacrylamide (29:1 acrylamide/bisacrylamide) in 89 mM Tris–borate, 2 mM EDTA buffer. Digestion patterns were visualized by analysis using Cyclone Storage Phosphor System or by staining with ethidium bromide (Sambrook and Russell, 2001). The cleavage positions of the appropriate ssDNA were established by comparing the size of reaction products with the A+G sequencing ladder that was generated of the same oligonucleotide with the help of formic acid and piperidine (Maniatis et al., 1982).

14

RESULTS AND DISCUSSION 1. MnlI R-M system and functional analysis of its components

1.1. Gene structure of the MnlI restriction-modification system Genes encoding enzymes of the MnlI R-M system were isolated using a

strategy based on the selection of self-modifying recombinant plasmids that have become resistant to the MnlI REase cleavage in vitro. A gene library of randomly fragmented Moraxella nonliquefaciens genomic DNA was constructed and analyzed as described in Materials and Methods. Two hundred transformants were obtained after the second round of enrichment by MnlI REase digestion. These transformants were screened for those, which acquired resistance to phage λvir infection due to the expression of cloned restriction-modification genes (Mann et al., 1978). Five positive clones were tested for the MnlI REase and methylase (MTase) activities. Crude cell extracts of these clones revealed the MnlI REase activity in vitro. Both their chromosomal and plasmid DNA were resistant to the MnlI cleavage as expected. The recombinant plasmids from these five clones were found to be identical. The restriction and deletion mapping of one of them, pMnlRM5, determined the relative position of the MnlI R-M genes that were localized within the 3.6 kb MluI-Eco32I fragment (Fig. 1).

Fig. 1. Gene organization of the MnlI R-M system (Kriukiene et al., 2005). Plasmid pMnlRM5 encoding the complete restriction-modification system MnlI was isolated from a library of Moraxella nonliguefaciens genomic DNA. Plasmids pMnlM1, pMnlM2, pMnlM3 and pMnlM4 coding for the DNA modification component only were isolated from the same library. The thick line indicates the pBR-R vector sequence; the shaded boxes correspond to the cloned heterologous DNA from M. nonliguefaciens. The shaded arrows indicate location and orientation of the following genes: mnlIR (encodes MnlI REase), mnlIM1 (MnlI m5C MTase), mnlIM2 (MnlI m6A MTase), cat and bla (genes for chloramphenicol and ampicillin resistance, respectively). The orfX and orfY code for proteins of unknown function. The grey box at the foot of the figure indicates the DNA fragment with mnlIM1 and mnlIM2 genes that was subcloned into pACYC184 vector in order to construct the plasmid pACMnlMM2.65. The black box represents the rep, an origin of replication; black arrows show direction of transcription from the promoter Ptet, which is adjacent to the cloned fragments.

15

Sequencing of both DNA strands of this region and subsequent sequence analysis

e f two

shares

revealed the presence of five open reading frames (ORFs) oriented in the same direction, which were named orfX, mnlIR, mnlIM1, mnlIM2 and orfY.

Two ORFs, orfX and orfY, encode the putative proteins of unknown function. The three ORFs identified between orfX and orfY could encode the MnlI R-M enzymes. The first of them, mnlIR, extends from the position 181 nt of the MluI-Eco32I fragment to the termination codon TAA at nt position 1339. This ORF may encode a putative MnlI REase of 386 amino acid residues with a calculated mass of 45.5 kDa. The potential translation initiation codon ATG at nt position 181 is preceded by a putative ribosome binding site AGGA (nt 170-173). The stop codon of mnlIR overlaps by 1 nt with the start codon ATG of the downstream ORF. The latter is 1053 bp long and extends from nt position 1341 to 2393. It is capable of coding for the M.MnlIM1 MTase of 351 amino acid residues (39.4 kDa). The next ORF, which corresponds to the mnlIM2 gene, starts with the translational start codon ATG, which is located 12 bp downstream of the last nucleotide of mnlIM1 (nt position 2406-3122). This ORF may encode the M.MnlIM2 MTase of 239 amino acid residues (28 kDa). Neither mnlIM1 nor mnlIM2 are preceded by a typical ribosome binding site.

1.2. Protein sequence analysis and specificity of MnlI methyltransferases

As indicated above, the analysis of the MnlI R-M system revealed the presenco ORFs potentially coding for separate MnlI MTases (Fig.1). Type IIS R-M systems often contain two methyltransferases with each recognizing and modifying bases on the opposite strands of the asymmetric recognition site (Lubys et al., 1996). We assumed that methylation of the MnlI target site might also be accomplished by two methyltransferases, M.MnlIM1 and M.MnlIM2.

The first of them, M.MnlIM1, contains all 10 motifs common to 5-methylcytosine (m5C) MTases (Posfai et al., 1989; Kumar et al., 1994). M.MnlIM1

the greatest degree of similarity with the open reading frame HP0051 (56% identity) from Helicobacter pylori strain 26695 (Tomb et al., 1997). It is known that the HP0051-encoded MTase recognizes the same DNA sequence as MnlI and that it modifies the outer cytosine in the upper strand of its recognition sequence resulting in 5’-m5CCTC (Vitkute et al., 2001). To test if the methylation performed by M.MnlIM1 occurs at the same position, we applied the sodium bisulfite modification technique (see Materials and Methods). Experimental data revealed that the first cytosine residue in the upper DNA strand 5’-CCTC survived the bisulfite attack in the case of the sequenced fragments of the M.MnlIM1-modified pUC19 DNA. Based on the presence of conserved motifs characteristic of m5C-methyltransferases and the results of sequencing of the bisulfite-treated methylated DNA, it can be suggested that M.MnlIM1 is a m5C-methyltransferase that modifies the first C base within the 5’-m5CCTC sequence.

16

The translation product of mnlIM2 is predicted to contain conserved motifs typical for β group of amino MTases (Malone et al., 1995), among which the N6-methyladenine (m6A) MTases show the highest similarity to M.MnlIM2. The closest homolog of the putative M.MnlIM2 is an HP0050-encoded MTase (55% identity) from the aforementioned H.pylori 26695 strain. It was suggested that the product of HP0050 methylates the bottom strand of the MnlI target resulting in 5’-Gm6AGG (Vitkute et al., 2001). In order to clarify the specificity of M.MnlIM2, we isolated the DNA of plasmid pET-21b from cells expressing the M.MnlIM2 protein, ER2267[pACMnlMM2.65]. The plasmid pET-21b contains the sequence 5’-TCTAGAGG in which the XbaI target (underlined) partially overlapps with the MnlI target (bold letters). It is known that XbaI REase is sensitive to the methylation of the distal adenine in its 5’-TCTAGm6A-3’ recognition sequence (Patel et al., 1990). Digestion of the M.MnlIM2-modified pET-21b DNA with XbaI REase revealed that XbaI is unable to cleave its recognition sequence that overlaps with the MnlI target. This finding suggests that M.MnlIM2 is an N6-adenine-specific methyltransferase, which modifies the unique adenine in the bottom strand of the MnlI recognition sequence, 5’-Gm6AGG-3’.

1.3. A novel subclass of Type IIS restriction endonucleases

Com REase revealed a significant sequence similarity (33% identity) of its N-terminal part with a hypoth

aled a weak similarity (13 identical and 26 similar amino

1.3.1. Protein sequence analysis of the MnlI REase

parative amino acid sequence analysis of MnlI

etical REase HP0052 of the putative R-M system HP0052-HP0051-HP0050 from H.pylori 26695 strain. However, H.pylori 26695 does not produce the restriction enzyme of the 5’-CCTC specificity (Vitkute et al., 2001). This observation can be explained by the C-terminal truncation of HP0052, where the major part of MnlI active site is located (see below).

The alignment of R.MnlI protein sequence to protein sequences in the databases using PSI-BLAST reve

acid residues in the 132 overlapping sequence) to the well-studied non-specific endonuclease (DNase) domains of colicins ColE7 and ColE9 (Kleanthous et al, 1999; Ko et al., 1999), the members of the HNH superfamily of nucleases (Fig. 2). The similarity extends within a narrow region, which represents the HNH-type active sites of ColE7 and ColE9. Strikingly, all amino acid residues that are important for the active site organization of ColE7 and ColE9 have their counterparts in the C-terminal part of the MnlI enzyme. This observation allowed us to derive a putative active site motif of MnlI REase, 306Rx3ExHHx14Nx8H.

17

Fig. 2. Comparison of amino acid sequences of colicins ColE7 and ColE9 nuclease domains and MnlI restriction endonuclease (Kriukiene et al., 2005). Only the C-terminal part of MnlI is shown. Red letters indicate identical amino acid residues, blue ones stand for similar residues. The active site region of colicin endonucleases is framed. Conserved amino acid residues, which play the key roles in the structure and function of the active site of ColE7 and ColE9, are presented as a MnlI sequence motif at the lower part of the figure.

To date, our knowledge of the Type IIS restriction enzymes is limited mainly

to the FokI and BfiI REases, which represent two different branches of the Type IIS group, the archetypal PD-D/ExK and the phospholipase D subtypes, respectively. The colicin-like HNH motif of MnlI suggests that the catalytic machinery of the enzyme may differ from those of FokI and BfiI. To test this hypothesis and to elucidate the importance of the HNH motif to cleavage of MnlI, we performed an alanine scanning mutagenesis and examined properties of the MnlI mutant proteins.

