Vaccination with Proteus Toxic Agglutinin, a Hemolysin ... · PDF fileComplicated urinary...

INFECTION AND IMMUNITY, Feb. 2009, p. 632–641 Vol. 77, No. 20019-9567/09/$08.00�0 doi:10.1128/IAI.01050-08Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Vaccination with Proteus Toxic Agglutinin, a Hemolysin-IndependentCytotoxin In Vivo, Protects against Proteus mirabilis Urinary

Tract Infection�

Praveen Alamuri,1 Kathryn A. Eaton,1,2 Stephanie D. Himpsl,1Sara N. Smith,1,2 and Harry L. T. Mobley1*

Department of Microbiology and Immunology1 and Unit for Laboratory Animal Medicine,2 University of Michigan Medical School,Ann Arbor, Michigan 48109

Received 22 August 2008/Returned for modification 22 October 2008/Accepted 12 November 2008

Complicated urinary tract infections (UTI) caused by Proteus mirabilis are associated with severe pathologyin the bladder and kidney. To investigate the roles of two established cytotoxins, the HpmA hemolysin, asecreted cytotoxin, and proteus toxic agglutinin (Pta), a surface-associated cytotoxin, mutant analysis was usedin conjunction with a mouse model of ascending UTI. Inactivation of pta, but not inactivation of hpmA, resultedin significant decreases in the bacterial loads of the mutant in kidneys (P < 0.01) and spleens (P < 0.05)compared to the bacterial loads of the wild type; the 50% infective dose (ID50) of an isogenic pta mutant orhpmA pta double mutant was 100-fold higher (5 � 108 CFU) than the ID50 of parent strain HI4320 (5 � 106

CFU). Colonization by the parent strain caused severe cystitis and interstitial nephritis as determined byhistopathological examination. Mice infected with the same bacterial load of the hpmA pta double mutantshowed significantly reduced pathology (P < 0.01), suggesting that the additive effect of these two cytotoxinsis critical during Proteus infection. Since Pta is surface associated and important for the persistence of P.mirabilis in the host, it was selected as a vaccine candidate. Mice intranasally vaccinated with a site-directed(indicated by an asterisk) (S366A) mutant purified intact toxin (Pta*) or the passenger domain Pta-�*, eachindependently conjugated with cholera toxin (CT), had significantly lower bacterial counts in their kidneys(P � 0.001) and spleens (P � 0.002) than mice that received CT alone. The serum immunoglobulin G levelscorrelated with protection (P � 0.03). This is the first report describing the in vivo cytotoxicity and antigenicityof an autotransporter in P. mirabilis and its use in vaccine development.

Proteus mirabilis, an etiological agent of complicated urinarytract infections (UTI) in humans, infects individuals with long-term catheterization, elderly residents in nursing homes, or indi-viduals with postoperative wounds (35, 36). The consequences ofUTI due to P. mirabilis may include catheter obstruction due tostone formation, urolithiasis, cystitis, pyelonephritis, and bactere-mia (23, 26). Stone formation, resulting from urease-mediatedurea hydrolysis in the urinary tract, causes severe tissue necrosisand inflammation at the site of infection (8, 11). In addition, itmay also render the pathogen inaccessible to antibiotics, makinginfections difficult to treat. Thus, investigation of two importantaspects of Proteus biology is warranted. First, identifying bacterialfactors that cause cellular damage in the host would allow thepossibility of antiserum-based neutralization. Second, identifica-tion of candidate antigens could lead to the development of ef-fective vaccines against P. mirabilis. Although MR/P fimbriae andflagella are immunogenic and aid in the persistence of this patho-gen in the host (3), their phase variation and antigenic variationmay require that they be used in conjunction with other antigens(25, 40).

Apart from urease, hemolysin (HpmA) is the only otherprotein previously identified as a cytotoxin in P. mirabilis. This

pore-forming secreted cytotoxin is produced by P. mirabilisduring the mid-exponential or late exponential phase of growth(4, 13, 14, 39). Hemolysin, which is induced during swarmercell differentiation of P. mirabilis and during infection (2, 6),lyses nucleated cells and erythrocytes (32, 33); however, itsprecise contribution to virulence has not been elucidated.

Recently, we discovered a novel bifunctional autotransporter(AT), proteus toxic agglutinin (Pta), in P. mirabilis HI4320 (1).Pta is a surface-associated, calcium-dependent, alkaline proteasethat exhibits time- and dose-dependent cytotoxicity with culturedepithelial cells. P. mirabilis cytotoxicity was significantly reducedin an isogenic pta mutant in vitro, and the mutant strain was alsosignificantly outcompeted by the wild-type strain during cochal-lenge in a mouse model of Proteus UTI (1). In an unrelated study,our laboratory identified Pta independently as one of the immu-nogenic outer membrane proteins of P. mirabilis and demon-strated that Pta is expressed in vivo (27). Protease-like ATs, suchas Sat in pathogenic Escherichia coli (34) or VacA in Helicobacterpylori (5), are known to elicit cytotoxic effects in vivo. Althoughthe contribution of Pta to the pathogenesis of cystitis and pyelo-nephritis remains to be determined, in vitro studies (1) haveprovided a strong rationale to test the cytotoxicity and antigenicproperties of Pta in vivo.

In this study, we compared the levels of inflammation andhistopathology in the bladders and kidneys of mice infectedindependently with the parent strain HI4320, an isogenic ptamutant, or an hpmA mutant. We also studied the effect of anhpmA pta double mutant on the cytotoxicity of P. mirabilis both

* Corresponding author. Mailing address: Department of Microbi-ology and Immunology, University of Michigan Medical School, AnnArbor, MI 48109-0620. Phone: (734) 764-1466. Fax: (734) 763-7163.E-mail: [email protected].

� Published ahead of print on 24 November 2008.

632

on October 16, 2017 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

in vitro using cultured bladder epithelial cells and in vivo usinga mouse model of ascending UTI. We tested the efficacy of Ptaas a vaccine candidate by intranasally immunizing mice withpurified Pta or with purified Pta-� (the Pta passenger domainalone) and individually testing the abilities of these prepara-tions to protect against subsequent Proteus infection. We dem-onstrated that anti-Pta sera, obtained from immunized mice,neutralized the protease activity of Pta in vitro. To our knowl-edge, this is the first study in which the contribution of HpmAand Pta to the pathogenesis of P. mirabilis was systematicallyevaluated and the use of an AT in P. mirabilis as a vaccinecandidate antigen was tested.

MATERIALS AND METHODS

All animal studies were performed with 6- to 8-week-old female CBA/J miceobtained from Harlan Sprague-Dawley, Indianapolis, IN. Anesthetized micewere transurethrally inoculated with 50 �l of washed P. mirabilis suspended inphosphate-buffered saline (PBS) (pH 7.2). The protocols used to perform mousemodel infection studies were approved by the University of Michigan’s Univer-sity Committee on Use and Care of Animals (approval 08999) and have beendescribed previously (18).

