USM Today Fall 2014
-
Upload
university-school -
Category
Documents
-
view
229 -
download
2
description
Transcript of USM Today Fall 2014
86725 USMTodayFall2014.indd 1 86725 USMTodayFall2014.indd 1 11/4/14 3:26 PM11/4/14 3:26 PM
At University School of Milwaukee, members of the USM community adhere to the At University School of Milwaukee, members of the USM community adhere to the Common Trust and agree to relate to one another and the School with trust, honesty, Common Trust and agree to relate to one another and the School with trust, honesty, fairness, kindness, and the 2014-2015 tenet,fairness, kindness, and the 2014-2015 tenet,
respect.Our senior prefects shared what respect means to them in a series of speeches during Our senior prefects shared what respect means to them in a series of speeches during USM’s Opening Day Ceremony on August 27, and the tenet of respect will resonate USM’s Opening Day Ceremony on August 27, and the tenet of respect will resonate throughout the school year in assemblies and gatherings across all divisions.throughout the school year in assemblies and gatherings across all divisions.
But most importantly, the tenet will be reflected in how we treat one another throughout But most importantly, the tenet will be reflected in how we treat one another throughout the school year, as we display the core values and unity that make USM special.the school year, as we display the core values and unity that make USM special.
86725 USMTodayFall2014.indd 2 86725 USMTodayFall2014.indd 2 11/4/14 3:26 PM11/4/14 3:26 PM
22Alumna Finds Success in Silicon Valley
39Announcing the Varsity Club Athletic Hall of Fame
16Music to Our Ears
0850 Years of USM
06Homecoming 2014
02 Head of School Message
04 Events Around Campus
14 Wright Distinguished Faculty Award Winners
18 Meet Eric Peters
20 Annual Giving: 50 Reasons to Give
28 In Memoriam
31 Class Notes
33 Academic Achievement
34 Preprimary Teachers Refi ne Approach Through Italy Trip
36 Bringing Ideas to the Table: Upper School Roundtables
38 Athletic Program Looks to Build Upon Success
40 A Look Back
ALSO IN THIS ISSUE:
03 Board of Trustees
24 Reunion Weekend
32 Parents’ Association
in this issue
USM TODAYUSM Today is published by University School of Milwaukeethree times per year. USM is an independent, coeducational,college preparatory day school for students from prekindergartenthrough grade 12. Our editorial staff has made every attempt to ensure the accuracy of information reported, and we apologize for any inadvertent errors that may have occurred.
EXECUTIVE EDITOR
Tim EilbesDirector of Marketing and Communications
MANAGING EDITOR
Ryan CardarellaAssistant Director of Marketing and Communications
CONTRIBUTING EDITOR
Julie PiwowarczykAssociate Director of Marketing and Communications
CONTRIBUTING WRITERS
Maria StoneDirector of Development
Jennifer FlierlAssistant Director of Marketing and Communications
ART DIRECTION AND DESIGN
McDill Design
PHOTOGRAPHY
James Schnepf
Visual Image Photography
2014–2015 LEADERSHIP
HEAD OF SCHOOL
Laura Fuller
ASSISTANT HEAD OF SCHOOL
Gregg Bach
HEAD OF UPPER SCHOOL
Stuart Cushman
HEAD OF MIDDLE SCHOOL
Pamela Nosbusch
HEAD OF LOWER SCHOOL
Kathy Choren
PRESIDENT, BOARD OF TRUSTEES
Richard Seesel
PRESIDENT, ALUMNI ASSOCIATION BOARD
Tom Parker ’79
PRESIDENT, PARENTS’ ASSOCIATION
Niven Kingwill
To change your address or unsubscribe from the USM Todaymailing list, please contact the USM Advancement Department at 414.540.3339 or [email protected].
At University School of Milwaukee, members of the USM community adhere to the Common Trust and agree to relate to one another and the School with trust, honesty, , fairness, kindness, and the 2014-2015 tenet,
Our senior prefects shared what respect means to them in a series of speeches during ng USM’s Opening Day Ceremony on August 27, and the tenet of respect will resonate throughout the school year in assemblies and gatherings across all divisions.
But most importantly, the tenet will be reflected in how we treat one another throughout hout the school year, as we display the core values and unity that make USM special.
86725 USMTodayFall2014.indd 3 86725 USMTodayFall2014.indd 3 11/4/14 3:26 PM11/4/14 3:26 PM
HEAD OF SCHOOL LAURA FULLER
A YEAR OF CELEBRATION This school year is a
special one for University School of Milwaukee as we
come together to celebrate our 50th year as a school. As
we do so, we also honor the legacies of our predecessor
schools, Milwaukee Country Day School, Milwaukee
Downer Seminary, and Milwaukee University School.