1.3.2. Mutational analysis of MnlI restriction endonuclease

To examine whether conserved amino acid residues from the motif

306Rx3ExHHx14Nx8H are involved in MnlI cleavage, alanine substitutions were introduced into MnlI by site-directed mutagenesis. The specific activity of the mutant proteins R306A, E310A, H312A, H313A, N328A and H337A was assayed using phage λ DNA as a substrate. Single amino acid substitutions E310A, H313A and H337A strongly affected the catalytic activity of MnlI (Table 1). The mutation H313A abolished the catalytic activity of the MnlI restriction enzyme, while the mutations E310A and H337A largely destroyed DNA cleavage by MnlI: complete cleavage of λ DNA by the mutant proteins was not achieved even at their concentrations that exceeded more than 1000 times the concentration of the wt MnlI

18

sufficient for complete cleavage of 1 μg phage λ DNA in one hour. In contrast, R306A, H312A and N328A mutations rendered proteins with moderately reduced specific activities. They retained 30%, 20% and 10% of wt MnlI specific activity, respectively.

Table 1. Specific activity of wt MnlI and the MnlI mutant proteins (Kriukiene et al., 2005)*.

Specific activity Protein units/mg % wt MnlI 170000 100 R306A 51000 30 E310A < 170 ** < 0.1 H312A 34000 20 H313A 0 0 N328A 17000 10 H337A < 170 ** < 0.1

* Specific activity of MnlI and the mutant proteins was assayed as described in Materials and Methods. One unit of enzyme is the amount required to hydrolyze 1 μg of λ DNA in one hour at 37°C in a 50-μl volume. ** Complete cleavage was not achieved even at the highest protein concentration (0.12 μg/μl) used in the experiments.

The reduced specific activity of mutants might be the consequence of global changes in protein folding, therefore it was necessary to ascertain that the introduced mutations do not result in perturbation of protein conformation. Both the unaffected oligomerization state of the mutants and their unaltered ability to specifically bind DNA containing the MnlI site would demonstrate that the mutations do not perturb the overall folding of the protein, and only change the local environment of the active site. In order to answer these questions, we have studied the DNA binding properties of wt MnlI and its mutant forms by electrophoretic mobility shift assay and the oligomeric state of the MnlI proteins by gel-filtration.

Despite strongly reduced activities, mutants of REases with substitutions at catalytic residues usually demonstrate similar DNA-binding behavior compared to the wt enzyme (Selent et al., 1992; Lagunavicius and Siksnys, 1997). Gel shift analysis of the MnlI proteins was carried out at a constant concentration (1 nM) of either cognate DNA duplex sd-31, or non-cognate one nd-31, while protein concentrations were in the range of 0-1000 nM (in terms of monomer) (Fig. 3).

The study revealed that substitutions E310A, H313A and H337A had no effect on the binding specificity of mutant proteins, indicating the lack of extensive conformational differences, compared to the wt MnlI. Both the wt enzyme and its mutant proteins formed complexes only with specific DNA duplex. Similar DNA-binding patterns were detected with the R306A, H312A and N328A proteins (data not shown).

19

Fig. 3. DNA binding by wt MnlI and the mutant proteins (Kriukiene et al., 2005). The reactions contained either [33P]5’-end labeled specific or non-specific DNA duplexes (1 nM) and one of the proteins of MnlI: wt MnlI, E310A, H313A, H337A (the protein concentrations are indicated at the top of each lane, in terms of monomer). The reaction conditions and analysis of the gels are described in Materials and Methods.

Oligomerization analysis by gel-filtration (Fig. 4) revealed that the wt MnlI and the MnlI mutants with strong defects in the REase activity, E310A, H313A, H337A, eluted as single species between bovine serum albumin (Mr = 64,700) and aldolase (Mr = 176,000).

Fig. 4. Gel filtration of wt MnlI and the mutant proteins E310A, H313A and H337A (Kriukiene et al., 2005). Samples of proteins (100 μl, 500 nM of monomer) were applied to a Superdex 200 HR column at 25°C equilibrated with 10 mM Tris-HCl (pH 7.5), 200 mM KCl. The elution was monitored by measuring the absorbance at 280 nm. The apparent molecular masses of the MnlI proteins were calculated by interpolation from standard curve (♦) obtained using the set of proteins with known molecular masses.

20

Their interpolated molecular masses were in the range of 87-91 kDa, very close to the calculated mass of MnlI dimer (90 kDa). The elution profiles of two other mutants, H312A and N328A, were nearly identical to that of the wt MnlI (data not shown), whereas the mutant R306A was not analyzed. The results indicate that the introduced mutations have no significant effect on the oligomerization state of MnlI. All the MnlI forms exist in solution as dimers.

Therefore, the mutational analysis of MnlI provides evidence that the amino acid residues of the motif 306Rx3ExHHx14Nx8H, which is located in the C-terminal half of MnlI, comprise the active site of the enzyme. The alanine scanning mutagenesis of individual amino acid residues of the putative active site produced the mutant H313A that exhibited no detectable activity and the mutants E310A and H337A that showed only traces of the DNA cleavage (>1000-fold reduction in the specific hydrolysis). In contrast, only three- to ten-fold decrease of the MnlI specific activity was observed after introduction of single mutations at positions R306, H312 or N328. Therefore, it seems that these conserved amino acid residues are less important for specific DNA cleavage. However, all replacements had no detectable effect on the specific DNA binding and dimerization of MnlI. Thus, the MnlI mutant proteins displayed properties, which were expected for the active site mutants, since they uncoupled the specific DNA binding and oligomerization from the hydrolysis of phosphodiester bonds. Crystallographic and mutational studies of ColE7 and ColE9 DNases (Ko et al., 1999; Kleanthous et al., 1999; Sui et al., 2002; Walker et al., 2002; Hsia et al., 2004; Mate and Kleanthous, 2004; Doudeva et al., 2006) may be helpful to better understand the role of individual conserved amino acid residues in the putative active site of MnlI. The position of H313 in the protein sequence of MnlI corresponds to that of a highly conserved histidine, which is proposed to function as a general base in the proteins of the HNH family (H103 and H545 residues of ColE9 and ColE7 DNases, respectively). The roles of H103 and H545 in the colicins have been shown to be critical for nuclease activity of the enzymes – substitutions H103A and H545A completely eliminated the nuclease activity of ColE9 and ColE7 DNases (Walker et al., 2002; Doudeva et al., 2006). The inactivation of MnlI by the H313A mutation suggests that H313 residue also might act as a general base. The different metal ion coordination has been reported for ColE9 (Hsia et al., 2004; Mate and Kleanthous, 2004; Doudeva et al., 2006): a metal ion can be held with two or three protein ligands (H102 and H127, or H102, H127 and H131). Consistent with this important role, the mutation H127A abolished the activity of ColE9, whereas H102A reduced the catalytic activity to 6% of the wt enzyme. The equivalents of the first two amino acids were found in MnlI (histidine residues H312 and H337). The mutant H337A has been shown to be nearly inactive (<0.1 % of the wt MnlI activity), suggesting the importance of H337 to the catalytic reaction of MnlI, whereas the mutant H312A retained considerable specific activity. The equivalent of the third histidine residue, known to be in a direct contact with a metal ion in ColE9 (H131), is absent in MnlI. In crystal structures of ColE9 DNase, the only glutamate residue, E100, orients the critical metal ligand, H127, without direct contacts to the metal ion.

21

The mutant E100A still contained residual activity (1%) as compared to wt ColE9 (Walker et al., 2002). In the case of MnlI, the glutamate E310 (equivalent to E100 in ColE9) appeared to be of critical importance for catalysis of MnlI, since the mutation E310A rendered MnlI nearly inactive (<0.1 % of the wt activity). Therefore, it is possible that the glutamate E310 is utilized for the coordination of divalent metal ion in the active site of MnlI. The R96 and N118 residues of the ColE9 DNase play a structural role in the active site of the enzyme. ColE9 DNase mutant proteins R96A and N118A showed reduced activities with dsDNA: they retained 14% and 86% of the wt enzyme activity, respectively. It is noteworthy that the reduced nuclease activity (23%) was also found in the N560A mutant of ColE7 (Huang and Yuan, 2007). The MnlI mutants, in which R306 and N328 (homologs of R96 and N118 in ColE9) were replaced by alanine, also demonstrated a weakening of dsDNA cleavage (Table 1). Future work on biochemical and crystallographic studies might prove helpful in determining the precise roles of the key residues in the predicted active site of MnlI REase.

1.3.3. Single-stranded DNA cleavage by MnlI

It has been shown that the activity of non-specific HNH nucleases ColE7 and

ColE9 depends on different alkaline earth and transition metal ions (Pommer et al., 2001; Ku et al., 2002; van den Heuvel, 2005; Hsia et al., 2004). The colicin nucleases require Mg2+ for the efficient degradation of plasmids, while Ni2+ is preferred metal ion for the cleavage of single-stranded DNA (Pommer et al., 1998; 2001). However, the ColE9 nuclease exhibits the cleavage of ssDNA, when ColE9 is in a 10,000-fold excess as compared with the protein amounts required for the plasmid DNA cleavage. Thus, ssDNA is a poor substrate for ColE9 DNase (Pommer et al., 2001).