Bacterial strains and construction of mutants. All cloning experiments wereperformed using Escherichia coli Top10. P. mirabilis HI4320, a human urinarytract isolate that is urease positive, hemolytic, motile, and fimbriated, was used asthe parent strain in this study. An isogenic Pta (pta) mutant obtained by inser-tional inactivation of the gene using a TargeTron mutagenesis kit obtained fromSigma-Aldrich (catalog no. TA0010) as described previously (1) was used. Ahemolysin (hpmA�kan) mutant was also constructed using a similar approach.Primers HpmIBS (AAAAAAGCTTATAATTATCCTTACCCTCCACAACAGTGCGCCCAGATAGGGTG), HpmEBS2 (TGAACGCAAGTTTCTAATTTCGGTTGAGGGTCGATAGAGGAAGTGTCT), and HpmEBS1d (CAGATTGTACAAATGTGGTGATAACAGATAAGTCACAACACCTAACTTACCTTTCTTTGT) were designed according to the vendor’s instructions. The group IIintron template provided with the kit was retargeted by inserting hpmA-specificsequences by overlapping PCR using the protocol recommended by the vendor.The PCR product was cloned into the BsrGI and HindIII sites of vectorpACD4K-C-loxP, which contains lox sequences flanking the kanamycin cassette.The resulting plasmid, pSAP2044, was transformed into electrocompetent P.mirabilis HI4320 carrying the T7 helper plasmid pAR1219 for insertional inac-tivation of hpmA. The resulting hpmA�kan strain of P. mirabilis was designatedALM2012. Inactivation of hpmA was confirmed by observing the 2.4-kb increasein the size of the gene due to insertion of the kanamycin cassette (1.4 kb) and theadjoining intron (1.0 kb) (Fig. 1A and B). The mutant was then passaged in Luriabroth several times to cure plasmid pAR1219; loss of the plasmid was confirmedby the ampicillin sensitivity of the hpmA�kan strain. An hpmA pta doublemutant was generated in two steps. First, the kanamycin cassette was excisedfrom the hpmA�kan strain by transforming the mutant with plasmid pQL123(Ampr), which expresses Cre protein under an isopropyl-�-D-thiogalactopyrano-side (IPTG)-inducible promoter. Excision of the kanamycin cassette due to CreloxP-based recombination was confirmed by PCR using primers HpmF (ATGAAATCAAAAAACTTTAAACTTTCACCC) and HpmR (TAATAGCAACGGTAATATCACTGCC), designed to amplify 3.0 kb toward the 5� end of thehpmA gene, after which the hpmA strain was inactivated only by a 1.0-kb intron.The resulting hpmA�intron strain was designated ALM2012B (Fig. 1A and B).We confirmed that the gene was inactivated in both cases by performing reversetranscription (RT)-PCR using primers HpmAF and HpmAR. The mutant strainwas passaged in plain Luria broth several times to cure plasmid pQL123. Theelectrocompetent hpmA strain (Kans and Amps) was again transformed with T7helper plasmid pAR1219 (ALM2012C) and subsequently transformed with plas-mid pSAP2037 (plasmid pACD4K-C carrying group II intron retargeted toinactivate pta) (1). Inactivation of pta in the hpmA strain was confirmed byperforming RT-PCR using primers PtaINTF (GGTTATATTCAAATTTACCTAGCAA) and PtaINTR (TTCAGAAGTTGGACAATTAGGTAAT), whichamplified the 2.2-kb fragment toward the 5� end of the pta gene (Fig. 1C), andby performing immunoblotting using rabbit polyclonal anti-Pta serum as de-scribed previously (1). The hpmA pta (Kanr) double mutant was designatedALM2014.

Cytotoxicity assays. The cytotoxicity of P. mirabilis HI4320 and each single anddouble mutant for human bladder epithelial cells was estimated by the lactate

dehydrogenase (LDH) release method as described previously (1). Briefly, eachP. mirabilis strain was cultured in LB (pH 8.5) to mid-exponential phase, andeach washed suspension of bacteria in PBS (pH 7.5) was laid over a monolayerof human bladder epithelial cells (UMUC-3) at a multiplicity of infection ofapproximately 100:1. After 4 h of incubation at 37°C, the amount of LDH in thesupernatant was estimated using a CytoTox membrane integrity assay kit (prod-uct no. G7890; Promega, Madison, WI) according to the vendor’s instructions.Treatment of epithelial cells with 2% (wt/vol) Triton X-100 and treatment ofepithelial cells with LB alone were used as positive and negative controls, re-spectively. The level of bladder cell lysis was expressed as a percentage of themaximal epithelial cell lysis obtained by Triton X-100 treatment.

Determination of ID50. P. mirabilis parent strain HI4320 and each Proteusconstruct were cultured in LB broth overnight, harvested, washed in PBS (pH7.2), and resuspended in PBS. The bacterial cell density was adjusted to obtainthe desired inoculum. Six- to eight-week-old female CBA mice (nine mice/

FIG. 1. Construction of hpmA and hpmA pta mutants and estima-tion of cytotoxicity. (A) Schematic diagram of the 4.73-kb hpmA gene,showing the site of inactivation by a kanamycin cassette. The approx-imate sizes of the hpmA gene, hpmA�kan, and hpmA�intron areindicated; the sizes of the corresponding PCR products amplified usingthe internal primers HpmAF and HpmAR (arrows) are indicated inparentheses. WT, wild type. (B) Insertion and excision of the kanamy-cin cassette in the hpmA�kan and hpmA�intron strains, respectively,was confirmed by amplification of hpmA by PCR. (C) Inactivation ofhpmA in the hpmA�kan and hpmA�intron strains (top) and inactiva-tion of pta in the hpmA pta double mutant (middle) were confirmed byRT-PCR using gene-specific primers. rpoA, encoding RNA polymeraseA, was used as the expression control (bottom). The sizes of PCRproducts are indicated on the right. Lane G, HI4320 genomic DNA,lane �, no RT added to the cDNA from strain HI4320. (D) P. mirabilisHI4320 and the mutants were independently cultured until mid-expo-nential phase (optical density at 600 nm, 0.6 to 0.7) in alkaline LB (pH8.5) supplemented with CaCl2 and 5% glycerol. A washed suspensionof bacteria (106 CFU) in PBS was laid over a confluent monolayer ofbladder cells and incubated for 4 h. The extent of bladder cell lysis(determined by the quantitative LDH release assay) is expressed as apercentage of the maximum cell lysis obtained by Triton X-100 treat-ment. The data are the means and standard errors of three indepen-dent experiments, each conducted in triplicate. *, P � 0.05; **, P �0.01.

VOL. 77, 2009 CYTOTOXICITY AND ANTIGENICITY OF Pta 633


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

infectious dose/group) were transurethrally inoculated with the following doses:5 106 and 5 107 CFU for parent strain HI4320 and the hpmA mutant; and5 106, 5 107, and 5 108 CFU for the pta mutant and the hpmA pta doublemutant. Each inoculum was quantified by plating serial dilutions (10�5 and 10�6)on LB agar, followed by enumeration of the CFU. One week after infection, micewere sacrificed, and bladder, kidney, and spleen tissue homogenates were platedon LB agar for enumeration of the CFU. The 50% infective doses (ID50) of theparent and mutant strains were calculated by using the method of Reed andMuench (28). The one-tailed Mann-Whitney test was used to determine the Pvalue; a P value of �0.05 was considered significant.