As of Opening Day, we had 1,133 students enrolled—yet
another year of record enrollment—and we owe much of
our excellence as a school to the foundation provided
by our predecessor schools’ histories and successes.
We work hard to make sure our alumni continue to have
a special place in their hearts for their alma mater—
especially during this milestone anniversary year—and
also strive to ensure that alumni of our predecessor
schools feel a special connection to USM as well.
Throughout this year’s “50 Years of USM” celebration,
we will share the story of the coming together of our
predecessor schools in 1964, as well as the stories of
USM’s accomplishments over the past fi ve decades.
We will also look forward and dream, as we envision
the next 50 years and beyond, and think about ways to
continue to build on our well-established traditions of
academic excellence and community.
The feature story in this issue is about USM’s
predecessor schools and our fi rst 50 years as a school,
and this issue includes several inserts, including our
revised Mission Statement and Guiding Principles and a
12-month update on the implementation of our Strategic
Plan. These documents, and all of the work that went into
these processes, remind me of how we are continuing to
evolve as a school, and of just how important that is to
fulfi lling our mission of graduating young adults who are
prepared not only for college, but also for a life of purpose.
Also included in this issue is our 2013-2014 Annual
Advancement Report, which recognizes the support
of our many volunteers and donors who give so
generously of themselves. The work that we do would
not be possible without their gifts of time, talents, and
resources, so I encourage you to join me in offering
a heartfelt thank you to the many people who provide
support in so many ways to USM. We are fortunate to be
able to continually invest in our students and their futures.
We look forward to seeing you on campus and in
your communities this year, as we celebrate the past,
present, and future of this amazing school. Happy 50th
anniversary to all of us!
USM TODAY | FALL 20142
86725 USMTodayFall2014.indd 4 86725 USMTodayFall2014.indd 4 11/4/14 3:26 PM11/4/14 3:26 PM
2014-2015 Board of Trustees
Board of TrusteesFront from left Sangeeta Khanna,
Tamora Martin, Frederick P. Stratton III ’92,
Edie Turnbull, Board of Trustees President
Richard J. Seesel, Head of School Laura J.
Fuller, Andrew A. Petzold, Marina Rosenberg,
and Jon Hopkins. Back from left Karen
Huffman, Patricia Juranitch, Dr. Patricia
Hoben, Sarah Zimmerman ’92, Erskine
Tucker Jr. ’79, R. David Fritz ’81, Stephen F.
Geimer ’78, Linda Mutschler, Gregory
Smith, and Parents’ Association President
Niven Kingwill. Not pictured Deanna Doerr,
Michael Grebe ’85, Stephen Guy, Charles
A. Mellowes ’87, Dr. William Pennington,
and Karin Werner.
USM Welcomes New Trustees
Gregory SmithOCCUPATION
Executive-in-Residence/
Lecturer, University of
Wisconsin-Milwaukee
Lubar School of Business;
Associate Curriculum
Director, American
Bankers Association;
Managing Partner,
Barnett Management
Advisors, LLC
BOARD COMMITTEES
Advancement and
Community Relations,
Finance, and Strategic
Innovation
Tamora MartinOCCUPATION
Partner, ASSAP
BOARD COMMITTEES
Auxiliary Revenue,
Facilities, and
Strategic Innovation
Karin WernerOCCUPATION
Director, Marquette
Legal Initiative for
Nonprofi t Corporations;
Adjunct Law Professor,
Marquette University
BOARD COMMITTEES
Advancement and
Community Relations,
Auxiliary Revenue,
and Facilities
Stephen GuyOCCUPATION
Managing Director,
Robert W. Baird and Co.
BOARD COMMITTEES
Athletics and Finance
Dr. Patricia HobenOCCUPATION
Founder and Head of
School, Carmen High
School of Science
and Technology
BOARD COMMITTEES
Advancement and
Community Relations
3
86725 USMTodayFall2014.indd 5 86725 USMTodayFall2014.indd 5 11/4/14 3:26 PM11/4/14 3:26 PM
events around campus
OPENING DAY 2014In August, our seniors kicked off Opening Day festivities as they entered the Middle School Circle hand-in-hand with senior kindergarten students. The ceremony featured speeches from the 2015 class prefects on the Common Trust tenet of respect; Head of Middle School Pamela Nosbusch rang the ceremonial fi rst bell of the 2014-2015 school year (top left); and a ribbon-cutting ceremony to begin the year was held for our Middle School students at the 8th-grade stairs (top right).
The day was also marked by a series of proclamations (middle right) in celebration of the 50th anniversary of the formation of USM. In honor of the anniversary, August 27 was proclaimed University School of Milwaukee Day by the City of Milwaukee and Milwaukee County. Additionally, the State of Wisconsin issued a certifi cate of commendation recognizing the 50th anniversary of USM.