To verify if MnlI, which has the colicin-like HNH active site, can hydrolyze ssDNA, the cleavage of [33P]5’-end labeled single-stranded oligonucleotide S-27 was carried out (Fig. 5). We found that MnlI displayed a weak endonuclease activity toward S-27 in the presence of Ni2+ or Cd2+, Co2+, Mn2+ and Zn2+, but there was no detectable activity in the presence of Mg2+ or Ca2+ (Fig. 5A and B). This finding is in good agreement with the data on colicins ColE9 and ColE7. Moreover, MnlI mutants with strong defects in the REase activity, namely E310A, H313A and H337A, demonstrated no detectable cleavage of S-27 substrate. This could indicate that the same HNH active site is responsible for both ds- and ssDNA cleavage of MnlI.

DNA degrading bacterial colicins ColE7 and ColE9 hydrolyze dsDNA, ssDNA and RNA nonspecifically. It has been demonstrated that these nucleases cleave dsDNA and ssDNA at all bases with a preference for cleavage after thymine in dsDNA hydrolysis (Pommer et al., 2001; van den Heuvel et al., 2005; Wang et al., 2007). However, the sequence-independent cleavage of ssDNA is specific for the length of DNA substrate: ≤ 10 nt nucleic acids are not hydrolyzed, as they cannot form stable complexes with the enzyme (Pommer et al., 2001; van den Heuvel et al., 2005).

22

Fig. 5. Cleavage of single-stranded oligonucleotide S-27 by the MnlI restriction endonuclease and the mutant proteins (Kriukiene et al., 2005). (A), [33P]S-27 was incubated with 80 nM (monomer) of MnlI or the MnlI mutant protein for 12 hours at 37°C in Buffer G supplemented with either 10 µM NiCl2, or 10 mM MgCl2, or without any divalent metal ions. (B), Cleavage patterns of hydrolysis of S-27 by wt MnlI after a 16-hour incubation in the presence of different divalent metal ions (indicated on the figure) either at 10 or 100 µM concentration. Hydrolysis products were analyzed as described in Materials and Methods.

To identify the ssDNA sequence selectivity of MnlI, different ssDNA

oligonucleotides S-27, S-35, S-19 and S-20 were digested with the REase and the digestion products were analyzed (Fig. 6). No readily identifiable preferences were found among these products, although the particular sites within a single oligonucleotide were better hydrolyzed than others.

Fig. 6. Sequence preferences in the cleavage of single-stranded DNA by MnlI (Kriukiene et al., 2005). The large and small triangles indicate the more or less preferred cleavage sites within the oligonucleotide. The exact cleavage positions were determined with the help of Maxam-Gilbert A+G sequencing ladders that were derived from the respective oligonucleotide as described in Materials and Methods.

23

This observation indicates that MnlI, like the colicins, is able to cleave DNA

substrates at all bases, thus, MnlI cleaves ssDNA rather nonspecifically. The discovered ssDNA-cleavage activity of MnlI in the presence of different metal ions further confirms the relationship of MnlI to the HNH enzymes, colicin DNases ColE7 and ColE9, and allows us to assign MnlI restriction enzyme into the HNH superfamily of nucleases.

Taken together, it can be suggested that the active site of MnlI REase is formed by the colicin-like HNH motif, 306Rx3ExHHx14Nx8H, that differs from the catalytic motifs employed by FokI and BfiI REases - the representative members of two known subtypes of Type IIS REases, PD-D/ExK and PLD, respectively. In addition, the active site of MnlI is responsible for hydrolysis of both ds- and ssDNA substrates. Hence, our study (Kriukiene et al., 2005) provided the first experimental evidence for a Type IIS REase that does not belong to the PD-D/ExK or PLD superfamilies of nucleases, and is instead a member of the unrelated HNH superfamily. Currently, the HNH group of Type IIS REases has two more members: HphI (Cymerman et al., 2006) and Eco31I (Jakubauskas et al., 2007).

2. DNA binding stoichiometry of MnlI restriction endonuclease

Most type IIS restriction enzymes characterized to date appear to be monomeric in solution (Pingoud et al., 2005). As a monomeric form of the enzymes will contain only a single active site, there is no straightforward way to achieve the hydrolysis of both DNA strands. Investigation of an archetypal member of the group, one of the best studied type IIS enzyme FokI, has led to a model of how FokI cuts dsDNA (Wah et al., 1997; 1998; Vanamee et al., 2001). FokI comprises two functionaly distinct domains, one for DNA binding and another for catalysis. Monomeric FokI binds to the recognition sequence via the DNA binding domain. The process releases the catalytic domain, allowing the formation of a FokI dimer, achieved by the dimerization through the cutting domains of two FokI monomers bound to two target sites. Double-stranded cleavage occurs near one of the recognition sequences, with the presence of two catalytic domains leading to the hydrolysis of the individual DNA strands at this one site. A key feature of this mechanism is the requirement of two DNA target sites for efficient cutting. However, not all Type IIS REases are monomers: BfiI and BpuJI enzymes are homodimers (Lagunavicius et al., 2003; Sukackaite et al., 2007), while BspMI is a homotetrameric protein (Gormley et al., 2002). Hence, these restriction enzymes do not require any further oligomerization for the breakage of two DNA strands. Despite the described differences in oligomerization states, which presumably determine the different pathways to achieve dsDNA cleavage, it can be suggested that for a Type IIS enzyme to accomplish a double-stranded cut, the enzyme should be able to form at least a dimer. Noteworthy, all the aforementioned Type IIS REases, like many Type IIS

24

restriction enzymes (Bath et al., 2002) have been shown to interact with two copies of their target site before efficient cleavage of DNA.

It had been previously estimated by gel-filtration analysis that MnlI REase is a dimer in solution (Fig. 4). Like all Type IIS enzymes characterized to date, MnlI is composed of two domains, one responsible for target recognition and the other for catalysis (see Section 3). Thus, the dimeric form of MnlI might be capable of binding two recognition sequences. The stoichiometry of the MnlI – DNA complexes was investigated by applying various biochemical methods.

2.1. Analysis of the MnlI – DNA complex Sucrose gradient velocity centrifugation was used to evaluate the ability of

MnlI to bind to two DNA target sites. The centrifugation results of the MnlI protein (Fig. 7) were consistent with previously reported findings based on gel-filtration: MnlI, relative to the marker proteins, yielded an apparent mass of ~94 kDa (Fig. 7, green line), and thus is a dimer.

Fig. 7. Ultracentrifugation analysis of wt MnlI and its complex with the specific 31-bp duplex sd-31-PTO. MnlI (500 nM of monomer), or 400 nM of MnlI (in terms of monomer) was combined with 400 nM of [33P]sd-31-PTO duplex and then centrifuged in a 12-ml of 5-20% (w/w) linear sucrose concentration gradient prepared in 40 mM Tris-acetate (pH 7.0), 2 mM Ca-acetate. The peaks of marker proteins and MnlI were achieved from analysis of fractions by SDS-PAGE. Distribution of the radioactively labeled duplex was detected by dot-blot analysis. In addition, the MnlI – DNA complex was detected by electrophoretic analysis of sucrose gradient fractions. The masses, which are shown above the peaks, denote the apparent molecular masses calculated by interpolation from standard curve derived using a set of marker proteins. The numbers indicate marker proteins: 1, chymotripsinogen A (Mr 19,900); 2, ovalbumin (Mr 45,800); 3, albumin (Mr 64,700); 4, aldolase (Mr 178,000).

The DNA binding properties of REases are often studied in the presence of

divalent metal ion, such as non-catalytic Ca2+ (Vipond and Halford, 1995). However, MnlI demonstrates endonucleolytic activity with a wide range of divalent metal ions (see Section 3), among which Ca2+ is a less efficient cofactor. Therefore, Ca2+ ions were used in all sucrose gradient centrifugation experiments. In order to prevent

25

DNA cleavage by MnlI, the experiments were carried out with the modified sd-31-PTO duplex, where the scissile phosphate in the top strand of DNA was replaced by phosphorothioate. This substitution rendered sd-31-PTO resistant to MnlI cleavage.

When the MnlI mixture with radioactively labeled specific DNA duplex sd-31-PTO was analyzed, two peaks of radioactivity were observed. The first peak, which had a radioactivity maximum in the eighth fraction, contained free DNA (Fig. 7, blue line). An apparent mass of DNA duplex, ~30 kDa, was slightly higher than its calculated molecular mass of 20 kDa. The second peak represented the MnlI – sd-31-PTO complex (Fig. 7, red line). The complex was estimated to have an apparent mass of ~161 kDa, and most likely contained the MnlI dimer bound to two DNA duplexes.

To further investigate the ability of MnlI to interact with two DNA molecules, DNA displacement experiments were undertaken. This approach was used previously to investigate the simultaneous binding of two specific DNA to the SfiI restriction endonuclease (Embleton et al., 1999). At first, the binding of MnlI to sd-31-PTO duplex in the presence of Ca2+ ions was examined (Fig. 8A).