Pathological evaluation. A murine model of ascending UTI was used to eval-uate the uropathogenicity of each of the single mutants and the double mutantof P. mirabilis. The following doses were used to infect mice based on the ID50

determined for each strain: each mouse received 5 106 CFU of P. mirabilisHI4320 or the isogenic hpmA�kan strain or 5 108 CFU of the pta�kan strainor the hpmA pta double mutant. One week after transurethral infection, micewere sacrificed, and for each mouse the bladder, one-half of the left kidney cutlongitudinally, and one-half of the right kidney cut transversely were preserved in10% formalin (pH 7.2), embedded in paraffin, sectioned, stained with hematox-ylin and eosin, and examined microscopically. The investigator was blind to theidentity of the bacterial strain or mutant construct. The severity of renal pathol-ogy was expressed as a semiquantitative score for kidney damage by using thefollowing scores for the severity of peripelvic inflammation: 0, no inflammation;1, multifocal clusters of neutrophils (polymorphonuclear cells [PMNs]); 2, PMNssurrounding all or most of the pelvis; and 3, intense neutrophilic inflammationextending into the peripelvic tissue. The extent of spread was scored as follows:0, no spread; 1, PMNs confined to the peripelvic region; 2, PMN clusters de-tectable in the papilla or peripelvic cortex; and 3, widespread extension of PMNsinto the cortex or outer medulla. The severity of cystitis was scored as follows: 0,no cystitis; 1, occasional submucosal inflammatory cell infiltrates; 2, widespreadsubmucosal inflammatory cell infiltration with minimal spread to the muscularisor epithelium; and 3, widespread inflammation with dense perivascular cuffs,transmural distribution, and intraepithelial inflammatory cells. Bladder edemawas scored as follows: 0, no edema; 1, detectable edema; and 2, widespread andsevere edema.

Antigen preparation. For vaccination, both Pta and the alpha domain of Ptaalone (Pta-�) with a C-terminal six-histidine tag were individually overexpressedin E. coli BL21/plysS and purified as previously described (1). To minimize thetoxic effects of the protease, the recombinant proteins were constructed with anactive-site serine mutation (S365A) and were designated Pta* and Pta-�*. Pu-rified Pta* and Pta-�* were each covalently coupled to the mucosal adjuvantcholera toxin (CT) (Sigma Chemical Co.) at a ratio of 10:1. Covalent conjugationof CT with the purified antigen was accomplished using the heterobifunctionalcleavable protein cross-linker N-succinimidyl-3-(2-pyridyldithio)propionate(Pierce Biotech) as instructed by the manufacturer.

Immunization and subsequent challenge of female CBA mice. Mice wereimmunized by intranasal administration of the antigen-adjuvant complex. Micewere divided into two groups (23 mice in each group) for each antigen admin-istered. In each case the control group received CT alone, whereas the immu-nized group received Pta* plus CT or Pta-�* plus CT. Immediately followingimmunization, mice were placed on their backs until they recovered from anes-thesia. The immunization schedule was as follows. On day 1, a preimmune serumsample (collected by retro-orbital bleeding) and urine were collected from eachmouse. Each mouse then received 50 �g of Pta* or Pta-�* covalently coupledwith 5 �g of CT in 20 �l (total volume); 10 �l of the antigen-adjuvant complexwas administered into each nostril. On days 7 and 14, the mice received the firstand second booster doses, respectively, which consisted of 25 �g of Pta* orPta-�* covalently coupled with 5 �g of CT. On day 21, postimmune serum andurine samples were collected from each mouse in both groups to determineantigen-specific antibody titers. Each mouse was then transurethrally challengedwith 5 107 CFU of P. mirabilis HI4320. On day 28, 1 week postinfection, micewere euthanized, and tissue homogenates (bladder, kidney, and spleen) wereplated on LB agar plates (0.5 g/liter NaCl) to determine the number of CFU/gtissue. The lower limit of detection in this assay was 102 CFU/g tissue, and thisvalue was assigned to samples with an undetectable level of colonization. Datawere analyzed using the one-tailed Mann-Whitney test, and a P value of �0.05was considered significant.

ELISA. An enzyme-linked immunosorbent assay (ELISA) was performed us-ing 96-well plates (Costar high binding; catalog no. 9017). Each well was coatedwith 250 ng of antigen (Pta* or Pta-�*) dissolved in 60 mM carbonate buffer.Twofold serial dilutions of serum or urine samples were individually prepared inblocking buffer (PBS containing 10% fetal bovine serum and 0.1% sodium azide)and added to the wells. Goat anti-mouse immunoglobulin G (IgG) or goat

anti-mouse IgA, each conjugated with alkaline phosphatase, was used as thesecondary antibody. The substrate p-nitrophenylphosphate was used to measurethe alkaline phosphatase activity by determining the A405 after a 60-min reaction.The data were expressed as direct A405 values (16, 18). All data were analyzedusing Prism software (GraphPad Software, Inc.). Immunoglobulin response andbacterial load data were compared using the nonparametric Mann-Whitney tests;Spearman’s rank correlation coefficient values were evaluated as previously de-scribed (15).

Serum bactericidal assay. The bactericidal assay was performed as describedpreviously by Hadi et al. (9). Dilutions of postimmune serum (1:2 to 1:64) insterile PBS were prepared and transferred into sterile 96-well tissue cultureplates, and 50 �l of a P. mirabilis suspension (containing approximately 104 CFU)was added to each well. The plates were covered and incubated for 120 min at37°C. Aliquots (50 �l) were plated onto agar plates at time zero and after 120min of incubation to enumerate the CFU at each time point, and the lowestconcentration of serum that lysed 50% of the bacterial cells was determined.Rabbit polyclonal anti-Pta serum (Cacalico Biologicals) and the preimmune serawere included in each plate as positive and negative controls, respectively. Othercontrol wells contained bacteria with PBS-bovine serum albumen and bacteriawith heat-inactivated postimmune sera (56°C, 30 min).

Serum neutralization assay. To determine whether the Pta-specific antiserumneutralized the activity of Pta, P. mirabilis HI4320 was cultured to mid-exponen-tial phase in modified Luria broth (see above), and approximately 106 bacteriawere incubated with 1:2 to 1:16 serial dilutions of each serum sample. After 3 h,a washed bacterial suspension in PBS was laid over a monolayer of bladderepithelial cells, and in each case the percentage of cell lysis was estimated usingthe quantitative LDH release assay as described above. The bladder cell lysis wasexpressed as a percentage of the maximal cell lysis obtained by treatment withTriton X-100, which was used as a positive control, and the values were normal-ized using the data for lysis by the pta mutant. Data for bladder cell lysis by P.mirabilis HI4320 (not incubated with serum) were used for comparison.

RT-PCR analysis of pta from clinical isolates of P. mirabilis. Eight randomlyselected P. mirabilis strains obtained from cases of pyelonephritis or catheter-associated bacteriuria or fecal isolates were used to determine the prevalence ofpta. The presence of this gene was first determined by PCR amplification usingprimers PtaINTF and PtaINTR (see above), which were designed to amplify aninternal region of pta. This was done to avoid any amplification artifacts due toa nonhomologous DNA sequence in the intergenic region upstream and down-stream of pta in various isolates. Each isolate was then individually cultured inLuria broth (pH 8.5) supplemented with 5% glycerol and 10 mM CaCl2 topromote the expression of pta as described previously (1). RNA was isolatedfrom each culture, and cDNA was synthesized using a SuperScript first-strandsynthesis kit (Invitrogen). Expression of pta was determined for each strain byRT-PCR using cDNA as the template and primers PtaINTF and PtaINTR. rpoA,encoding RNA polymerase A, was used as an expression control.

