Validation studies of Real Time Validation studies of Real Time PCR protocols for PCR protocols for

Salmonella and Listeria Salmonella and Listeria Salmonella and Listeria Salmonella and Listeria monocytogenes monocytogenes

7th BASELINE meeting. Brussels 17-18th October 2012

Components of a microbiological criterion (Codex)

• Micro-organism of concern• Analytical method• Sampling plan• Microbiological limits• The food-stuff

Task 7.3 and Task 7.5

Task 7.4 and Task

2

• The food-stuff• The point of the food chain

where the limit applies• Actions to be taken when

unsatisfactory• Results

Task 7.4 and Task 7.5

3

Background

Testing against criteria

Food Business Operators (Reg 2073/2005)For validation and verification of proceduresbased on HACCP and GHPFor batch acceptability testing during the storage life

4

For batch acceptability testing during the storage life (PO)

Competent Authorities (Reg 882/2004 onofficial controls)To verify that food is in compliance with the Community criteria during the entire shelf life (FSO)

Classical Cultural Methods

• No expensive infrastructure • Cheap in consumables• Cheap equipments

5

• Laborious to perform• Large volumes of materials• Time consuming

• rapid methods replaced “alternative methods”.

• Rapid =– a shorter time to detection– better flow through– automation

Alternative method or rapid methods

6

– automation

Based on “Golden standard”:a “rapid method” can be defined as any method or system that reduces the time taken to obtain a microbiological test result(Feng, 1996; Fung, 1994)

Rapid (Alternative) methods

Advantages for Food Business Operators:• Rapid corrective measures and actions • Possible to verify the efficency of the GHP and HACCP

Results available more rapidly than by using classical cultural methods

7

Advantages for Competent Authorities:• More rapid management of emergency situation and crisis• Evaluate microbiological hazard prevalence/concentration

in a specific commodity (large monitoring), in order to evaluate the risk for the population

The use of alternative analytical methods is acceptable when the methods are:

• validated against the reference method

Alternative method in Regulation EC 2073/2005 on microbiological criteria

8

• if a proprietary method, certified by a third party in accordance with the protocol set out in EN/ISO standard 16140 or other internationally accepted protocols, is used.

Proprietary Methods

Validation bodies

• AFNOR (Association Français deNormalisation, France)

• NordVal (part of the Nordic Committeeon Food Analysis, Norway)

• MicroVal (European Validation andCertification Organisation, Europe)

9

Certification Organisation, Europe)

• AOAC (Association of Official AnalyticalChemist, USA)

Validation certificates of AFNOR, NordVal and MicroVal are based on ISO 16140• AOAC ~ ISO 16140

ISO for molecular methods

Standard reference Title Status

EN ISO 20837:2006Microbiology of food and animal feeding stuffs - Polymerase chain reaction (PCR) for the detection of food-

borne pathogens - Requirements for sample preparation for qualitative detection published

EN ISO 20838:2006Microbiology of food and animal feeding stuffs - Polymerase chain reaction (PCR) for the detection of food-

borne pathogens - Requirements for amplification and detection for qualitative methods published

EN ISO 22118:2011Microbiology of food and animal feeding stuffs - Polymerase chain reaction (PCR) for the detection and

quantification of food-borne pathogens - Performance characteristics published

EN ISO 22119:2011Microbiology of food and animal feeding stuffs - Real-time polymerase chain reaction (PCR) for the detection

of food-borne pathogens - General requirements and definitions published

EN ISO 22174:2005Microbiology of food and animal feeding stuffs - Polymerase chain reaction (PCR) for the detection of food-

publishedEN ISO 22174:2005Microbiology of food and animal feeding stuffs - Polymerase chain reaction (PCR) for the detection of food-

borne pathogens - General requirements and definitions published

CEN ISO/TS 13136:2012

Microbiology of food and animal feed - Real-time polymerase chain reaction (PCR)-based method for the

detection of food-borne pathogens - Horizontal method for the detection of Shiga toxin-producing

Escherichia coli (STEC) and the determination of O157, O111, O26, O103 and O145 serogroups

published

ISO/TS 15216-1Microbiology of food and animal feeding stuffs- Horizontal method for detection of hepatitis A virus and

norovirus in food using real-time RT-PCR- Part 1: Method for quantitative determinationpublished

ISO/TS 15216 -2Microbiology of food and animal feeding stuffs- Horizontal method for detection of hepatitis A virus and

norovirus in food using real-time RT-PCR- Part 2: Method for qualitative determinationpublished