Fig. 8. Analysis of the MnlI – DNA complex by gel shift assays. (A), The reactions contained [33P]sd-31-PTO DNA duplex (1 nM) and increasing amounts of MnlI (the protein concentrations are indicated at the top of each lane, in terms of monomer) in binding buffer 40 mM Tris-acetate (pH 7.0), 2 mM Ca-acetate, 0.1 mg/ml BSA, 10% glycerol. (B), DNA displacement assay of the MnlI – DNA complex. Increasing amounts of unlabeled 418-bp fragment, having a single MnlI site, were added to a mixture of 1 nM 31-bp radioactively labeled duplex and 25 nM wt MnlI (monomer) in the same binding buffer as indicated in the part A. Electrophoresis was run and gels were analyzed as described in Materials and Methods.

26

The titration of a fixed amount of DNA with increasing concentrations of the

MnlI protein yielded only one specific complex (Complex 1). In the subsequent DNA displacement experiment (Fig. 8B), the specific Complex 1 was formed by mixing 1 nM of the radioactively labeled duplex sd-31-PTO with a molar excess of the MnlI protein (25 nM, in terms of monomer). Then, an unlabeled 418-bp DNA fragment that contains one MnlI recognition site was added in increasing amounts to the complex. If a dimer of MnlI binds only one DNA molecule, the radioactively labeled duplex should be gradually replaced by the unlabeled DNA fragment as the concentration of the latter increases. In gel-shift assays, this can be detected as an increasing amount of free duplex. If a dimer of MnlI interacts with two DNA molecules at the same time, a novel complex containing two DNA molecules of different lengths, 31-bp labeled DNA duplex and 418-bp DNA fragment, should be formed. This additional complex may be detectable as a less mobile type of the specific complexes. When the 418-bp DNA fragment was added to the primary Complex 1, it once became incorporated in the novel Complex 2 (Fig. 8B). Further increases in the concentration of the DNA fragment resulted in the displacement of the radioactively labeled sd-31-PTO from Complex 1 as well as Complex 2. Therefore, it seems apparent that MnlI is capable of binding both the labeled and unlabeled DNA at the same time. This observation is in good agreement with the ultracentrifugation experiments: MnlI is able to bind two copies of its recognition site to form a synaptic complex.

2.2. Trans - stimulation of MnlI cleavage Restriction endonucleases that require a bridging interaction between two

copies of their recognition sequence are more active on a DNA with two sites than on a DNA with only one DNA target site (Wentzell et al., 1995; Skirgaila et al., 1998; Bath et al., 2002; Lagunavicius et al., 2003). The requirement for two recognition sites is most clearly demonstrated with the supercoiled DNA substrates carrying either one or two target sites (Bilcock et al., 1999). Interactions between two DNA sites in cis, in the same DNA molecule, are usually favoured over interactions across sites in trans, on separate DNA molecules, since the energy needed to bring together sites in cis is usually much smaller than that for sites in trans (Welsh et al., 2004, in Restriction Endonucleases). Thus, DNA substrate with one recognition sequence is cleaved particularly poorly. In contrast, if the protein binds two DNA target sites located in cis on a single DNA molecule, it effectively hydrolyzes the plasmid. In addition, the slow cleavage of the plasmid with one DNA target site can be activated by the specific DNA duplex supplied in trans.

Unfortunately, in the case of MnlI, the presence of at least 13 MnlI recognition sites on available supercoiled plasmids interfered with the test of the one- or two-site plasmids. Therefore, MnlI-directed DNA cleavage was investigated using a DNA fragment with one MnlI target site when cognate DNA duplex was added in trans.

27

The MnlI cleavage of the 418-bp DNA fragment under single turnover conditions ([DNA fragment] = 1 nM, [MnlI] = 4 nM (dimer)) was examined in the absence or the presence of the cognate oligonucleotide duplex sd-31 ([31-mer] = 4 nM) (Fig. 9). The data were fitted to single exponentials to evaluate the rate constants of the cleavage.

Fig. 9. Activation of MnlI cleavage by the specific duplex sd-31. The cleavage reactions were performed at 25oC in Buffer G supplemented with 10 mM MgCl2. The reaction mixtures contained either 1 nM 418-bp DNA fragment, 4 nM MnlI dimer (filled circles), or 4 nM of sd-31 duplex along with the components mentioned above (filled diamonds). Samples were removed from the mixtures at the time intervals indicated on the x-axis. The samples were then analyzed as described in Materials and Methods. Each data set is the average of three independent determinations (error bars not shown on the graph are smaller than the symbols).

The fit of the DNA substrate cleavage by MnlI in the absence of sd-31 duplex

(filled circles, ●) gave rate constant of 0.16 min-1. When the oligonucleotide sd-31 was added to the reaction mixture, hydrolysis was sped up (filled diamonds, ♦), resulting in a 3-fold increase in the rate over that seen in the absence of added oligonucleotide duplex. In this case, the estimated rate constant was 0.49 min-1.

On the whole, the experiments described above confirmed the ability of MnlI to interact with two DNA sites at the same time. The simultaneous recognition of two DNA target sequences is necessary for the optimal action of MnlI restriction endonuclease. Therefore, the MnlI protein can be assigned into the rapidly growing group of restriction enzymes, whose catalytic activity is stimulated by binding to two copies of the specific DNA.

In the field of REases, the biological significance of the need for two DNA sites is still elusive. One consequence of the requirement for two unmodified DNA sites for cleavage, which in turn can result in a reduction in the endonucleolytic activity of the restriction enzyme, could be a protection against suicidal restriction of the rare unmodified sites in the cellular DNA. Such unmethylated sites may arise by DNA repair or by incomplete DNA methylation (Bickle and Kruger, 1993).

28

3. Domain organization of the MnlI restriction endonuclease

A two-domain structure has been demonstrated for all characterized to date Type IIS restriction enzymes. The modular structure of Type IIS REases makes them excellent targets for the study of evolutionary shuffling of structural elements among all families of nucleases and DNA-binding proteins. This process has been already validated in some members of this family. The DNA-recognition domain of an archetypal REase FokI, the member of the conventional PD-D/ExK superfamily of restriction enzymes, resembles the DNA binding domain of the catabolite gene activator protein (Wah et al., 1997), while its C-terminal nucleolytic domain exhibits a λ-exonuclease-like fold, demonstrating a weak non-specific nuclease activity (Li et al., 1992). A monomeric Type IIS REase Mva1269I, possessing two active sites residing in one molecule of the protein, has been proposed to have evolved through fusion of an EcoRI-like domain and a non-specific nuclease domain of FokI, each of which perform a single cut in the double-stranded DNA substrate (Armalyte et al., 2005). A recent crystal structure obtained for the EDTA-resistant Type IIS REase BfiI (Grazulis et al., 2005) indicates the similarity of its C-terminal DNA-binding domain to those of the Type IIE enzyme EcoRII and the Arabidopsis cold-responsive transcription factor RAV1. Strikingly, the N-terminal domain of BfiI shows sequence similarity to Nuc, an EDTA-resistant non-specific nuclease from the phospholipase D superfamily (Sapranauskas et al., 2000). Bioinformatic studies (Bujnicki et al., 2001) predicted that another nuclease fold, which forms a non-specific catalytic center designated as a ‘ββα-metal’ fold, may be involved in the catalytic action of restriction endonucleases. One of the largest group of the ‘ββα-metal’ enzymes, the HNH family, forms a large cluster of nucleic acid-specific enzymes, which demonstrate a broad diversity in their catalytic and structural properties as well as their origination from a common ancestor (Mehta et al., 2004). The HNH homing endonuclease I-HmuI appears to have an HNN-type active site and two DNA-binding domains previously observed in I-PpoI and I-TevI homing endonucleases, the members of the His-Cys and GIY-YIG homing enzyme families, respectively (Shen et al., 2004). The presence of different protein domains has also been demonstrated for other HNH enzymes, I-CmoeI and I-TevIII. The first contains the GIY-YIG motif (Drouin et al., 2000), while two putative zinc-finger domains reside in the latter (Eddy and Gold, 1991, Robbins et al., 2007). Besides the involvement of various members of the HNH family in cleavage of nucleic acids, their specificity is also directed by fusion to additional protein domains, such as reverse transcriptase, DNA repair enzyme AP2 domains, cloacin ribonucleases, and various DNA binding motifs (Stoddard, 2005). The growing number of data indicating that structural domains of different protein families reside in various endonucleases suggest the presumable evolution of enzymes by combination of independent structural domains to acquire new biologically distinct functions.

MnlI displays homology to the HNH members, bacterial colicin DNases, across its active site region, hinting at the involvement of the HNH-type nuclease

29

domain in the DNA cleavage function of MnlI. To test this hypothesis, the putative domain structure of MnlI was examined by limited proteolysis.

3.1. Proteolysis of MnlI The absence of structural information for MnlI induced the mapping of the

domain structure by limited proteolysis. Generally, only linker regions or loops between tightly packed domains are readily accessible to proteases, thus providing us with important information on protein folding. Limiting amounts of endoproteinase Glu-C were used to search for functional domains of MnlI in the absence (Fig. 10A) or the presence (Fig. 10B) of specific DNA.

Fig. 10. SDS-PAGE profiles of limited proteolysis of MnlI in the absence (A) or the presence (B) of specific DNA (Kriukiene, 2006). Small arrows indicate the proteolytic fragments of MnlI and time-points chosen to generate them for Edman degradation. The apparent Mrs of possible domains of MnlI produced by Glu-C (based on molecular weight markers) and the positions of the first N-terminal amino acid of the C-terminal domains are indicated alongside the schematic representation of the MnlI protein.