RESULTS

Cytotoxicity of HpmA and Pta. The hpmA gene was inacti-vated in P. mirabilis HI4320 as shown in Fig. 1A. An hpmA ptadouble mutant of P. mirabilis was also created using a similarapproach. Inactivation of the genes in the constructs was con-firmed by RT-PCR (Fig. 1B and C).

The effect of inactivation of the two cytotoxin genes on theability of P. mirabilis to lyse bladder epithelial cells in culturewas determined by the LDH release assay. Inoculation of par-ent strain HI4320 resulted in lysis of approximately 65% of thebladder cells (Fig. 1D). The percentage was significantly lower(P � 0.01) for cells inoculated with either the isogenic hpmA(35%) or pta (30%) mutant incubated for the same length oftime. The decrease in cytotoxicity was more pronounced whenbladder cells were overlaid with the hpmA pta double mutant.After 4 h of incubation only 25% of the bladder cells werelysed, as estimated by the extent of LDH release (Fig. 1D).This value was significantly (P � 0.05) lower than the lysisvalue obtained with either of the single mutants and less than50% of the value obtained with the wild-type strain. Theseresults indicated that the activities of HpmA and Pta were

634 ALAMURI ET AL. INFECT. IMMUN.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

independent of each other but additive in that together theycontributed to cytotoxicity.

Mouse colonization assay and determination of ID50. Toinvestigate the individual roles of HpmA and Pta in vivo, wecompared the cytotoxicities of the mutants using a mousemodel of Proteus UTI. The ID50 of each of the strains wasdetermined so that we could estimate the damage to the hosttissue based on the same bacterial load.

Mice were independently challenged transurethrally with arange of doses, as described above, and the level of coloniza-tion obtained with each dose was determined by plating thetissue homogenates. Table 1 shows the median bacterial loadsrecovered from mice that received various doses of parentstrain HI4320 or one of the mutant constructs. The ID50 ofeach strain was calculated using quantitative counts obtainedfor kidney homogenates for mice sacrificed 1 week after chal-lenge, as described by others (11, 28). The ratios of the numberof mice with kidney levels of 103 CFU/ml to the total numberof mice challenged by inoculation were determined for a rangeof bacterial loads. The ID50 of the parent strain and the iso-genic hpmA mutant calculated from these ratios was 5 106

CFU, whereas the ID50 of the pta and hpmA pta mutants was100-fold greater (5 108 CFU), suggesting that Pta is animportant virulence factor in P. mirabilis.

Histopathologic evaluation of mouse bladders and kidneys.To determine the effect of inactivation of either or both of thetoxins on disease due to P. mirabilis, five groups of 6-week-oldfemale CBA/J mice (six mice per group) were independentlyinoculated with P. mirabilis HI4320 or the pta, hpmA, or hpmA ptamutant by using a dose corresponding to the ID50, and the his-topathology of the bladder and kidney was evaluated (Fig. 2 to 4).

Colonization of the kidneys by P. mirabilis strain HI4320 wasaccompanied by neutrophilic interstitial nephritis centered onthe peripelvic renal cortex and in some cases extending intoand destroying the surrounding renal parenchyma (Fig. 2E andF) compared to the results to uninfected mice (Fig. 2C and D).Similar pathology was observed for the hpmA mutant (Fig. 2Aand B), and in some cases bacterial colonies were present inthe lesions (Fig. 2B). The intensity and extent of inflammationin kidneys ranged from none to severe, and scores of 0 to 3were obtained as described in Materials and Methods (Fig. 3).The levels of severity and extents of kidney inflammation weresimilar in mice colonized by wild-type P. mirabilis and micecolonized by the hpmA mutant. However, in mice colonized by

the pta mutant or the hpmA pta double mutant, both theseverity and the extent of nephritis were significantly less (P �0.05) than the severity and the extent of nephritis in micecolonized by the wild-type strain (Fig. 3). Uninfected mice hadno nephritis (Fig. 3).

Cystitis in infected mice was characterized by transmuralneutrophilic inflammation with epithelial transcytosis of neu-trophils and marked submucosal edema (Fig. 4A and B). Theintensity and extent of inflammation in the bladders rangedfrom none to severe, and scores of 0 to 3 were obtained asdescribed in Materials and Methods. The hpmA pta doublemutant caused significantly less inflammation than wild-typestrain HI4320 (P � 0.01) (Fig. 4D). Uninfected mice had nocystitis (Fig. 4C and D). Uncompromised urease activity ineach of these infections was indicated by the presence of crystaldeposits (i.e., stones) that were observed in the majority of thebladder cross sections (data not shown).

Protection against P. mirabilis challenge provided by vacci-nation with Pta. AT proteins have been used as effective vac-cines against bacterial infections. The App proteins from Neis-seria meningitidis, pertactin and BrkA from Bordetella pertussis,and Hap from Haemophilus influenzae are examples of ATsthat have provided immune protection against subsequentchallenge with the corresponding pathogens. Taking into ac-count the immunogenic properties of Pta (27) and its role incolonization of the host, we asked whether vaccination of micewith Pta provides protection against subsequent challenge withP. mirabilis. CT, which was successfully used in our laboratoryas an adjuvant for intranasal vaccination of mice with MrpHantigen (an adhesin of M/RP fimbria) (17), was used as amucosal adjuvant.

Vaccination with Pta* reduced the level of P. mirabilis infectionin the bladder of mice (Fig. 5A); the median number of CFU/gwas about 1 log10 lower than the value for CT-immunized (naïve)mice, although the difference was not statistically significant (P �0.062). However, the protection in the kidney and spleen wassignificant (P � 0.01); the median values were log10 6.3 and log10

5.6 CFU/g tissue, respectively, for the naïve group of mice andlog10 3.5 and 3.0 CFU/g tissue, respectively, for immunized mice.Indeed, for 9 of 20 mice in the immunized group the bacterialcounts were below the limit of detection, suggesting that therewas robust protection of the upper urinary tract.