4 USM TODAY | FALL 2014
86725 USMTodayFall2014.indd 6 86725 USMTodayFall2014.indd 6 11/4/14 3:26 PM11/4/14 3:26 PM
PARENTS’ ASSOCIATION BACK-TO-SCHOOL COFFEEThe USM Parents’ Association welcomed families to campus with a Back-to-School coffee following the Opening Day Ceremony. The coffee gave parents an opportunity to connect with one another and to learn more about how to get involved as volunteers with key Parents’ Association initiatives.
JUNIOR WILDCAT JAMBOREEUSM community members joined together in support of our Middle School during September’s Junior Wildcat Jamboree. This event showcased several of USM’s Middle School interscholastic sports teams, and attendees were treated to a series of snacks and festive activities near Willie’s Corner. They also took aim at several Middle School faculty members who braved the chilly morning to participate in the dunk tank.
5
86725 USMTodayFall2014.indd 7 86725 USMTodayFall2014.indd 7 11/4/14 3:26 PM11/4/14 3:26 PM
SFollowing a week of Homecoming spirit dress days and
the traditional senior pep rally on Wednesday, Friday’s
All-School Pep Rally kicked off the weekend’s activities.
The All-School Pep Rally featured a rousing a cappella
performance by the Upper School Blazers; an ice bucket
challenge answered by Head of Lower School Kathy
Choren, Head of Middle School Pamela Nosbusch, and
Head of Upper School Stuart Cushman; an incredible fi re
twirling demonstration by Margaret BodalskiMargaret Bodalski ’15; and an
appearance by FOX6 sports anchor Tom Pipines, who
later covered the Homecoming football game. The Rally
was capped off by an impromptu dance competition
that pitted USM’s Willie the Wildcat against his mascot
friends Bango the Buck, Bernie Brewer, Roscoe from
the Milwaukee Admirals, and Gill from the Lakeshore
Chinooks. Willie fended off his fi erce competition and was
declared the dance-off champion by the students!
The Pep Rally was followed by the Homecoming BBQ,
held on a beautiful evening behind the Don Forti Stadium
bleachers, where several hundred Wildcat fans gathered
for food and fun prior to the Homecoming football game.
While the Wildcats fell to Brookfi eld Academy 34-13, the
atmosphere was electric.
The festivities continued on Saturday morning with the
Blue and Gold 3K Fun Run/Walk. Entrants of all ages took
part in the run/walk around USM’s scenic cross-country
trail. Our own Willie even joined in for the run! Our younger
Wildcats enjoyed carnival games and bounce houses at
Willie’s Fall Fun Fest in the Middle School Gymnasium.
Von Mansfi eldVon Mansfi eld ’78 spoke at
the Varsity Club Luncheon.
The University School of Milwaukee community gathered in celebration during Homecoming 2014 festivities.
Willie the Wildcat took on
other local mascots in a
dance-off competition at the
All-School Pep Rally.
USM TODAY | FALL 20146
86725 USMTodayFall2014.indd 8 86725 USMTodayFall2014.indd 8 11/4/14 3:27 PM11/4/14 3:27 PM
gSEPTEMBER
18-20
USM went undefeated in three Upper School athletic
events on Saturday, as boys’ soccer defeated Living Word
Lutheran 4-0, volleyball swept Milwaukee Vincent 3-0, and
fi eld hockey routed Divine Savior Holy Angels 13-0 in the
Tessa NowakowskiTessa Nowakowski ’10 Memorial Field Hockey Game.
Former Badgers and Packers standout Von Mansfi eldVon Mansfi eld ’78
closed the Saturday morning festivities with a presentation
at the Varsity Club Luncheon in Mellowes Hall. The
weekend festivities concluded with the Upper School
Homecoming Dance on Saturday evening.
Head of Upper School Head of Upper School
Stuart Cushman conquers Stuart Cushman conquers
the ice bucket challenge.the ice bucket challenge.
7
86725 USMTodayFall2014.indd 9 86725 USMTodayFall2014.indd 9 11/4/14 3:27 PM11/4/14 3:27 PM
In the fall of 1964, University School of Milwaukee
opened its doors, on two separate campuses, for
the fi rst time. The founding of USM was a result of
a merger of three highly respected independent
schools in Milwaukee: Milwaukee Country Day
School, Milwaukee Downer Seminary, and
Milwaukee University School. This represented
the fi rst successful merger of three independent
schools in the United States.
Five decades after that historic merger, the USM
community is excited to celebrate “50 Years of
USM.” Join us for a series of School highlights,
from the merger of three historic Milwaukee
independent schools through USM’s current
standing as the fi nest preprimary through
secondary school in the Milwaukee area and the
state of Wisconsin, and one of the top college
preparatory schools in the country.