ISO/PDTS WI 00275221

“Microbiology of food, feeding stuffs and environmental samples — Polymerase chain reaction (PCR) for the

detection of food-borne pathogens — Detection of botulinum type A, B, E and F neurotoxin producing

clostridia”

draft

“General requirements relating to molecular methods for detection and quantification of

microorganisms” - Draft standard of PCR detection of enteropathogenic Yersinia spp.in discussion

Microbiology of food and animal feeding stuffs - Detection of Vibrio parahaemolyticus in seafoods: Part 1 -

Quantitative determination of total, thermostable direct haemolysin (TDH) and thermostable direct-related

haemolysin (TRH) positive Vibrio parahaemolyticus using nucleic acid hybridisation

in discussion

Revision of EN ISO 16140

PG 1: TerminologyPG 2: Proprietary methodsPG 3: Intermediate validationPG 4: Method verification

11

PG 5: In house method validationPG 6: Technical requirements for the establishment/revision of standardised methods

Revision of EN ISO 16140

PG 1: TerminologyPG 2: Proprietary methodsPG 3: Intermediate validationPG 4: Method verification

12

PG 5: In house method validationPG 6: Technical requirements for the establishment/revision of standardised methods

Intermediate validation (non proprietary methods)

First Draft text EN ISO 16140-1 - Terminology of Met hod Validation ”

Intermediate validation A validation study including an inter-laboratory study with a limited number of participating laboratories

NOTE

13

NOTE This type of validation study is restricted to non-proprietary methods. It is applicable when the method of analysis deals with a complex methodology or with an analyte for which only a restricted number of laboratories have the competence and the infrastructure to participate in a validation study.

Since the validation process has high costs, the laboratories involved should be preferably reduced

Validation (proprietary methods)

EN ISO 16140

Interlaboratory study organisation

• At least valid data from 10 laboratories

• 3 levels of contamination

• 8 replicates per level

14

1. Abdulmawjood, A., Bulte, M., Cook, N., Roth, S., Schonenbrucher, H. and Hoorfar, J. (2003) Toward an international standard for PCR-based detection of Escherichia coli O157. Part 1. Assay development and multi-center validation. J Microbiol Methods 55, 775-786.

2. Lubeck, P.S., Cook, N., Wagner, M., Fach, P. and Hoorfar, J. (2003) Toward an international standard for PCR-based detection of food-borne thermotolerantCampylobacters: validation in a multicenter collaborative trial. Appl Environ Microbiol 69, 5670-5672.

3. Malorny, B., N. Cook, M. D'Agostino, D. De Medici, L. Croci, A. Abdulmawjood, P. Fach, R. Karpiskova, T. Aymerich, K. Kwaitek and J. Hoorfar (2004). “Multicenter validation of PCR-based method for detection of Salmonella in chicken and pig samples.” J AOAC Int 87(4): 861-6.

4. Fenicia, L., Fach, P., van Rotterdam, B.J., Anniballi, F., Segerman, B., Auricchio, B., Delibato, E., Hamidjaja, R.A., Wielinga, P.R., Woudstra, C., Agren, J., De Medici, D. and Knutsson, R. (2011) Towards an international standard for detection and typing botulinum

PC

REuropean ring trial

15

Knutsson, R. (2011) Towards an international standard for detection and typing botulinumneurotoxin-producing Clostridia types A, B, E and F in food, feed and environmentalsamples: a European ring trial study to evaluate a real-time PCR assay. Int J Food Microbiol 145 Suppl 1, S152-157.

5. Fach, P., Fenicia, L., Knutsson, R., Wielinga, P.R., Anniballi, F., Delibato, E., Auricchio, B., Woudstra, C., Agren, J., Segerman, B., de Medici, D. and van Rotterdam, B.J. (2011) An innovative molecular detection tool for tracking and tracing Clostridium botulinum types A, B, E, F and other botulinum neurotoxin producing Clostridia based on the GeneDisc cycler. Int J Food Microbiol 145 Suppl 1, S145-151.