Since the passenger/alpha domain (Pta-�) is the functionalmoiety of the AT and directly interacts with the host, we asked

TABLE 1. Colonization of mice by P. mirabilis HI4320 and isogenic mutants

P. mirabilisconstruct

Log10 CFU/g tissue witha:

5 106-CFU inoculum 5 107-CFU inoculum 5 108-CFU inoculum

Bladder Kidney Spleen Bladder Kidney Spleen Bladder Kidney Spleen

HI4320 7.3 6.0 4.2 8.1 6.4 5.2 ND ND NDhpmA

mutant6.7 (NS) 5.4 (NS) 4.8 (NS) 6.8 (NS) 6.2 (NS) 6.0 (NS) ND ND ND

ptamutant

6.5 (P � 0.037) 3.9 (P � 0.002) 2.1 (P � 0.017) 7.5 (NS) 3.6 (P � 0.002) 2.5 (P � 0.024) 6.5 (NS) 5.8 (NS) 4.4 (NS)

hpmA ptamutant

5.8 (P � 0.0012) 4.1 (P � 0.0017) 2.8 (P � 0.011) 7.2 (NS) 4.8 (P � 0.001) 3.4 (P � 0.031) 6.5 (NS) 6.2 (NS) 6.0 (NS)

a Median log10 CFU/g recovered from mouse tissue. The median for each construct was compared to the value for the wild type when the inoculum was 5 106

CFU. P values were calculated using the one-tailed Mann-Whitney U test, and a P value of �0.05 was considered significant. NS, not significant. ND, not determined.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

if vaccination with Pta-� alone protects mice from P. mirabilisinfection. Two groups of mice (22 mice in each group) wereintranasally vaccinated either with CT alone or with a Pta-�*–CT conjugate. Pta-� provided protection similar to thatobserved with Pta*. Mice challenged with P. mirabilis followingimmunization and boosting had significantly lower (P � 0.01)bacterial loads in their kidneys and spleens than the naïve mice(Fig. 5B). Thus, we concluded that the alpha/passenger domainalone can stimulate a strong immune response that signifi-cantly reduces colonization by P. mirabilis.

Correlates of protective immunity. Sera from mice immu-nized with Pta* or Pta-�* were tested to determine their an-tibody responses. After immunization and boosting, the serumIgG titers (Fig. 6A) and urine IgA titers (Fig. 6C) for micevaccinated with Pta*-CT or Pta-�*–CT were significantlyhigher (P � 0.01) than the titers for sera and urine from thepreimmune samples or from mice that received CT alone (Fig.6A and C), suggesting that there was a strong immune re-sponse against the antigen. The immune response (serum IgG

FIG. 3. Interstitial nephritis caused by P. mirabilis HI4320 and iso-genic mutants of this strain. Histopathology was scored as described inMaterials and Methods. The horizontal bars indicate the means. Pvalues were calculated by the one-tailed Mann-Whitney U test. *, P �0.05; **, P � 0.01.

FIG. 2. Mice were independently transurethrally inoculated with P. mirabilis HI4320 or the mutant constructs. After 7 days of infection, akidney from each mouse was fixed, and the sections were stained for histopathological evaluation. (A) Kidney from a mouse inoculated with thehpmA mutant of P. mirabilis. Multiple foci of inflammation and necrosis are scattered throughout the cortex (arrows). The arrowheads delineatethe border between more-normal tissue (left) and necrotic tissue (right). (Inset) Overview of the entire kidney, indicating the location of thesection. (B) Higher magnification of panel A showing a focus of necrosis, neutrophilic inflammation, and bacterial colonies. (C) Normal kidneyfrom an uninfected mouse. (D) Higher magnification of panel C. (E) Kidney from a mouse inoculated with wild-type P. mirabilis HI4320. A mildlymphocytic infiltrate is present adjacent to the renal pelvis (arrow). (F) Higher magnification of panel E showing lymphocytic infiltrate.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

in Pta*- and Pta-�*-immunized mice) also showed a significantinverse correlation (P � 0.0024 and P � 0.0325 for Pta*- andPta-�*-immunized mice, respectively) with the bacterial load(that is, when the antibody levels were low, the numbers ofCFU were high, and when antibody levels were high, the num-bers of CFU were low or bacteria were undetectable), as de-termined by Spearman’s rank correlation coefficient values(Fig. 6B and D), suggesting that both the magnitude and the

specificity of the antibody response were critical correlates ofprotection. The correlation varied from moderate for miceimmunized with Pta-�* (P � 0.0559) to none with Pta* (P �0.954). There was no difference in the IgM titers for any group(data not shown), suggesting that there was efficient and com-plete class switching of immunoglobulins.

Neutralization of Pta by anti-Pta sera. Since Pta* stimulateda strong antibody response and provided significant protectionagainst P. mirabilis infection, we determined whether anti-Ptaserum was bactericidal or neutralizing. The bactericidal activ-ities of serial dilutions (1:2 to 1:32) of antisera obtained fromdifferent groups of mice were tested as described in Materialsand Methods. No antiserum-based bacterial cell lysis was ob-served even when cells were incubated with the highest con-centration (1:2) of the sera tested (data not shown), indicatingthat there was no direct anti-Pta serum-mediated bactericidalactivity. However, for P. mirabilis HI4320 cells preincubatedfor 3 h with anti-Pta sera there was a significant decrease (P �0.05) in the ability of the bacteria to lyse cultured bladder cells

FIG. 4. Histopathological evaluation of bladders from mice.(A) The urinary bladder obtained from a mouse after 7 days of infec-tion with 5 106 CFU of parent strain HI4320 was processed forhistopathological evaluation as described in the text. The mucosa isthickened with edema and inflammatory cells (arrows). (B) Highermagnification of panel A showing neutrophils within the epithelium.(C) Bladder from a mouse that received PBS as a control. (D) Cystitisseverity after inoculation of various P. mirabilis constructs. The hori-zontal bars indicate the means. P values were calculated by the one-tailed Mann-Whitney U test. **, P � 0.01.

FIG. 5. Immune protection from P. mirabilis challenge by vaccina-tion with Pta* and Pta-�*. Mice were vaccinated and boosted withCT-Pta* (A) or CT–Pta-�* (B) as described in the text and werechallenged intraurethrally on day 21 with 5 107 CFU P. mirabilisHI4320. The numbers of P. mirabilis CFU in bladders, kidneys, andspleens of naïve mice (which received CT alone) and mice immunizedwith CT–Pta-�* or CT-Pta* were determined 1 week after bacterialchallenge. Each symbol indicates the log10 CFU/g of tissue from anindividual mouse. Samples in which colonization was undetectablewere given a value of 2.1 log10 CFU/g of tissue (the limit of detection).The bars indicate medians. P values were determined using the one-tailed Mann-Whitney U test; a P value of �0.05 was considered sig-nificant.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

compared to the cytotoxicity of the same strain that was notincubated with antisera or to the cytotoxicity of bacteria incu-bated with preimmune serum or sera from mice that receivedCT alone (Fig. 7). Indeed, the residual cytotoxicity of P. mira-bilis incubated with Pta-specific sera for bladder cells was onlyabout 10% of the maximal cytotoxicity (lysis) observed (Fig. 7).The lowest concentration of anti-Pta sera that reduced the

bladder cell lysis (by P. mirabilis) by 50% was 1:8. These resultsindicated that anti-Pta sera not only recognized Pta on thehomologous parent strain but also compromised the activity ofthe toxin. No significant reduction in the extent of bladder celllysis was observed when bladder cells were incubated with P.mirabilis treated with the lower concentrations (1:16 and 1:32)of the same serum (Fig. 7). These results suggest that the modeof protection against Proteus infection in the Pta*-vaccinatedmice may involve antibody-based neutralization of Pta.