8
86725 USMTodayFall2014.indd 10 86725 USMTodayFall2014.indd 10 11/4/14 3:27 PM11/4/14 3:27 PM
9
86725 USMTodayFall2014.indd 11 86725 USMTodayFall2014.indd 11 11/4/14 3:27 PM11/4/14 3:27 PM
University School of Milwaukee: Three Merge Into One
“It seems ridiculous to support three independent schools within
fi ve miles of each other.” - William C. Messinger, former USM
Board of Trustees’ President.
The merger of Milwaukee’s three prominent independent
schools had been discussed since the 1920s, but talks had
failed to gain any traction until the early 1960s, when economic
constraints and the academic and athletic potential of a unifi ed
school helped bring USM to fruition. In a letter from USM’s new
Board of Trustees, it was stated that the merger would “provide
a larger enrollment, greater breadth and depth of curriculum,
a strengthened faculty, and overall excellence as a result of
common leadership.”
While many people only know
USM as the unifi ed school that it
is today, the merger of 1964 was
not a smooth transition. All three
predecessor schools believed in
the superiority of their teachers,
students, and academic offerings,
and that competitive spirit was
identifi ed as the most serious
obstacle to the merger of the
schools. Athletic rivalries also
carried over following the merger,
as MUS and MCDS were fi erce
competitors. During the mid-1930s
the animosity was so strong that
the schools considered severing
their athletic relationship. However,
after some initial misgivings, the
leadership of School luminaries such as Ken Laird, Howard
Boese, and new headmaster F. Gardiner F. Bridge helped to
unify the School. John “J.S.” Stephens even referred to Bridge as
“USM’s Eisenhower who, like the former U.S. president, brought
together disparate factions of the School and gave it a unifi ed,
competent image for the Milwaukee community.” Athletic success
and a familiarity with discipline and tradition also helped to
smooth the transition.
Extracurricular Programs Emerge
Following the assimilation of the predecessor schools, USM
began to carve out its own unique identity. Extracurricular
activities thrived during the 1970s as the most popular of those
extracurricular offerings, USM’s arts and drama programs, both
took shape. The arrivals of Ernie Brusubardis in 1970 and Dale
Gutzman in 1972 helped bolster the programs and launched
several successful careers in the performing arts, including the
career of three-time Tony Award winning actor Mark Rylance
(Mark WatersMark Waters ’78). “There was always a lot of talent here (at USM),”
said Brusubardis. “You just needed to fi nd it and get the students
involved. There was a lot of positive energy within the program
at that time.” Together, Gutzman and Brusubardis collaborated
to produce a series of musicals and took students on the road
to places like Minneapolis, St. Louis, and Nashville, Tenn. to
perform at other independent schools throughout the Midwest.
“Our group grew from 32 students and only four boys when I
fi rst started, to nearly 100 participants,” Brusubardis added. “We
needed two buses to get to Nashville!”
Organizations such as Student
Affairs, Model United Nations,
and the food committee gave
students more control over their
academic environment, while
others refl ected specifi c student
interests. This control refl ected
the popular culture of the 1960s
and 1970s, as students began to
challenge tradition and push for
more freedom and independence
within their educational experience.
Athletic Program Thrives
The USM athletic program
excelled during the 1970s and
1980s, with the merger having strengthened what were already
rich traditions of success on the playing fi elds. USM won
conference championships in football and baseball, and earned
state championships in track and fi eld, boys soccer, cross
country, boys and girls tennis, and boys hockey.
The era also produced some decorated athletes. Von Mansfi eldVon Mansfi eld ’78
excelled as a three-sport athlete at USM before going on to play
for the Wisconsin Badgers and Green Bay Packers in the 1980s.
Lane MacDonaldLane MacDonald ’84 starred for USM’s football and hockey teams
before serving as captain of Harvard’s hockey team. MacDonald
also went on to play for the 1988 U.S. Olympic hockey team.