6. D’Agostino, M., Cook, C., Di Bartolo, I., Ruggeri, F.M. Martelli, F., Banks, M., Vasickova, P., Kralik, P., Pavlik, I., Kokkinos, P., Vantarakis, A., Söderberg, K., Maunula, L., Verhaelen, K., Rutjes, S., de Roda Husman, A.M., Hakze, R., Van der Poel, W., Kozyra, I., Rzezutka, A., Prodanov, J., Lazic, S., Petrovic, T., Carratala, A., Gironés, R., Diez-Valcarce, M., Hernandez, M., Rodriguez-Lazaro, D. (2011) Multicenter collaborative trial evaluation of a method for detection of human adenoviruses in berry fruit. Food Analytical methods. In press. DOI 10.1007/s12161-011-9287-0

Rea

l –T

ime

PC

R

4- 10 partners

Validation procedures and CEN

16

Baseline Approach to new /alternative methods: parameters considered in the evaluation of alternative methods

• Test portion (Analytical portion): increase the amount of the Test portion in order to enhance the Limit Of Detection (x/25g; 2x/50g, etc.)

• (pre)-enrichment: reduction of volume for expensive media in order to reduce cost for analysis

17

media in order to reduce cost for analysis

• time of incubation: reduction of time in order to increase the speed of analysis

• Evaluation pre-PCR processing step, including sample preparation and nucleic acid extraction

VALIDATION STRATEGYPRE-VALIDATION EVALUATION

Objective: Define the best conditions for alternative tests co mpatible with ISO standards for detection of Listeria monocytogenes and Salmonella spp.

Prerequisites: Prerequisites: • Rapid protocol (next-day results)

• As easy and simple as possible (easy to be implemented in a routine lab)

• Compatible with ISO standard (i.e. the ISO standard must be continued

once the results are obtained by the alternative methods)

• Not too expensive (similar price as standard)

Approach: • Use the same enrichment broths (Half-Fraser for L. monocytogenes,

BPW for Salmonella spp.)

• Evaluate several strategies for reduction of time f or final

Validation Strategy:Pre-Validation Evaluation for Listeria and Salmonell a

results:

� Reduce the time of incubation

� Use of easy and simple bacterial DNA extraction pro tocols

� Use real-time PCR assays for detection

Parameters to evaluate:

� Size of sample (25 g or 50 g)

� Dilution of the sample (1:3, 1:5 or 1:10)

Validation Strategy Pre-ValidationEvaluation for Listeria and Salmonella

� Dilution of the sample (1:3, 1:5 or 1:10)

� Incubation time (i.e. 5, 8-10 or 18-24 hours of (pre)-enrichment)

� Bacterial DNA extraction protocol (boiling, resin protocol, or commercial

column-based kit)

Listeria monoctyogenes1-10 ufc

10-100 ufc

(100-1000 ufc)

25 g

50 g

ISO

Dilutions: 1:3

1:5

Listeria

monoctyogenes

VALIDATION STRATEGYEVALUATION APPROACH

50 g1:5

1:10

Incubation:

8 h

18 h

24 hDNA extraction:

Boiling

Chelex

Column

monoctyogenes

VALIDATION STRATEGYDIAGRAM

DilutionIncubation

timesISO

Baseline

QIAGEN

Baseline

CHELEX

Baseline

BOILING

1 cfu /

sample1:3

8 h 3/3 1/3 0/3 0/3

18 h 3/3 1/3 0/3 0/3

24 h 3/3 3/3 1/3 0/3

VALIDATION STRATEGYPRE-VALIDATION EVALUATION RESULTS

1:5

8 h 3/3 0/3 0/3 0/3

18 h 3/3 2/3 0/3 0/3

24 h 3/3 2/3 1/3 0/3

1:10

8 h 3/3 0/3 0/3 0/3

18 h 3/3 0/3 1/3 0/3

24 h 3/3 3/3 0/3 0/3✔

1:10 Half Fraser

(ISO)

Incubation 24 h

Validation StrategyFinal protocol: Listeria monocytogenes in Cheese

Listeria monoctyogenes

DNA extraction: QIAGEN column

Real-time PCRRodríguez Lázaro et al (2004) Appl. Environ. Microbiol.

ISS Strains

1-1010-100

3.4 cfu/g

0.34 cfu/g

5 hours1°

detection18 hours3 a.m.