In the absence of the specific duplex, digestion with Glu-C released two

possible domains in 1 min, corresponding to molecular masses of ~30 kDa and ~14 kDa by SDS-PAGE, which were referred to as N-I and C-I, respectively. On further digestion, the N-I fragment was rapidly degraded, whereas incubation with Glu-C for at least 60 min degraded C-I into a stable fragment C-II?, with a molecular mass of ~12 kDa. A time course of Glu-C mediated digestion of the MnlI – DNA complex (Fig. 10B) showed a significantly different cleavage pattern. A 15-min cleavage with Glu-C released two stable fragments, N-II and C-II, whose mobility in SDS-PAGE corresponded to the molecular masses of ~32 kDa and ~12 kDa, respectively.

The N-terminal sequences of the fragments N-I, N-II, C-I, C-II and C-II? (Fig. 10) were determined by Edman degradation. Unambiguous sequencing data allowed the protein fragments to be located on the MnlI polypeptide. Based on this analysis, MnlI consists of two protease-resistant domains that correspond to the N-terminal and C-terminal halves of the protein. The N-terminal sequences of N-I and N-II matched exactly the sequence at the N-terminus of the MnlI protein. Upon isolation from the Glu-C digest of MnlI in the presence of DNA by size-exclusion chromatography, the N-II protein was subjected to MALDI mass spectrometry analysis. The N-II domain

30

yielded a measured mass of 31.215 kDa. Since the Glu-C cleavage at other possible cleavage sites in the respective region of MnlI would have yielded the fragments with considerably different molecular masses, the measured value corresponds to the protein fragment that includes amino acid residues 1-266 of MnlI and has the theoretical mass of 31.135 kDa. Hence, when proteolysis of pre-formed MnlI-DNA complex is carried out, proteolysis of MnlI results in the appearance of two stable fragments, an N-terminal fragment including amino acid residues 1-266 that has the measured mass of 31.215 kDa, and a C-terminal fragment C-II starting at Lys267, with a mass of ~12 kDa in SDS-PAGE (Fig. 10B).

Proteolysis without specific DNA initially converts MnlI into an N-terminal fragment N-I with a mass of ~30 kDa in SDS-PAGE and a C-terminal fragment C-I starting at Ile249 that has a mass of ~14 kDa (Fig. 10A). As proteolysis proceeds, N-I is digested to small peptides, while the C-I fragment is degraded into the stable C-II? fragment, with the same N-terminus as C-II resulted in Fig. 10B. In both experiments, the sum of the apparent molecular masses of the N-terminal and C-terminal fragments is close to that expected for a subunit of MnlI dimer (45 kDa). Since the whole protein, as well as the N-terminal half of MnlI, becomes more resistant to Glu-C as MnlI binds to its recognition sequence, the N-terminal half could be involved in specific DNA binding by MnlI. The stable C-II fragment may represent the protein domain responsible for accomplishing the catalytic reaction, as all essential catalytic amino acids are located in this part of the protein (see Section 1).

3.2. Functional domains in MnlI restriction endonuclease To gain insight into the function of the C-terminal fragment C-II, the digest of

MnlI by Glu-C in the absence of specific DNA was first fractionated by size-exclusion chromatography. Strikingly, analysis of both the A280 profile (Fig. 11A) and the presence of C-II in SDS-PAGE (not shown), gave an apparent mass of ~8 kDa. The observed molecular mass of C-II was approximately 1.5 times lower than that estimated by SDS-PAGE (~12 kDa). Therefore, it seems that the C-II protein exists in solution as a monomer. The purified C-terminal domain (Fig. 11A) was tested for nucleolytic activity on λ DNA and pUC19 DNA (not shown). It appears that C-II caused DNA to be rapidly degraded.

To analyze whether the identified N-terminal proteolytic fragment N-II corresponds to the DNA-binding domain of MnlI, the fragment of the mnlIR gene, representing the N-II domain, was cloned, and the polypeptide was expressed and purified as described in Materials and Methods. SDS-PAGE analysis revealed the enzyme preparation to be homogeneous N-terminal domain N-II (Fig. 11B).

31

Fig. 11. Purification of the functional domains of MnlI (Kriukiene, 2006). (A), The elution profile of the C-II domain after the fractionation by gel-filtration. A 1.5-μg sample was loaded to test the purity of the resulted C-II in SDS-PAGE. (B), Analysis of a 3-μg sample of the purified N-terminal domain N-II by SDS-PAGE. The proteins were visualized by Coomassie Brilliant Blue staining.

Gel mobility-shift assays to analyze binding of the specific duplex (sd-31) by

the purified N-II protein (Fig. 12) revealed two bands of different electrophoretic mobility in binding buffer supplemented with 0.1 mM EDTA, whereas MnlI formed only one complex.

Fig. 12. Gel mobility-shift assay with MnlI and its N-terminal fragment in the presence of a 31-bp specific duplex. The reactions contained either sd-31-PTO (in the experiments with MnlI) or sd-31 (in the case of the N-II domain) specific DNA duplex at 1 nM concentration and increasing concentrations of one of the proteins in binding buffer 40 mM Tris–acetate (pH 7.0), 0.1 mg/ml BSA, 10% glycerol supplemented with 0.1 mM EDTA or 2 mM Ca-acetate. Enzyme concentrations (in terms of monomer) are indicated at the top of each lane. Electrophoresis was run and gels were analyzed as described in Materials and Methods. Numbers 1 and 2 designate two complexes formed by the N-terminal domain.

32

Western blot-hybridization of the complexes in the gels of Fig. 12 with the antibodies raised against MnlI confirmed that namely the N-II domain caused two complexes with the specific duplex to appear (data not shown). The predominant complex of N-II (Complex 1) had a higher electrophoretic mobility than MnlI-DNA complex. A faster mobility results from the lower molecular mass of N-II compared with MnlI. Replacement of EDTA by Ca2+ ions in the binding buffer, contrary to MnlI, did not affect the DNA binding properties of the N-II domain. It should be noted that none of these complexes were detected with the duplex lacking the cognate site (nd-31).

These results clearly demonstrated that the N-terminal domain mediates sequence-specific DNA binding by the full-length protein. Neither MnlI nor its N-terminal DNA-binding fragment requires divalent metal ions for specific DNA binding. N-II formed Complex 1 in the low nanomolar range of protein concentration, whereas the appearance of a higher order complex (Complex 2) depended slightly on increasing concentrations of N-II. Therefore, most likely, two bands for the N-II – DNA complexes could appear due to possible dimerization of N-II. In this case, N-II might be capable of binding two recognition sequences of MnlI.

3.3. Analysis of the N-II – DNA complexes A gel-filtration assay was used to investigate the stoichiometry of the N-II –

DNA complexes (Fig. 13A). On a gel-filtration column the purified N-II domain eluted at a volume that corresponded to an apparent molecular mass of ~29 kDa, very close to a monomer of the 31.215 kDa N-II protein. The apparent molecular mass of the specific duplex sd-31 (~48 kDa) was found to be nearly 2.5 times higher than its calculated molecular mass of 20 kDa. This was explained by the cylindrical shape of DNA molecules, which results in a much higher frictional ratio than the spherically shaped marker proteins (Lagunavicius et al., 2003; Tamulaitis et al., 2006). In the gel-filtration experiment of the mixture of N-II and sd-31 at an N-II:DNA molar ratio of 10:1, two peaks were detected: one at the same volume as the free N-II (~29 kDa) and another corresponding to an apparent mass of ~68 kDa. Although the value of 68 kDa lies between the sum of the theoretical masses for one protein molecule bound to one DNA duplex (51 kDa) and those expected from gel-filtration experiments (77 kDa), it most likely represents the monomer of N-II bound to one DNA molecule. The lower mass value of the complex may have been due to an alteration in either protein or DNA structure occurring upon DNA binding. Further increases in the N-II:DNA molar ratio up to 60:1 revealed the appearance of a minor peak besides the ~68 kDa species. The novel complex possessed an apparent molecular mass of ~132 kDa, which is in excellent agreement with the size of two N-II - DNA complexes (136 kDa). It should be noted that neither the DNA duplex nor N-II caused the minor peak to appear at the concentrations used in the experiment.

As another independent test for the evaluation of stoichiometry of the N-II – DNA complexes, sucrose gradient velocity centrifugation under similar conditions as

33

those used in the gel mobility-shift assays (in the presence of Ca2+, Fig. 12) was performed (Fig. 13B). The N-II protein was observed in a peak corresponding to an apparent mass of ~27.5 kDa. When the specific complex that was formed with a molar excess of N-II over radioactively labeled sd-31 duplex was subjected to sucrose gradient centrifugation, two specific N-II – DNA complexes were detected. The predominant complex with the same mobility as Complex 1 in non-denaturing gels (Fig. 12) had an apparent mass of ~54 kDa. This value corresponds well to the sum of molecular masses of the protein monomer and one DNA molecule (27.5 kDa + 30 kDa = 57.5 kDa).