Prevalence and expression of pta in P. mirabilis. The vacci-nation data suggested that Pta can be used as an effectivecandidate vaccine to protect against P. mirabilis infection.Since ATs are pathogen specific, we wanted to know whetherPta is present in pathogenic as well as commensal strains of P.mirabilis. Each strain was independently cultured, and thegenomic DNA and cDNA were isolated. Amplification by PCRshowed that pta was present in all fecal, catheter-associated,and pyelonephritis (data not shown) isolates tested (Fig. 8B).Whereas pta was expressed in all the pyelonephritis (data notshown) and catheter-associated strains tested (Fig. 8A), noneof the fecal isolates showed any detectable transcript, as de-termined by RT-PCR (Fig. 8C). This finding was in contrast tothe data obtained for mrpH (encoding an adhesin of MR/Pfimbria) (18) or the urease activities that were observed in allP. mirabilis isolates, suggesting that Pta is pathogen specific.

DISCUSSION

Complicated UTI caused by P. mirabilis are characterized bysevere necrosis of the kidney and bladder epithelium, pelvic

FIG. 6. Correlation of IgG and IgA titers with protection. The antibody responses in mice to intranasal vaccination with CT-Pta*, withCT–Pta-�*, or with CT alone were determined by an indirect ELISA. Serum IgG and urine IgA titers in pre- and postimmune sera and urinecollected from each group of immunized and naïve mice were determined using a 1:512 dilution of serum or urine. Goat anti-rabbit IgA or IgGconjugated with alkaline phosphatase was used as the secondary antibody. The alkaline phosphatase activity was determined at A405 60 min afteraddition of the substrate. The means and standard errors for serum IgG (A) and urine IgA (C) titers for eight mice (with each experimentperformed in duplicate) are indicated. The bacterial load recovered from immunized mice 1 week after challenge was tested to determinecorrelations with Pta*- or Pta-�*-specific serum IgG (B) and urine IgA (D) responses. Both the anti-Pta and anti-Pta-� serum IgG titers wereinversely correlated with the bacterial load, whereas the inverse correlation was significant only for Pta-�*-specific urine IgA and was not significantfor Pta*. P values were calculated for correlation coefficients, and a P value of �0.05 was considered significant. Spearman’s rank correlationcoefficients (r) are indicated. The diagonal lines indicate linear regression.

FIG. 7. Neutralization of Pta by anti-Pta sera. LDH release wasused as a measure of bladder cell lysis after inoculation of P. mirabilispreincubated for 3 h with different dilutions of sera. The y axis indi-cates bladder cell lysis expressed as a percentage of the maximum lysis(after treatment with 2% [wt/vol] Triton X-100) normalized to thebladder cell lysis by the pta mutant. No antibody, strain HI4320 incu-bated with no serum; Naive, strain HI430 preincubated with seracollected from CT-immunized mice on day 21; Pre-immune, strainHI430 preincubated with sera collected from mice on day 1 prior tovaccination with Pta*; Anti-Pta, strain HI430 preincubated with seracollected on day 21 from mice immunized with Pta*. The one-tailedMann-Whitney U test was used to determine P values. *, P � 0.05.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

inflammation, and stone formation in the bladder and kidney(23, 36, 37). Hemolysin, urease, and Pta are the cytotoxinscharacterized so far in this uropathogen (1, 24, 38, 39) thathave been implicated in this damage in the host. In this study,we demonstrated that inactivation of hpmA or pta alone orinactivation of both hpmA and pta significantly reduces thecytotoxicity of P. mirabilis with cultured bladder epithelial cells(Fig. 1D). The effects of the mutations in vivo also exhibitedthis general trend. Using histopathological examination of thekidneys and bladders from mice inoculated with the mutantstrains (hpmA or pta), we observed a moderate decrease ininterstitial nephritis or the severity of cystitis. A significantdecrease (P � 0.01) in pathology (compared to that of theparent strain), however, was observed only when both toxingenes were inactivated (Fig. 3 and 4D). Thus, we identifiedsimilar, yet independent, roles for the two toxins in P. mirabilisinfection. This was in contrast to the activity of HlyA from auropathogenic strain of E. coli; in this organism inactivation ofhylA alone was directly associated with a decrease in the shed-ding of uroepithelium in a mouse model of UTI (31). Never-theless, we also observed a certain degree of residual pathology(necrosis of pelvic epithelium, cystitis, or interstitial nephritis)in mice inoculated with the hpmA pta double mutant (Fig. 3and 4D) that could be attributed to other factors in Proteus,including urease.

Urease, a urea-inducible, cytoplasmic metalloenzyme in P.mirabilis, is essential for the persistence of P. mirabilis in theurinary tract. This enzyme enables the bacterium to use urea asa source of nitrogen, which is required for DNA and proteinsynthesis. Ammonia released during urea hydrolysis directlycauses tissue necrosis at the site of infection. In addition, theammonium and bicarbonate ions formed alkalinize the urinary

tract and initiate precipitation of otherwise soluble Ca2� andMg2� salts present in the urine (11). Prior to this report,urease was the only other protein with an established cytotoxiceffect in vivo. Direct comparison of the pathology of the kidneyand bladder in mice infected with a urease-negative strain of P.mirabilis with the pathology of the kidney and bladder in miceinfected with the parent strain showed that there was a dra-matic decrease in tissue necrosis and pelvic inflammation withthe former strain (11). In this study, we propose yet anotherindirect role of urease activity. Pta, unlike HpmA, is a calcium-dependent, alkaline protease with a pH optimum of 8.5 to 9.0;these conditions are prevalent in a Proteus-infected urinarytract (1). Thus, Pta activity during infection is likely ureasedependent. We hypothesize that the phenotype of a urease-negative strain (ureC) of P. mirabilis (12) may be in part aconsequence of both a reduction in the expression and a re-duction in the enzymatic activity of Pta. Thus, under nonalka-line conditions a urease-negative strain indirectly behaves likea ureC pta mutant of P. mirabilis.

A set of efficacious candidate antigens must be identified inorder to develop a vaccine against Proteus infections. Flagellin(FlaA/FlaB), MR/P fimbrial protein MrpH (17, 18), recombi-nant Lactococcus lactis displaying Proteus fimbrial proteinMrpA (30), and outer membrane protein (22) of Proteus wereall previously considered as candidate antigens for a vaccine.Limitations such as the phase variability of MR/P fimbriae(and thus MrpH) and recombination of FlaA with FlaB (25,40) mean that these proteins must be used in combination withother stable antigens as part of a multivalent vaccine. Thus, anideal vaccine candidate should be stably expressed during in-fection and should contribute to virulence. Hence, we com-pared the colonization efficiency of each of the single mutants(hpmA or pta) with that of the parent strain to determine theindividual roles of the proteins in colonization and persistenceof P. mirabilis in the host. We found no role for HpmA incolonization by the pathogen (that is, the bacterial burden) inthe host (Table 1), an observation consistent with that of Swi-hart and Welch (32). On the other hand, inactivation of ptasignificantly decreased (P � 0.01) the viable counts recoveredfrom the upper urinary tract of mice compared with the dataobtained with the parent strain (Table 1). Indeed, the ID50 ofthe isogenic pta mutant was found to be 100-fold higher thanthat of the parent strain. Because Pta is not only a key cyto-toxin in P. mirabilis but also a surface-exposed protein that iscritical for establishing an infection in the host, this proteinappeared to be a logical choice for testing as a vaccine candi-date.