However, few programs in the state reached the level of Jim
Laing’s boys’ and girls’ tennis teams. After being named boys’
tennis head coach in 1964, Laing’s teams won 36 Midwest Classic
conference titles, 10 Wisconsin Independent School Athletic
IIIIIIIIInnnnnnnnnn aaaaaaaaa llllllllllleeeeeeeetttttttttttttttteeeeeeeeeerrrrrrrrrr ffffffffrrrrrrrrooooooooooommmmmmmmmmmmmmmm UUUUUUUUUUSSSSSSSSSMMMMMMMMM’’’’’’’’ssssssss nnnnnnnnnnnnnnnnneeeeeeeewwwwwwww BBBBBBBBBooooooooooaaaaaaaaaaaaaarrrrrrrrrrddddddddddd oooooooooofffffffffffff TTTTTTTTTTTrrrrrrrrrruuuuuuuuussssssssstttttttteeeeeeeeeeeeeeeeeessssssss,,,,, iiiiiiiiiiiiiiiiiiiiiiiiiittttttttt wwwwwwwwwaaaaaaaassssssssss sssssssssssttttttttaaaaaaaaaaaaaaaatttttttttttttttttteeeeeeeeeeeeeeeeeeeeeeddddddddd tttttttthhhhhhhhhhhhaaaaaaaaaaaattttttttttt tttttttttttttttttttttttttthhhhhhhhhhhhhhhhhhheeeeeeee mmmmmmmmmmeeeeeeeerrrrrrggggggggeeeeeeerrrrrrrrr wwwwwwwwwooooooouuuuuuulllllllldddddddd ““““““pppppppprrrrrroooooooovvvvvvviiiiiiiiiiidddddddddeeeeeeee aaaaaaaa lllllllllaaaaaaarrrrrrggggggggeeeeeeerrrrrrrr eeeeeeeeeennnnnnnnnnrrrrrrrroooooooooollllllllllllllllmmmmmmmmmeeeeeennnnnnnttttttt,,,,,, ggggggggrrrrrrrreeeeeeeeaaaaaatttttteeeeeeeeerrrrrrr bbbbbbbbbbrrrrrrrreeeeeeeaaaaaaaaaaadddddddddddtttttttttttthhhhhh aaaaaaannnnnnnddddddddd
ddddddddddeeeeeeepppppppppptttttttthhhhhhhhhh oooooooooooofffffffff cccccuuuuuuuurrrrrrrrrrrrriiiiiiiiiccccccccuuuuuulllllllluuuuummmmmmmm,,,,,,,,, aaaaaaaaa sssssssstttttttttrrrrrrrrrreeeeeeeeennnnnnnggggggggttttttttthhhhhhhhheeeeeennnnnneeeeeeedddddddd fffffffffaaaaaaaacccccuuuuuuulllllllttttttttyyyyyyyy,,,,,,, aaaaaaaaannnnnnnnddddddd oooooooovvvvveeeeeeeeerrrrraaaaaaaaaaaallllllllllllllllllll exexexexexexexexexex cccccccccccceeeeeeeeeeelllllllllllllllleeeeeeennnnnnncccccccceeeeeee aaaaaaaasssss aaaaaaaa
rrrrrrrreeeeeeeesssssssuuuuuuuuulllllllltttttttt ooooooooffffffffff cccccccccooooooommmmmmmmmmmmmmmmooooonnnnnnnnnnnnnnnn lllllllleeeeeeeeeaaaaaaaaaaaaadddddddddddddddeeeeeeeeeerrrrrrrrrsssssssssshhhhhhhhiiiiiiiipppppppp....””””””
10
86725 USMTodayFall2014.indd 12 86725 USMTodayFall2014.indd 12 11/4/14 3:27 PM11/4/14 3:27 PM
Association (WISAA) team titles and 24 WISAA state individual
titles. Laing also coached girls tennis, beginning in 1971, and won
41 WISAA state individual titles and 12 WISAA state team titles—an
all-time record.
“Coach Laing was an incredible role model who kept things in
perspective for us as players,” said Liz CyganiakLiz Cyganiak ’91 in USM Today
following Laing’s retirement in 2000. “He helped us on and off the
courts. He had energy, spirit, and a great sense of humor that he
shared with us during matches, practices, and on the team bus.”
That excellence still carries on at USM today, as the School was
named the 2013 Interscholastic Sports Program of Excellence,
won the Wisconsin Sports Network Cup, and earned distinction
as Boys’ Athletic Program of the Year, awarded by the Milwaukee
Journal Sentinel. USM is a perennial state power in boys hockey,
girls and boys tennis, and fi eld hockey.
“June Jog” completes campus consolidation as USM unites at River Hills campus
The consolidation of USM at its current River Hills campus had
been a goal for the USM Board of Trustees since the merger, but
plans to unify did not come together until the late 1970s. In 1978,
the Board approved a $6 million fund drive to support unifi cation,
but concerns over leaving the Whitefi sh Bay market and a desire
to increase the Endowment stalled progress on the plan. In
1983, a comprehensive plan to raise money for unifi cation and to
increase the Endowment was announced, and the North Campus
Development Fund raised nearly $11 million, the largest amount
of money ever raised in an independent day school building
campaign at that time.
After years of careful planning and consideration, the USM
campus fi nally united as one on June 8, 1985, as the South
Campus formally moved to the North Campus in River Hills
during an Olympic-style “June Jog” ceremony. The USM fl ag
was lowered for the last time at
the Whitefi sh Bay campus and passed to
prefects Michael GrebeMichael Grebe ’85 and Maria AcevedoMaria Acevedo ’85,
who led the four-and-one-half mile jog to River Hills, where the fl ag
was raised again. A day of festivities to mark the occasion followed,
as USM celebrated its standing as a singular, unifi ed school.