2°detection

3 hours 3°detection

After 24 hours

ISO method Real-Time PCR

CFUL. monocytogenes/samples

Dilution Rate*

pre-enrichment

(HFB)hours

Numbers of replicates

Positive samples

Positive samples

hly system(FAM)

Ct±SD

IAC system(HEX)

Ct±SD

1-10 CFU

(0.34 CFU/g)

25g + 50mL

5h 5 2 0 - 32.92±1.25

8h 5 5 0 - 33.00±0.48

24h 5 5 5 35.91±0.67 32.61±1.46

25g + 100mL

5h 5 2 0 - 32.55±0.79

8h 5 5 0 - 32.12±0.90

24h 5 5 5 29.59±0.66 32.89±1.10

25g + 225mL

5h 5 2 0 - 32.86±1.10

8h 5 5 0 - 33.51±0.5825g + 225mL 8h 5 5 0 - 33.51±0.58

24h 5 5 5 29.16±0.91 32,17±0.64

10-100 CFU

(3.4 CFU/g)

25g + 50mL

5h 5 2 0 - 33.28±0.84

8h 5 5 0 - 33.63±0.71

24h 5 5 5 31.26±0.31 32,70±1.83

25g + 100mL

5h 5 2 0 - 33.30±0.42

8h 5 5 0 - 33.32±0.70

24h 5 5 5 26.61±0.37 32,46±1.43

25g + 225mL

5h 5 2 0 - 33.10±0.63

8h 5 5 0 - 33.62±1.03

24h 5 5 5 25.38±0.16 32.86±1.40

Reduction of volume for expensive media order to reduce cost for analysis

No differences were found when we use 100 or 225 ml of Half Frazer with 25 g of sample after 24 hours of pre-enrichment in Real Time PCR

Real Time PCR positive after 24 hours pre-emrichment in HFAfter 5 and 8 hours of pre-enrichment in HF all the samples were negative

28

Salmonella spp.

1-10 ufc

10-100 ufc

100-1000 ufc

25 g

50 g

VALIDATION STRATEGYEVALUATION APPROACH

Incubation:

6 h

10 h

DNA extraction:

Boiling

Chelex

Column

10 h

24 h

DilutionIncubation

timesISO

Baseline

QIAGEN

Baseline

CHELEX

Baseline

BOILING

1 cfu /

sample1:10

6 h 3/3 1/3 1/3 0/3

10 h 3/3 3/3 3/3 3/3

24 h 3/3 3/3 3/3 3/3 ✔

VALIDATION STRATEGYEVALUATION APPROACH

DilutionIncubation

timesISO

Baseline

QIAGEN

Baseline

CHELEX

Baseline

BOILING

1 cfu /

sample1:10

6 h 3/3 1/3 1/3 0/3

10 h 3/3 3/3 3/3 3/3

24 h 3/3 3/3 3/3 3/3

Salmonella spp.(it is possible also use 50 g)

Dilution 1:10 Buffered Peptone Water

(ISO)

VALIDATED STRATEGY FOR SALMONELLA

Incubation 24 h (it is possible at 10 h, but better

Ct values after 24 h)

DNA extraction: Chelex

Real-time PCRJosefsen MH, et. al (2007). AEM 73:3040-3048.

Malorny B, et al (2004) AEM. 70:7046-7052.

Protocols

32

Preparation of spiked samples for Ring Trial

SalmonellaListeria monocytogenes

33

Lenticules Lyophilized strains

Ring trialLaboratories Salmonella

Listeria

monocytogenesCountry

Accredited

17025

Università di Bologna X X Italy

National Veterinary Institute X X Norway Yes

Centro National de Tecnologia y

Seguridad AlimentariaX X Spain Yes

National Food Chain Safety Office X X Hungary Yes

Istituto Superiore di Sanità X X Italy Yes

University of Zagreb X X Croatia

Istituto Tecnologico Agrario de Castilla

y LeonX X Spain

y LeonX X Spain

University of Copenhagen X X Denmark

Agence nationale de sécurité sanitaire

de l’alimentation, de l’environnement et

du travail

X France Yes

IZS Venezie X X Italy Yes

IZS Lazio e Toscana X X Italy Yes

IZS Lombardia e Emilia Romagna X X Italy Yes

IZS Meridione X Italy Yes

IZS Abruzzo e Molise X Italy Yes

NRL

Real Time PCR – Listeria

Designation Sequence 5’-3’

ttr-6 (forward) CTCACCAGGAGATTACAACATGG

ttr-4 (reverse) AGCTCAGACCAAAAGTGACCATC

ttr-5 (LNA target probe) 6-FAM–CG+ACGGCG+AG+ACCG-BHQ1

IAC Probe HEX-CACACGGCGACGCGAACGCTTT-BHQ1

IAC sequence GACTCACCAGGAGATTACAACATGGCTCTTGCTGTGCATCATCGCAGAACATCAAAGCGTTCGCGTCGCCGTGTGGGATGGTC

ACTTTTGGTCTGAGCTAC

Table.1 Sequences of primer/probes and IAC

Step Parameter Temp. Time Fluorescence Cycles

Duplex Real Time PCR: Set the real-time PCR instrument for the simultaneous detection of FAM and HEX fluorophores in the same real-time PCR reaction well.