The attenuated form of Pta was used for vaccination of mice.Immune protection against infection by mucosal pathogens,such as P. mirabilis, also requires an effective mucosal adjuvant.CT, which was successfully used as a mucosal adjuvant previ-ously in our laboratory, was also used here. This adjuvant wascovalently coupled with the antigen (Pta* or Pta-�*), a condi-tion that promotes the critical interaction of CT with dendriticcells in the spleen and thus an effective immune response (7).As expected, immunization with Pta*-CT or Pta-�*–CT pro-vided significant protection against Proteus UTI, especially inthe upper urinary tract (Fig. 5). This protection correlatedstrongly with the serum IgG response elicited by immunization(Fig. 6C), but it correlated only weakly with the urine IgA

FIG. 8. Prevalence of Pta in P. mirabilis isolates. Eight catheter-associated strains (C1 to C8) and eight fecal isolates (F1 to F8) wereindependently cultured to mid-exponential phase in LB (pH 8.5) sup-plemented with 10 mM CaCl2 and 5% glycerol. (A) Expression of ptain catheter-associated strains was determined by RT-PCR using pta-specific primers; cDNA obtained from each strain was used as a tem-plate. (B) Prevalence of pta in the genomes of fecal isolates as deter-mined by PCR of genomic DNA. (C) Expression of pta in the strainsas determined by RT-PCR using cDNA obtained from each isolateand pta-specific primers. rpoA, encoding RNA polymerase A, was usedas an expression control. cDNA from strain HI4320 was used as thereference. Lane G, genomic DNA from strain HI4320 used as a tem-plate; lanes �, no RT added; lanes �, RT added. Sizes (in kb) areindicated on the right.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

response. We attribute the difference to the possible localizedexpression of Pta in the urinary tract. Both the mutant analysisstudy and the immune protection study showed that a lack ofPta or possible neutralization of Pta by serum does not signif-icantly affect the colonization by the pathogen in the bladder,suggesting that the role of this protein in the lower urinarytract is insignificant. Hence, even though the urine IgA titerwas higher in Pta*-vaccinated mice than in CT-immunizedmice, the protection was not significant in the bladder, due toonly basal levels of Pta expression on the surface of P. mirabilisin bladder. Hence, we propose that protection against P. mira-bilis in Pta*-immunized mice may be due to serum IgG-medi-ated neutralization of Pta in the upper urinary tract of mice.Previous studies in our laboratory have shown that unlike in-fection with uropathogenic E. coli, where the antibody titerfrom a previous infection correlates with the short resolutiontime of a secondary infection (10), primary infection with P.mirabilis or immunization of naïve mice with sera obtainedfrom immunized mice does not confer passive protectionagainst P. mirabilis infection (19). Hence, passive protectionwith Pta-specific sera was not tested in this study.

ATs such as Pta are considered pathogen-specific proteinsproduced by gram-negative bacteria, and few of them (BrkA,Hap, and VacA) are required for virulence (20, 21, 29). Con-sistent with these observations, we showed that Pta was apathogen-specific protein in P. mirabilis (Fig. 8). The reasonsfor a lack of pta expression in the fecal isolates were, however,not clear, but this finding provided a strong basis for use of thisantigen as a vaccine against pathogenic strains of P. mirabilis;that is, commensal strains of P. mirabilis would not be affectedby a Pta vaccine. This observation also suggested that strains ofP. mirabilis may not be as homogeneous as once thought asgenetic variation is possible, especially when pathogen-specificfactors (such as ATs) are considered.

In conclusion, we established the roles of two different cy-totoxins, hemolysin and proteus toxic agglutinin, in the patho-genesis of P. mirabilis. To our knowledge, this is also the firstreport that describes a systematic evaluation of HpmA in vivoand also provides insight into factors other than urease thatcontribute to host tissue damage. Identification of Pta as aneffective antigen is a promising step toward our long-term goalof developing a vaccine against complicated UTIs caused by P.mirabilis. However, further investigation to identify an appro-priate adjuvant for use in humans, as well as an effective an-tigen delivery system, is required.

ACKNOWLEDGMENTS

We thank the histology laboratory at Michigan State University,East Lansing, for processing mouse tissue for our histopathology study.

This project was funded by Public Service Grant AI-059722 from theNational Institutes of Health to H.L.T.M.

REFERENCES

1. Alamuri, P., and H. L. Mobley. 2008. A novel autotransporter of uropatho-genic Proteus mirabilis is both a cytotoxin and an agglutinin. Mol. Microbiol.68:997–1017.

2. Allison, C., H. C. Lai, and C. Hughes. 1992. Co-ordinate expression ofvirulence genes during swarm-cell differentiation and population migrationof Proteus mirabilis. Mol. Microbiol. 6:1583–1591.

3. Bahrani, F. K., D. E. Johnson, D. Robbins, and H. L. Mobley. 1991. Proteusmirabilis flagella and MR/P fimbriae: isolation, purification, N-terminal anal-ysis, and serum antibody response following experimental urinary tract in-fection. Infect. Immun. 59:3574–3580.

4. Braun, V., and T. Focareta. 1991. Pore-forming bacterial protein hemolysins(cytolysins). Crit. Rev. Microbiol. 18:115–158.

5. Cover, T. L., and S. R. Blanke. 2005. Helicobacter pylori VacA, a paradigmfor toxin multifunctionality. Nat. Rev. Microbiol. 3:320–332.

6. Fraser, G. M., L. Claret, R. Furness, S. Gupta, and C. Hughes. 2002.Swarming-coupled expression of the Proteus mirabilis hpmBA haemolysinoperon. Microbiology 148:2191–2201.

7. Grdic, D., L. Ekman, K. Schon, K. Lindgren, J. Mattsson, K. E. Magnusson,P. Ricciardi-Castagnoli, and N. Lycke. 2005. Splenic marginal zone dendriticcells mediate the cholera toxin adjuvant effect: dependence on the ADP-ribosyltransferase activity of the holotoxin. J. Immunol. 175:5192–5202.

8. Griffith, D. P., D. M. Musher, and C. Itin. 1976. Urease. The primary causeof infection-induced urinary stones. Investig. Urol. 13:346–350.

9. Hadi, H. A., K. G. Wooldridge, K. Robinson, and D. A. Ala’Aldeen. 2001.Identification and characterization of App: an immunogenic autotransporterprotein of Neisseria meningitidis. Mol. Microbiol. 41:611–623.

10. Hopkins, W. J., and D. T. Uehling. 1995. Resolution time of Escherichia colicystitis is correlated with levels of preinfection antibody to the infectingEscherichia coli strain. Urology 45:42–46.

11. Johnson, D. E., R. G. Russell, C. V. Lockatell, J. C. Zulty, J. W. Warren, andH. L. Mobley. 1993. Contribution of Proteus mirabilis urease to persistence,urolithiasis, and acute pyelonephritis in a mouse model of ascending urinarytract infection. Infect. Immun. 61:2748–2754.

12. Jones, B. D., C. V. Lockatell, D. E. Johnson, J. W. Warren, and H. L. Mobley.1990. Construction of a urease-negative mutant of Proteus mirabilis: analysisof virulence in a mouse model of ascending urinary tract infection. Infect.Immun. 58:1120–1123.

13. Kaca, W., and A. Rozalski. 1991. Characterization of cell-bound and cell-freehemolytic activity of Proteus strains. Eur. J. Epidemiol. 7:159–165.