A Formula for Success
Lengthy streaks of success were not limited to the playing fi elds.
An unprecedented run of success in the Academic Decathlon
began in 1986, as USM won eight straight state championships
and emerged as a national power in the event. Following an
eighth-place fi nish in 1985 that represented USM’s fi rst foray into
the Academic Decathlon, USM came back with a vengeance in
1986. Fueled by their initial struggles, USM roared back with its
CloCloCloC ockwckwckwckwkckkk iseiseiseise frfrrom om m m toptoptoptop
VonVonVVonVVVVV n MaMaMaM nsfinsfinsfinsfielelelele d ’d ’d ’d ’d 78 78 78 788 excexcexexce ellellell ed ed at at a
defdefdefddefdefdd ensensnsensiveiveiveive babababackckckck forforfororoo ththtthe Be Be Be BBe adgadgdad ersers
andandanandandan PaPaaPackeckeckekkkckers.rs.rs.r ThThThThe Ae AAe Amermerricaicacaaaan fln fln flagagg
is is sis isis is rairairairairairairaraisedsedsedsedsesessedsessedse atatataaaata ththththe oe oe oe oooffi ffi ffi ficiaciaciaciac l ol ol openpenpenpenp ingingingng
ooof of ofoofofof thethehetthththetttt UpUpUpUpppperperperperpp ScScScS hoohoohoohool ol ooon tn tn tthe he hehe RivRivRR er er
HilHilHilHilHilHilHiHHiHilHHilHHHilHills ls s lssssl camcamcamcamamcc puspuspupu inininn 1919199985.85.8 JiJiJJ m Lm Lm Lmmmmm ainainainaing g
tautautautaaughtghtghtght EnEnEnEnEE gliglilig shshsh andandn reretirtired ed e as as ss oneonenne
of of ofo WisWisWisWisWWWisWisWisWWWWisWisWWW ssWisWWWWWisWisssssW concconcccconconconconcc nconsinsin’s ’s mosmosmosmoo t st succucccccccessessssesssfulfufufulfff
highighigghh h sh sh sh s cchochool ol tentententeneneeeneeeeeeeee nisnisnisnis cocococoachachachachchhes eseses
in inin inii 200200200002 0.0.0.0
11
eeeeeeedddddddd tototototootoo
86725 USMTodayFall2014.indd 13 86725 USMTodayFall2014.indd 13 11/4/14 3:27 PM11/4/14 3:27 PM
fi rst championship,
and a streak
of consecutive
championships
lasted through
1994, when USM
was fi nally knocked off by
Rufus King High School. USM
fi nished as high as third overall nationally in
1988, and won back-to-back small school
national championships in 1992 and 1993.
The success of the program was attributed
to a strong work ethic on the part of USM
students, who balanced their academic and
athletic workloads with the demands of the
Decathlon, as well as exemplary coaching from
former faculty members John Horlivy, Carol
Drummond, Conrad Van Voorst, Brian Pack,
and Steve Bruemmer, among others.
“(Coaches) Brian Pack and Steve Bruemmer
were tremendous educators and even better
people. Their enthusiasm for the material, and
more importantly, the process of independent
learning, was contagious,” said Donald BaeDonald Bae ’88,
a member of the 1987 and 1988 state championship
teams. “This combination of rigor, enthusiasm,
generosity, and friendship was the foundation
for any success we may have had.”
USM Embraces Technology Behind AAT Campaign, New Website
In what was its fi rst capital campaign in more than ten years, USM
broke ground on a series of facility upgrades to enhance the arts,
athletics, and technology (AAT) in the spring of 1995. The old
Middle School gymnasium was converted into a new two-story
Arts center, featuring studios for visual arts, music, drama, dance,
band, and a new atrium. A new Middle School gymnasium was
built adjacent to the Upper School gym.
The fi rst computer network to provide school-wide Internet
access was introduced in 1996, beginning with 40 computers in
the Middle School and Upper School. Classrooms, libraries, and
other School computer labs were phased in later in that school
year. Shortly thereafter, USM also introduced its fi rst website,
which was launched in May of 1997 and included information on
admissions, curriculum, alumni/development, and items available
at the School Store, as USM stayed on the cutting edge of
emerging technology.