Fig. 13. Stoichiometric analysis of N-II – DNA complexes (Kriukiene, 2006). The numbers above the peaks denote the apparent molecular masses calculated by interpolation from standard curve derived using a set of marker proteins. (A), Gel-filtration analysis on Superdex 200 HR column. The elution profiles are shown for 1 μM of specific duplex sd-31; 60 μM of N-II; N-II and DNA mixtures at protein:DNA (μM) ratios of 10:1; 40:1 and 60:1. (B), Ultracentrifugation analysis of N-II (40 μM), [33P]sd-31 (1 μM), and the N-II -[33P]sd-31 (40:1) mixtures on a sucrose gradient in buffer 40 mM Tris–acetate (pH 7.0), 2 mM Ca-acetate. The peaks were achieved by applying different detection methods (Materials and Methods).

34

The complex with lower mobility (Complex 2) accumulated in a fraction that, relative to the marker proteins, gave an apparent mass of ~117 kDa. It is close to the sum of the masses for two N-II – sd-31 complexes (115 kDa). Worthy of note, centrifugation of the mixture of MnlI and non-cognate DNA duplex did not result in detection of any complexes (not shown).

The conventional Type IIS REases need to dimerise to cut two strands of their double-stranded DNA targets. MnlI REase is a homodimeric protein (90 kDa), with a single active site residing in the monomeric C-terminal domain of each subunit. Mutagenic studies have revealed that the DNA cleavage reaction of MnlI is accomplished through the action of the C-terminal HNH motif, 306Rx3ExHHx14Nx8H. This motif shares the highest active site similarity with the colicin ColE7 and ColE9 nucleases, the members of the HNH group of the ‘ββα-metal’ superfamily. Like the C-terminal domain of MnlI, the nuclease domains of ColE7 and ColE9 exist in monomeric states (Kleanthous et al., 1999; Ko et al., 1999). It has been proposed that although it is possible that colicins cleave dsDNA as a homodimers (Cheng et al., 2002), the dimeric state is not essential for degradation of dsDNA. Pommer et al. (2001) have shown that the endonuclease E9 is capable of degrading dsDNA by making a number of single-stranded cuts. Moreover, other monomeric non-specific nucleases of the ‘ββα-metal’ group, such as a periplasmic nuclease Vvn from Vibrio vulnificus (Li et al., 2003), NucA from Anabaena sp. (Meiss et al., 2000) and monomeric variants of Serratia nuclease (Franke et al., 1998), cleave ss- and dsDNA efficiently, even though the latter was reported to be a homodimer (Miller et al., 1994; 1996). In addition, the recently reported domain organization of the HNH endonuclease I-TevIII (Robbins et al., 2007) has revealed that the catalytic domain of I-TevIII, which possesses a colicin-like HNH motif, is monomeric, while the DNA-binding domain mediates the DNA recognition as well as the dimerization of the protein.

All the Type IIS REases characterized to date dimerise through their nucleolytic domains (Wah et al., 1997; Zaremba et al., 2004; Grazulis et al., 2005). In contrast, the nucleolytic domain of the dimeric MnlI protein, C-II, was determined to be a monomer. Sucrose centrifugation and gel-filtration experiments show that the N-terminal fragment of MnlI REase, N-II, binds as a monomer to a single copy of its recognition sequence. However, the N-II domain displays an ability to form a dimer, which can bind to two copies of the recognition sequence. Considering the monomeric state of the domain C-II that possesses a single active site capable of making a single-stranded cut in the dsDNA, for MnlI to achieve a double-stranded cut, the enzyme must have evolved additional structural elements for dimerization, which most likely reside in the N-terminal domain or/and the linker region connecting the domains.

35

3.4. Colicin-like nuclease domain of MnlI triggers metal-dependence and substrate specificity of the MnlI restriction endonuclease The highly variable HNH motif is the hallmark sequence signature of a broadly

distributed nuclease fold, which forms a non-specific catalytic center in many enzymes, known as a ‘ββα-metal’ fold (Kuhlmann et al., 1999). The ‘ββα-metal’ superfamily comprises a variety of nucleases, including the best characterized members such as specific homing endonucleases from the HNH and the His-Cys families, non-specific nucleases from Serratia group, the nuclease Vvn, bacterial colicins and phage T4 Endo VII endonuclease regardless of little sequence homology they exhibit to each other. This points to a common nuclease ancestor that has diverged into distinct families to such an extent that these groups share only some active site residues, a histidine that acts as a general base and one or two carboxylate/carboxamide/histidine as cofactor ligands. Most nucleases that have adopted a ‘ββα-metal’ fold require an alkaline earth metal ion, Mg2+ or Ca2+, to promote endonuclease activity (Stoddard, 2005). Only a few sequence-specific members of this family, such as homing endonucleases I-PpoI (Lowery et al., 1992), I-HmuI (Shen et al., 2004) and I-TevIII (Robbins et al., 2007), can be activated in vitro by several transition metal ions. However, both alkaline earth and transition metal ions can function as cofactors for the nucleolytic activity of non-specific nucleases from Serratia group and bacterial colicins.

It seems that subtle differences in metal binding and overall conformation displayed by the ‘ββα-metal’ enzymes are responsible for different metal specificity profiles of enzymes that belong to a distinct group of the superfamily. The differences in preferred metal ions for degradation of nucleic acids have been reported for the closely related sugar non-specific nucleases from Serratia group: Serratia nuclease (Friedhoff et al., 1996) and NucA from Anabaena sp. (Meiss et al., 1998). Although the Serratia enzyme demonstrates maximum activity with Mg2+, other ions, such as Co2+, Ni2+ and Zn2+ but not Ca2+ can replace it. NucA prefers Mn2+ and Co2+ over Mg2+ and shows little activity with Ni2+ and no activity with Zn2+. In contrast, the histidine-rich environment of the ‘ββα-metal’ motif in bacterial colicins has converted their active site into a highly adaptive catalytic centre, capable of utilizing Mg2+, Ni2+, Co2+, Mn2+, Zn2+ and Ca2+ in catalytic pathways (Pommer et al., 1998; 2001; Ku et al., 2002; van den Bremer et al., 2004; Stoddard, 2005). The Mg2+ ions were shown to be preferred ions for catalysis of dsDNA cleavage by colicin nuclease domains, whereas Ni2+ yielded the highest activity toward single-stranded DNA. Interestingly, a recent analysis of four bacterial colicins has pointed out the differences in conformational and functional properties (van den Bremer et al., 2004), despite their high sequence identity (~70% identity of amino acid sequences and >80% identity of the active site clefts). Hence, the question of the roles that different metal ions perform in the active sites of ‘ββα-metal’ nucleases still remains obscure.

A mutational analysis of MnlI has shown that its C-terminal part contains an active site highly similar to those of bacterial colicin ColE7 and ColE9 nucleases

36

(Section 1). Therefore, it was interesting to clarify metal-dependence features that may have been inherited by MnlI from its C-terminal nuclease domain.

To characterize the activity of MnlI and its C-II domain in the presence of a single metal ion, preparation of the divalent metal-free proteins was carried out (Materials and Methods). It was found that both apo-enzymes completely lost their enzymatic activities. However, the addition of different metal ions into the assay system re-activated the proteins to various degrees (Fig. 14). The relative order of non-specific endonuclease activity of C-II at 1 mM metal ion concentration was found to be Ni2+ > Mn2+ = Co2+ > Mg2+ ≥ Ca2+> Zn2+ (Fig. 14A). 50-100 μM concentrations of Ni2+, Co2+, Zn2+ and Mn2+ were sufficient to render the C-II domain active, whereas Mg2+ and Ca2+ were required in higher concentrations, with an optimal effect on activity at 1 mM. The fact that such a variety of metal ions can function as cofactors to activate the C-II domain is consistent with studies on colicin ColE7 and ColE9 (Pommer et al., 1998; Pommer et al., 1999; Pommer et al., 2001; Ku et al., 2002). Similarly, higher Mg2+ concentration is required for optimal activity than that required in the presence of Ni2+ (in μM range).

Fig. 14. Effect of different divalent metal ions on the activity of MnlI (B) and its C-terminal domain C-II (A) (Kriukiene, 2006). Cleavage reactions were carried out in the presence of various amounts (10 μM – 5 mM) of Mg2+, Ca2+, Ni2+, Mn2+, Co2+, and Zn2+, or without any metal ion (-Me). The concentrations (mM) of divalent metal ions are indicated above each lane. C- control line containing the dsDNA substrate incubated only with reaction Buffer G. S, O and L – supercoiled, open-circle and linear forms of the pUC19 substrate, respectively. M, GeneRuler DNA Ladder Mix.

37

The most controversial ion in the investigation of colicins is Zn2+. Its ability to fulfill the catalytic role is still a matter of debate. Ku et al. (2002) have reported that the E7 DNase is a zinc-dependent enzyme. By contrast, Zn2+-dependence studies on other colicins (E2, E8 and E9) did not result in activity for any of these DNases (Pommer et al., 1998; Pommer et al., 1999; van den Bremer et al., 2004). ColE7 nuclease was most active in a low Zn2+ concentration range (in nM-μM), with a higher concentration tending to be inhibitory. When the molar ratio of zinc ions to the enzyme reached >1000-fold, the zinc ions started to inhibit DNase activity, and at ~105-fold excess over ColE7, the zinc completely inhibited the ColE7 DNase (Ku et al., 2002). The present assay demonstrated activation of apo-C-II by the addition of 50-100 μM of Zn2+ (Fig. 14A). However, a concentration of Zn2+ above 100 μM started to suppress the Zn2+-dependent reaction of C-II, reaching complete inhibition of activity at 5 mM of Zn2+ (the molar ratio of Zn2+ to C-II is 106). Thus, like ColE7, the C-II domain is active in the presence of a low level of Zn2+ ions.