14. Kotelko, K., W. Kaca, A. Rozalski, and M. Deka. 1983. Some biologicalfeatures of Proteus bacilli. 2. Haemolytic activities of Proteus mirabilis andProteus vulgaris strains. Acta Microbiol. Pol. 32:345–351.

15. Kwissa, M., R. R. Amara, H. L. Robinson, B. Moss, S. Alkan, A. Jabbar, F.Villinger, and B. Pulendran. 2007. Adjuvanting a DNA vaccine with a TLR9ligand plus Flt3 ligand results in enhanced cellular immunity against thesimian immunodeficiency virus. J. Exp. Med. 204:2733–2746.

16. Li, W., M. H. Sofi, N. Yeh, S. Sehra, B. P. McCarthy, D. R. Patel, R. R.Brutkiewicz, M. H. Kaplan, and C. H. Chang. 2007. Thymic selection path-way regulates the effector function of CD4 T cells. J. Exp. Med. 204:2145–2157.

17. Li, X., J. L. Erbe, C. V. Lockatell, D. E. Johnson, M. G. Jobling, R. K.Holmes, and H. L. Mobley. 2004. Use of translational fusion of the MrpHfimbrial adhesin-binding domain with the cholera toxin A2 domain, coex-pressed with the cholera toxin B subunit, as an intranasal vaccine to preventexperimental urinary tract infection by Proteus mirabilis. Infect. Immun.72:7306–7310.

18. Li, X., C. V. Lockatell, D. E. Johnson, M. C. Lane, J. W. Warren, and H. L.Mobley. 2004. Development of an intranasal vaccine to prevent urinary tractinfection by Proteus mirabilis. Infect. Immun. 72:66–75.

19. Li, X., and H. L. Mobley. 2002. Vaccines for Proteus mirabilis in urinary tractinfection. Int. J. Antimicrob. Agents 19:461–465.

20. Liu, D. F., K. W. Mason, M. Mastri, M. Pazirandeh, D. Cutter, D. L. Fink,J. W. St. Geme III, D. Zhu, and B. A. Green. 2004. The C-terminal fragmentof the internal 110-kilodalton passenger domain of the Hap protein ofnontypeable Haemophilus influenzae is a potential vaccine candidate. Infect.Immun. 72:6961–6968.

21. Marr, N., D. C. Oliver, V. Laurent, J. Poolman, P. Denoel, and R. C.Fernandez. 2008. Protective activity of the Bordetella pertussis BrkA auto-transporter in the murine lung colonization model. Vaccine 26:4306–4311.

22. Moayeri, N., C. M. Collins, and P. O’Hanley. 1991. Efficacy of a Proteusmirabilis outer membrane protein vaccine in preventing experimental Proteuspyelonephritis in a BALB/c mouse model. Infect. Immun. 59:3778–3786.

23. Mobley, H. L. T., and J. W. Warren. 1987. Urease-positive bacteriuria andobstruction of long-term urinary catheters J. Clin. Microbiol. 25:2216–2217.

24. Mobley, H. L., and G. R. Chippendale. 1990. Hemagglutinin, urease, andhemolysin production by Proteus mirabilis from clinical sources. J. Infect. Dis.161:525–530.

25. Murphy, C. A., and R. Belas. 1999. Genomic rearrangements in the flagellingenes of Proteus mirabilis. Mol. Microbiol. 31:679–690.

26. Nemoy, N. J., and T. A. Staney. 1971. Surgical, bacteriological, and biochem-ical management of “infection stones.” JAMA 215:1470–1476.

27. Nielubowicz, G. R., S. N. Smith, and H. L. Mobley. 2008. Outer membraneantigens of the uropathogen Proteus mirabilis recognized by the humoralresponse during experimental murine urinary tract infection. Infect. Immun.76:4222–4321.

28. Reed, L. J., and H. A. Muench. 1938. A simple method of estimating fiftypercent endpoints. Am. J. Hyg. 27:493–497.

29. Salama, N. R., G. Otto, L. Tompkins, and S. Falkow. 2001. Vacuolatingcytotoxin of Helicobacter pylori plays a role during colonization in a mousemodel of infection. Infect. Immun. 69:730–736.

30. Scavone, P., A. Miyoshi, A. Rial, A. Chabalgoity, P. Langella, V. Azevedo,and P. Zunino. 2007. Intranasal immunization with recombinant Lactococcus



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

lactis displaying either anchored or secreted forms of Proteus mirabilis MrpAfimbrial protein confers specific immune response and induces a significantreduction of kidney bacterial colonization in mice. Microbes Infect. 9:821–828.

31. Smith, Y. C., S. B. Rasmussen, K. K. Grande, R. M. Conran, and A. D.O’Brien. 2008. Hemolysin of uropathogenic Escherichia coli evokes extensiveshedding of the uroepithelium and hemorrhage in bladder tissue within thefirst 24 hours after intraurethral inoculation of mice. Infect. Immun. 76:2978–2990.

32. Swihart, K., and R. A. Welch. 1990. Cytotoxic activity of the Proteus hemo-lysisn HpmA. Infect. Immun. 58:1861–1869.

33. Swihart, K. G., and R. A. Welch. 1990. The HpmA hemolysin is morecommon than HlyA among Proteus isolates. Infect. Immun. 58:1853–1860.

34. Taddei, C. R., A. Fasano, A. J. Ferreira, L. R. Trabulsi, and M. B. Martinez.2005. Secreted autotransporter toxin produced by a diffusely adhering Esch-erichia coli strain causes intestinal damage in animal model assays. FEMSMicrobiol. Lett. 250:263–269.

35. Warren, J. W. 1991. The catheter and urinary tract infections. Med. Clin. N.Am. 75:481–493.

36. Warren, J. W., D. Damron, J. H. Tenney, J. M. Hoopes, B. Deforge, and H. L.Muncie, Jr. 1987. Fever, bacteremia, and death as complications of bacteri-uria in women with long-term urethral catheters. J. Infect. Dis. 155:1151–1158.

37. Warren, J. W., H. L. Muncie, Jr., and M. Hall-Craggs. 1988. Acute pyelo-nephritis associated with bacteriuria during long-term catheterization: apropspective clinicopathological study. J. Infect. Dis. 158:1341–1346.

38. Welch, R. A. 1991. Pore-forming cytolysins of gram-negative bacteria. Mol.Microbiol. 5:521–528.

39. Welch, R. A., C. Forestier, A. Lobo, S. Pellett, W. Thomas, Jr., and G. Rowe.1992. The synthesis and function of the Escherichia coli hemolysin andrelated RTX exotoxins. FEMS Microbiol. Immunol. 5:29–36.

40. Zhao, H., X. Li, D. E. Johnson, I. Blomfield, and H. L. Mobley. 1997. In vivophase variation of MR/P fimbrial gene expression in Proteus mirabilis infect-ing the urinary tract. Mol. Microbiol. 23:1009–1019.

Editor: S. R. Blanke



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Vaccination with Proteus Toxic Agglutinin, a Hemolysin ... · PDF fileComplicated urinary...

Documents

Transcript of Vaccination with Proteus Toxic Agglutinin, a Hemolysin ... · PDF fileComplicated urinary...