150 Years in Milwaukee
USM celebrated a historic milestone in 2002, as former
headmasters F. Gardiner F. Bridge, Robert Johnston, and
Harvey Sperling, along with then-Head of School Ward Ghory
joined students, parents, alumni, and current and former
TopToppp USUSUSUSSSSSSSSSSM wM wM wwwM won onoo eigggeigeigggght httht strstrstrtrtrraigaigaiga ht ht t stastastaas te te AcaAcaAcaademdemdemdemiciccicc DecDecDecDecDecce athathathathathhathha lonlonlonlononlonn chchchchc ampampampamppionionionioni shishishihshshhshh pspspsppp
frofroroom 1m 1m 1m 119869869869869866-19-1-19-191993.9393.9399 MidMiddledle WoWoork rk on on USMUSMU M’s’s’s NexNexNexexN t Gt Gt Gt Geneeneeneeneeeeeratratratratraa ionionionioi CaCaCaCampampampaignignignn
begbegbebegeganananaan in inin earearearearearly lyly ly 2002002002000 5. 5. 55 BotBottomom USUSUSSM sM sM sM studtudtudtudentententents ss ss ss howhowhowh cascascase te te te tee heiheiheiheir pr pr pr projrojojrojectectectectee s ss s
eacaceaceach yh yh yh eareararaaa atataa thththe Ue Ue Uppeppppepp r Sr SSchochochoololo SciSciSciSc encencncce Fe Fe Fe Fe airairairr. SS. SSSeveeveeveeveeveralralralra ststs udeuded ntsntsntsntss hahahahahhahahaaave ve ve veeveveevv
advadvad ancancnced ed ed dd andandan eaeaeae rnernerneneneed rd rd rd rd eceececc nt nt awaawawawaw rdsrdsrdsrd atatat thththe Ie Intentel Il Intentett rnarnanaaatiotiotioioonalnalnalnalnaanaaaa ScScScScienienieniencececec
anddandd EnEnEEnginginging eereereeringinging FaFaF ir.ir.ir
12
ofofofofo ffff bybybybybybybb
86725 USMTodayFall2014.indd 14 86725 USMTodayFall2014.indd 14 11/4/14 3:27 PM11/4/14 3:27 PM
faculty members in celebration of USM’s sesquicentennial,
marking 150 years since the opening of Milwaukee’s German-
English Academy.
The occasion was celebrated at the “Evening to Remember,”
sesquicentennial reception held at the Midwest Express
Center (now the Wisconsin Center). The reception featured a
performance by the USM String Orchestra, “150 Years” videos
produced by USM students, and the opportunity to dance
to the Ernie Brusubardis Band. Ahead of the celebration,
USM’s administrative hallway was transformed into “Heritage
Hall,” featuring a photo display that refl ected the School’s rich
history. Alumni volunteers organized and identifi ed photos
from the archives and selected and hung them throughout the
administrative wing.
USM Ushers In “Next Generation”
By the mid-2000s, USM had several identifi able facility needs.
After years of careful study and planning, the School launched
the Next Generation Campaign in March of 2005. The main
components of this dynamic campaign resulted in the Upper
School addition that now houses the multi-functional Mellowes
Hall and six state-of-the-art science laboratories, the USM Fitness
Center, and upgrades to the Polly and Henry Uihlein Ice Arena.
As construction began, School-wide curricular enhancements
were made to ensure an education in the sciences that was
second-to-none.
A second phase of the campaign began in 2009 and helped to
revitalize the Lower School and Middle School. The three-story
addition to the Lower School included additional classrooms to
house grades 2-4, a computer lab, world language classrooms,
offi ces for the Lower School guidance counselor and the Parents’
Association, additional tutoring and Learning Center space, and
the Marion and Verne Read Gymnasium. Phase II also included
a series of robust new additions for the Middle School, including
the Middle School Commons, a fl exible, multi-functional work
space for groups of students to congregate, work, and socialize.
A large study hall fully equipped with computers was also built
adjacent to the Commons for a private work area. The fi nal
Middle School component was the creation of a new Digital
Media Studio, where students were able to utilize the most
current Macintosh technology for an expanding array of fi ne arts
curriculum that included fi lmmaking, Web 2.0 tools, and digital art.
Addressing the outlined objectives to recruit, retain, and develop
the best faculty in the region; to update aging and dated facilities
and support program initiatives; and to increase the endowment
for School programs, scholarships, and fi nancial aid, USM’s Next
Generation Campaign was a great success that positioned the
School well for years to come.
USM Students Excel at International Science Fair
Perhaps not coincidentally, during this same time period several
USM students made their mark in the fi eld of science at the very
highest international level. The Intel International Science and
Engineering Fair (ISEF) is the world’s largest pre-college science
competition. Millions of students worldwide enter the competition
each year in local and school-sponsored science fairs, with the
winners advancing to regional and state fairs at which the best
earn the opportunity to attend the Intel ISEF.
USM is in the midst of an incredible run of success on the
international level, as the following 10 students have received
awards at the competition since 2003:
Laura JonesLaura Jones ’05, Joseph CrivelloJoseph Crivello ’06, Michael PizerMichael Pizer ’06, Cristina Cristina
CostantiniCostantini ’07, Spencer GreavesSpencer Greaves ’07, Anna ShimshakAnna Shimshak ’09, Meredith Meredith
MarksMarks ’11, Ashton WackymAshton Wackym ’12, Kern KhannaKern Khanna ’13, and Dominique Dominique
TlomakTlomak ’14.