The activity profile of apo-MnlI at various concentrations of divalent metal ions (Fig. 14B) appeared to be nearly identical to that of C-II. The most striking feature of this experiment was the different relative order of activity, in comparison to that of C-II. At 1 mM of metal ion alone the order of activity was Mg2+ > Ni2+ = Co2+ > Mn2+ > Ca2+> Zn2+. These results suggested that the enzyme is optimally active with magnesium. Additionally, the introduction of different metal ions at a 10 μM concentration induced the slight activity of MnlI only in the case of Mg2+. This result can be supported by the data presented in Fig. 14A, where 10 μM Mg2+ was able to induce the slight nicking activity of the C-II domain. As in the reactions with C-II, the addition of 50–100 μM Zn2+ resulted in an initial enhancement of MnlI followed by an inhibition of the enzyme with increasing amounts of the ion. It should be noted that Zn2+ ions did not affect DNA binding properties of apo-MnlI (data not shown).

In Section 1.3.3., it has been demonstrated that the HNH-type active site of MnlI is responsible for a weak endonuclease activity toward ssDNA. With regard to this unique activity of MnlI, it has been reported that colicin nucleases show the same behavior in the presence of some transition metal ions (Pommet et al., 2001; van den Heuvel et al., 2005). To further address the question of whether this activity of MnlI was acquired from the colicin-like nuclease domain, cleavage of the ssDNA substrate S-27 by the C-II domain and its dependency on various metals was tested (Fig. 15). The cleavage pattern of the ssDNA fragment S-27 had been determined before: MnlI cut it at 15 nt and 22 nt nucleotides (See Section 1.3.3.). Therefore, this fragment was chosen to compare the sequence selectivity of C-II with that displayed by MnlI.

Identical digestion patterns were observed in a 18-hour incubation, indicating the same sequence selectivity of both MnlI and its C-terminal domain, although the activity of MnlI was less pronounced (Fig. 15). The C-II domain exhibited endonuclease activity at 100 μM concentration of each metal ion, in the order of Ni2+ = Mn2+ > Mg2+ >Zn2+ > Ca2+. The relative order obtained with MnlI showed similar reactivity, except that Mg2+ and Ca2+ were not able to activate MnlI to the same

38

extent. The cleavage results are in line with data on colicin ColE9 (Pommer et al., 2001) and ColE7 (van den Heuvel et al., 2005), indicating that the highest activity of MnlI as well as colicin nucleases toward ssDNA is associated with Ni2+, and only a weak activity is displayed with Mg2+. Again, like ColE7 DNase (van den Heuvel et al., 2005), both MnlI and its C-terminal domain cleaved ssDNA in the presence of Zn2+.

Fig. 15. Metal-dependent activity of MnlI and its domain C-II toward single-stranded oligonucleotide S-27 (Kriukiene, 2006). The reactions were carried out in Buffer G at a fixed concentration (100 μM) of different metal ions Mg2+, Ni2+, Mn2+, Zn2+, Ca2+, or without any metal ion (-Me2+). The mixtures containing 5.6 μM S-27 and either 4 μM MnlI (monomer) or 80 nM C-II were incubated at 37oC for 18 hours. The reaction products of S-27 hydrolysis (27-mer) are designated as 22-mer and 15-mer fragments.

The study indicated the preference for Mg2+ in the specific cleavage of dsDNA

by MnlI. In this aspect, MnlI resembles conventional Type II REases. Only a few Type II REases show DNA cleavage, when Mg2+ is substituted with some other metal ions, such as Mn2+, Co2+, or Ca2+ (Woodhead et al., 1981; Baldwin et al., 1999; Chandrashekaran et al., 2004). However, MnlI displays a unique characteristic among REases characterized to date, namely, specific cleavage with a wide range of divalent metal ions. Additionally, in contrast to other restriction endonucleases, the nucleolytic domain triggers non-specific activity of MnlI toward ssDNA. In the crystal structures of colicin nuclease domains bound to DNA (Hsia et al., 2004; Mate and Kleanthous, 2004; Doudeva et al., 2006), monomeric nucleases interact with DNA primarily via phosphate backbones, suggesting their structural basis as sugar and sequence non-specific enzymes. Indeed, bacterial colicins cleave all nucleic acids that they encounter, including dsDNA, ssDNA and RNA. The non-specific single-stranded activity of MnlI indicates that its monomeric colicin-like nuclease domain can function as a separate non-specific nuclease even though it became to be incorporated into the full-length MnlI protein.

39

Conclusively, the fact that the activity profiles of both C-II and MnlI are highly similar to that of colicin nucleases supports the proposal that a HNH-type nuclease was fused to a DNA-binding protein by exchanging of structural domains among different protein families to create the specific MnlI REase. It should be noted that the ability to utilize a wide range of metal cofactors for cleavage of ds- and ssDNA is of great importance to the biological function of MnlI REase residing in Moraxella nonliquefaciens, a species that can cause respiratory diseases of man. This feature could be an advantage to the bacteria in the degradation process of invading foreign genomes, when competing with other bacteria for their environment.

40

CONCLUSIONS

1. The Type IIS restriction-modification system MnlI is composed of N6-methyladenine and C5-methylcytosine methyltransferases and a restriction enzyme. The methyltransferases modify cytosine and adenine on the opposite strands of the recognition sequence, resulting in 5’-m5CCTC-3’/5’-Gm6AGG-3’. The MnlI restriction endonuclease cleaves both DNA strands 7/6 nucleotides downstream of the recognition site.

2. The active site of MnlI REase resembles those of the bacterial colicin DNases ColE7 and ColE9, which belong to the HNH superfamily of nucleases. The motif 306Rx3ExHHx14Nx8H located in the C-terminal part of the protein comprises the active site of MnlI.

3. MnlI is a homodimeric protein capable of binding two copies of its recognition sequence. Simultaneous binding of two DNA target sites stimulates DNA cleavage by MnlI.

4. A two-domain structure of the Type IIS restriction endonuclease MnlI has been identified by limited proteolysis. An N-terminal domain of the enzyme mediates the sequence-specific interaction with DNA and in part the dimerization of MnlI. It binds the recognition sequence as a monomer, though it displays an ability to interact with two copies of the recognition sequence as a dimer. A C-terminal domain of MnlI is determined to be monomeric in solution.

5. The C-terminal domain of MnlI REase resembles bacterial colicin nucleases in its oligomeric state and requirement for alkaline earth as well as transition metal ions for double- and single-stranded DNA cleavage activities.

6. The fusion of the non-specific HNH-type nuclease to the DNA binding domain had transformed MnlI into a Mg2+-, Ni2+-, Co2+-, Mn2+-, Zn2+-, Ca2+-dependent sequence-specific enzyme. Nevertheless, MnlI retains a residual single-stranded DNA cleavage activity controlled by its C-terminal colicin-like nuclease domain. The cleavage of ds- and ssDNA by MnlI with a wide range of divalent metal ions is unparalleled among restriction endonucleases characterized to date.

41

LIST OF PUBLICATIONS The thesis is based on the following original publications:

1. Kriukienė E., Lubienė J., Lagunavičius A., Lubys A. (2005). MnlI-The member of H-N-H subtype of Type IIS restriction endonucleases. Biochim. Biophys. Acta 1751, 194-204.

2. Kriukienė E. (2006). Domain organization and metal ion requirement of

the type IIS restriction endonuclease MnlI. FEBS Letters 580, 6115-6122.

Other publications:

1. Jurėnaitė-Urbanavičienė S., Šerkšnaitė J., Kriukienė E., Giedrienė J., Venclovas Č., Lubys A. (2007). Generation of DNA cleavage specificities of type II restriction endonucleases by reassortment of target recognition domains. Proc. Natl. Acad. Sci. USA 104, 10358-10363.

2. Kriukienė E., Lubys A. (1998). Comparison of two restriction-

modification systems recognizing the same GGATCC sequence. Biologija 1, 55-59.

3. Kriukienė E., Lubys A. (1998). Cloning and analysis of DNA regions

adjacent to methyltransferase Lsp1109I of restriction-modification system Lsp1109I, type IIS. Biologija 2, 62-65.

42

ACKNOWLEDGEMENTS

The presented work was carried out at the Institute of Biotechnology and was in part supported by the Lithuanian State Science and Studies Foundation and contracts with Fermentas UAB.

I would like to thank Dr. Arvydas Lubys for discussions and help with the preparation of this doctoral thesis.

I wish to express my appreciation to Dr. Arūnas Lagunavičius (Fermentas UAB) for the discovery of the HNH motif in the MnlI protein sequence that induced further work described in the dissertation and for invaluable discussions and comments.

My special thanks to Prof. Dr. Joachim W. Engels and his group (Johann W. Goethe-University, Frankfurt) for MALDI-MS measurements, J. Giedrienė (Institute of Biotechnology) for purification of the MnlI mutants and the N- terminal domain of MnlI.

I am obliged to Fermentas UAB for providing wt MnlI preparations, other enzymes and kits and access to laboratory equipment.