Step Parameter Temp. Time Fluorescence

measurement

Cycles

1 Initial denaturation 95°C 15 min No 1

2 Amplification Denaturation 95°C 30 s No

40Annealing 65°C 60 s Yes

Extension 72°C 30 s No

Ring Trial Listeria

Pork loin was aseptically removed in a slaughtering; the meat was stored for ageing for three days at 4°C. 325 samples of 25-g were prepared used ageing pork loin. Each sample was used for artificially contaminated..

The contamination of the pork samples were performed using commercial lenticules.

Partecipants: 13 laboratories

36

lenticules.The contamination was performed using three different blinded contamination levels of lenticules:L0 = negative control L1 = lenticules contaminated with 10-20 CFU (0.4-0.8 CFU/g of pork meat) of Salmonella Typhimurium NCTC 12023 (HPA, Salisbury, UK)L2 = lenticules contaminated with 20-160 CFU (0.8- 6.4 CFU/g) of Salmonella Typhimurium NCTC 12023 (Oxoid, Milan, Italy)

Platform

37

6 4 2 1

13

Results

We considered negative all the samples produced Ct >35

All the Laboratories detected correctly all the positive samples using ISO 6579 and Real Time PCR method (only in some cases one of the three replicates were negative)

Definition of positive samples: CT ≤35 in two wells out three

38

Concordance is defined as the percentage chance of finding the same results Concordance: 16 positive samples analyzed in 13 laboratories.

15 samples have a concordance of 100 %1 samples have a concordance of 92.30% (only one lab in one sample found only one well positive out three)

Salmonella IAC

Results of Salmonella Ring Trial

39

A lot of IAC negative in positive samples, probably the method does not work well in duplex using Roche (the lab has 100% of concordance with the real samples)

6 negative IAC in negative samples (presence of inhibitors) 1 in lab 3 and in lab 8, 2 in lab 7 and 9

Ring Trial Listeria monocytogenes

Worst-case scenario

Soft Cheese

� High level of natural competitive micro-flora

Participants: 12 laboratories (all labs are very expert in the detection of Listeria monocytogenes using ISO 11290-1 or/and Real Time PCR methods

40

� High level of natural competitive micro-flora� High level of amplification inhibitors (high level of fat and proteins)

The samples were spiked using a lyophilized standard containing:� an ATCC strain of Listeria monocytogenes difficult to isolate (ATCC

19111)� a strains of Listeria innocua ( with a concentration one log less

concentrate than Listeria monocytogenes)

Listeria Ring Trial

Preliminary Results

41

The labs seems have more problems with the ISO method than Real Time PCR

University of BolognaGerardo ManfredaAlessandra De CesareFrederique

National Veterinary InstituteTaran SkjeralGroJohannessen

CNTAJavier PerezMaria Jose Saiz

Hungarian Food Safety Office

AnsesLegall FrancoiseMarianne ChemmayBerthand LombardNathalie Gnanou-Besse

IZS VenezieDamiano CominMaria GrimaldiAntonia RicciAntonia Lettini

IZS Lombardia e Emilia RomagnaMarina Nadia LosioBarbara Bertasi

Acknowledgements

42

Zsuzsanna Sréterné Lancz Mészáros László

University of ZagrebLidija KozačinskiDanijela Horvatek Tomić

ITACyLDavid Rodriguez LazaroMarta Hernanez-Perez

University of CopenhagenJonh OlselDziuginta Jakociune

Barbara BertasiEnrico Pavoni

IZS Lazio e ToscanaStefano BileiPaola De SantisSarah Lovari

IZS MezzogiornoFederico CapuanoYolande Proroga

Istituto Superiore di SanitàMonica Virginia GianfranceschiElisabetta DelibatoAntonietta GattusoMichele Sonnessa

Baseline Approach to new /alternative methods

According to the advices of the project reviewers, different Baseline partners agreed that to reach a high impact of the Project results it would be very helpful to open an active collaboration with EU-RL for “Salmonella” and “Listeria monocytogenes” for the validation process.

43

In order to verify the interest of the two CRL, Baseline Scientific coordinator and WP7 coordinator send to the two CRLs an official letter describing the aims of the project and a request of collaboration in the validation activities of Baseline project.

Collaboration with EU-RL for “Salmonella” and “Listeria monocytogenes”

44