My greatest gratitude belongs to my family for sustained support and understanding. CURRICULUM VITAE Name: Edita Kriukienė Date of birth: 15.08.1972 Address: Laboratory of Prokaryote gene engineering Institute of Biotechnology Graičiūno 8, Vilnius LT-02441, Lithuania Phone: +370 5 2602698 E-mail: ediga@ibt.lt Education: 1994 B. Sc., Biochemistry, Vilnius University 1996 M. Sc., Biochemistry, Vilnius University Employment: at the Laboratory of Prokaryote gene engineering, Institute of Biotechnology 2002-present Junior scientist 1998-2001 Ph. D. student in Biochemistry 1996-1997 Junior scientist

43

REZIUMĖ

Savo unikalaus gebėjimo specifiškai atpažinti trumpus (4-8 bp) taikinius DNR grandinėje ir kirpti ją fiksuotoje padėtyje taikinio viduje arba už jo dėka II tipo restrikcijos endonukleazės (REazės) buvo pritaikytos DNR manipuliacijoms in vitro, kas paskatino genų inžinerijos metodų išplėtojimą.

II REazių tipo IIS potipiui priklausančios restrikcijos endonukleazės atpažįsta asimetrines DNR sekas ir bent vieną DNR grandinę kerpa už atpažįstamos sekos. Abi DNR grandines už taikinio karpančioms šios grupės REazėms būdinga domeninė struktūra: šie fermentai susideda iš dviejų - DNR atpažįstančio ir DNR hidrolizę vykdančio – domenų (Pingoud et al., 2005). Kadangi DNR atpažinimo bei hidrolizės determinantės yra lokalizuotos skirtinguose baltymo domenuose, IIS REazės yra patogus modelis tiriant baltymų struktūros ir funkcijos ryšius bei nagrinėjant funkciškai susijusių baltymų grupių evoliucinius aspektus. Domenine organizacija pasižymi ir dvi geriausiai ištyrinėtos IIS potipio REazės - FokI (Li et al., 1992; Wah et al., 1997; Vanamee et al., 2001) ir BfiI (Lagunavicius et al., 2003; Zaremba et al., 2004; Grazulis et al., 2005). Archetipinė IIS REazė FokI, kaip ir dauguma II tipo REazių, turi PD-D/ExK aminorūgščių motyvą, sudarantį fermento katalizės ir Mg2+ kofaktoriaus surišimo centrą (Pingoud et al., 2005). Tik 2000 m. Biotechnologijos instituto darbuotojų paskelbtas mokslinis straipsnis (Sapranauskas et al., 2000) pristatė pirmą restrikcijos fermentą, BfiI REazę, kurios aktyvus centras skiriasi nuo aukščiau paminėtos katalitinio centro struktūros, ir yra panašus į Fosfolipazės D šeimai priklausančios nukleazės Nuc aktyvų centrą. Detalūs IIS REazės BfiI struktūriniai ir biocheminiai tyrimai paneigė ankstesnę nuostatą, teigiančią, kad restrikcijos endonukleazės kilo iš vieno struktūrinio protėvio, bei kartu pademonstravo, kad šių baltymų evoliucija galėjo vykti susiliejant specifinę DNR seką atpažįstantiems baltymams su skirtingos kilmės nespecifinėmis nukleazėmis. Taigi, atsižvelgiant į aktyvaus centro struktūrą bei reakcijos mechanizmą minėtos FokI ir BfiI REazės atstovauja du skirtingus IIS potipio fermentų pogrupius – atitinkamai PD-D/ExK ir Fosfolipazės D.

Biotechnologijos instituto Prokariotų genų inžinerijos laboratorijoje iš Moraxella nonliquefaciens kamieno buvo klonuota ir charakterizuota IIS potipio restrikcijos-modifikacijos sistema MnlI. Ši sistema yra sudaryta iš 5-metilcitozininės bei N6-metiladenininės metiltransferazių, modifikuojančių atpažįstamą DNR seką 5’-m5CCTC-3’/5’-Gm6AGG-3’ nurodytose pozicijose, bei MnlI REazės, kerpančios abi DNR grandines 7/6 nt atstumu už atpažįstamos DNR sekos. MnlI restrikcijos endonukleazės baltymo sekos analizė bei mutagenezės darbai parodė, kad MnlI aktyvų centrą sudaro aminorūgščių motyvas 306Rx3ExHHx14Nx8H. Savo sudėtimi jis yra artimas HNH šeimos baltymų - E. coli baktericidinių agentų kolicinų ColE7 ir ColE9 - DNR hidrolizuojančių domenų aktyvių centrų motyvams (Kleanthous et al., 1999; Ko et al., 1999). Be to, MnlI REazė pasižymi ir kita kolicinams būdinga savybe - nespecifišku viengrandės DNR karpymu, esant įvairiems metalo jonų kofaktoriams. Šie duomenys leido teigti, kad MnlI skiriasi nuo Fosfolipazės D ir PD-D/ExK grupių

44

narių ir atstovauja naują IIS potipio REazių grupę – HNH. Savo aktyvaus centro struktūra bei spėjamu reakcijos mechanizmu MnlI restrikcijos fermentas yra artimas „HNH homing“ endonukleazių ir bakterinių kolicinų šeimai bei kartu didesnei šias grupes apjungiančiai „ββα-Me“ nukleazių šeimai (Kuhlmann et al., 1999).

Visos detaliai ištirtos IIS potipio REazės, karpančios DNR už atpažįstamos sekos, dvi DNR grandines hidrolizuoja dimerinėje baltymo būsenoje. Kiekvienas dimerinio baltymo subvienetas yra sudarytas iš dviejų – atpažinimo ir katalizės – domenų. Taigi, dimerinis baltymas turi du DNR atpažinimo domenus, kurie gali rištis su dviem atpažįstamos DNR sekos kopijomis. Dalies IIS potipio fermentų DNR kirpimo tyrimai parodė, kad dauguma šios grupės REazių žymiai efektyviau hidrolizuoja DNR, kai vienu metu suriša dvi specifines DNR (Bath et al., 2002). IIS grupės restrikcijos endonukleazė MnlI yra homodimeras. MnlI REazės komplekso su DNR tyrimai pademonstravo šio fermento gebėjimą vienu metu sąveikauti su dviem specifinės DNR molekulėmis. DNR fragmento hidrolizės MnlI REaze eksperimentai, vykdyti sąlygomis, kai MnlI turėtų būti susirišęs su dviem atpažįstamos DNR sekos kopijomis, parodė greitesnį šiomis sąlygomis atliekamą DNR substrato karpymą. Taigi, MnlI galima priskirti aukščiau paminėtai IIS REazių grupei, kurios nariams efektyviai DNR hidrolizei yra būtina suformuoti sinaptinį kompleksą. Dalinės MnlI proteolizės būdu buvo nustatyta di-domeninė MnlI sandara. N-galinis MnlI domenas yra atsakingas už kontaktų su atpažįstama DNR seka suformavimą, o C-galinis domenas vykdo katalitinę fermento reakciją. Skirtingai nuo kitų charakterizuotų IIS potipio REazių (FokI, BfiI), kurios dimerizuojasi nukleolitiniais domenais, MnlI nukleazinis domenas C-II tirpale yra monomerinis, tuo tarpu už kontaktų su DNR suformavimą atsakingas domenas N-II sudaro du specifinius kompleksus su DNR. Nors vyraujančiame komplekse N-II monomeras riša vieną atpažįstamos DNR sekos kopiją, šis domenas geba formuoti aukštesnės oligomerinės būsenos kompleksą, kuriame N-II dimeras vienu metu sujungia dvi specifinės DNR molekules. Taigi, už MnlI REazės dviejų DNR taikinių surišimą yra atsakingi du MnlI homodimere esantys specifinę DNR atpažįstantys domenai.

MnlI REazė savo HNH tipo aktyvaus centro aminorūgščių sudėtimi, kofaktorių bei DNR substratų poreikiais yra labiausiai gimininga DNR specifiškiems kolicinams. Specifinėje DNR hidrolizėje MnlI teikia pirmenybę Mg2+ jonams. Šiuo aspektu ji elgiasi kaip įprastinė II tipo restrikcijos endonukleazė. Tačiau MnlI REazė gali būti aktyvuojama įvairiais dvivalenčių metalų jonais - Mg2+, Ni2+, Mn2+, Co2+, Ca2+ ar Zn2+. MnlI tyrimai parodė, kad šiuos neįprastus REazės kofaktorių poreikius lemia kolicinų tipo MnlI nukleazinis domenas. Be to, nukleazinis domenas MnlI fermentui suteikė ir unikalią REazių tarpe savybę - viengrandės DNR nespecifinio skaldymo funkciją. MnlI ir C-II domeno viengrandės DNR karpymo funkcijos palyginimas parodė, kad, net ir esantis MnlI baltymo sudėtyje, t.y. susijungęs su DNR atpažinimo domenu, MnlI nukleazinis domenas gali funkcionuoti kaip nepriklausoma nespecifinė nukleazė. Šios savybės rodo, kad specifiškai DNR skaldančios MnlI restrikcijos endonukleazės evoliucija galėjo vykti, susiliejant HNH prigimties nespecifinei nukleazei su DNR sekai specifišku baltymu.

45