Pizer earned an ISEF award during all four of his years in Upper
School, and took home the fi rst place prize in Physics in 2005. He
was also awarded the Intel Achievement Award, given to only 12 of
1,434 entered projects, at the fair. Thanks to the fi rst class facilities
and top-notch faculty guidance, USM scientists fi gure to continue
to perform well at the Intel ISEF for many future years.
A Strategic Plan for the Future
Today, USM continues to provide an excellent educational
experience to a diverse student body, preparing them for a
lifetime of success. Through its new Strategic Plan, USM aspires
to enhance existing academic programs for current and future
students, ensure its long-term fi nancial stability, strengthen
relationships both internally and externally, and earn the
reputation as a thought leader and resource for primary and
secondary education in the greater Milwaukee and national and
international communities.
This Strategic Plan represents a bold step forward for the School
and, combined with USM and its predecessor schools’ legacies
of excellence, will ensure vibrant success for the School that will
extend for another 50 years and beyond.
13
86725 USMTodayFall2014.indd 15 86725 USMTodayFall2014.indd 15 11/4/14 3:27 PM11/4/14 3:27 PM
JANE KEILY
Preprimary Program and Lower School Physical Education
Teacher Jane Keily is a faculty member and department chair
who “quietly and expertly leads with a positive, collaborative spirit.”
Her departmental focus is on helping students “pursue a lifetime
of healthful physical activity.”
Working alongside longtime colleague, Preprimary Teacher
Margie Voss, Keily believes that physical education works in
tandem with academics and plays a critical role in the education
of the whole child. “The benefi ts of physical education can
affect both academic learning and physical activity patterns of
students. The healthy, physically active student is more likely to
be academically motivated, alert, and successful,” Keily said. “In
the preschool and primary years, active play may be positively
related to motor abilities and cognitive development.”
Keily is a model for the high standards of independent school
teaching—a hard-working, collaborative, creative expert whose
constant smile lets all of us know that she loves what she does
year after year.
KEVIN LINZMEIER
Lower School Learning Center Teacher Kevin Linzmeier is
recognized for his dedication to improving student outcomes and
providing crucial academic support to ensure the success of all
Lower School students.
Linzemeier’s collaborative work with his colleagues has been
instrumental in several important changes to the Lower School
curriculum. Presently, every teacher in senior kindergarten
through 4th grade has been trained in the Daily 5/CAFÉ
framework for reading.
“This framework gives students ample opportunity to practice
what they are learning and to build their reading and writing
stamina,” Linzmeier said. “The CAFÉ component of the reading
block consists of mini-lessons that reinforce strategies needed for
developing comprehension, accuracy, fl uency, and vocabulary.”
Linzmeier models leadership through the extension of self and
his dedication to his own learning that exemplifi es the highest
standards of independent school teaching.
Wright Award WinnersFrom left Lower School Learning
Center Teacher Kevin Linzmeier,
Upper School Math Teacher and
Department Chair Steve Bertucci,
Preprimary Program and Lower
School Physical Education Teacher
Jane Keily, Upper School English
Teacher and Department Chair
Elaine Griffi n, 7th-grade English
Teacher Hannah Reimer, and
Middle School Science Teacher
Kip Jacobs ’74.
USM’s Wright Family Distinguished Faculty Awards honor excellent teachers, who by virtue of expertise, dedication,
and extension of self, exemplify the highest standards of independent school teaching. These teachers serve as
mentors, as inspirations to colleagues and students, and as role models in the community. Since 1992, the Wright
Family Distinguished Faculty Award Fund has existed within USM’s Endowment, providing professional development
support to faculty thanks to the thoughtful generosity of the Wright family. The following faculty members (two per
division) are honored for their exemplary work as 2014 Wright Family Distinguished Faculty Award Recipients.
Six Earn Wright Family Distinguished Faculty Award Honors
USM TODAY | FALL 201414
86725 USMTodayFall2014.indd 16 86725 USMTodayFall2014.indd 16 11/4/14 3:28 PM11/4/14 3:28 PM
KIP JACOBS ’74
Whether you need a garden planted, a workbench made for the
maker space, or a recycling program implemented throughout
the School, Middle School Science Teacher Kip JacobsKip Jacobs ’74 is
your man.
A lifelong learner, Jacobs is ready to jump in wherever he is
needed, and is never afraid to adapt and change.
“As a teacher you have to be willing to take risks and have your
fi nger on the pulse of what you teach,” Jacobs said. “Science is
always changing, and I feel that I need to be willing to change with
it. Not everything will work, but that’s OK. That is the basis of the
scientifi c method.”
Jacobs has also been eager to embrace new technology.
Using an array of new tools and devices, Jacobs has generated
electronic labs, utilized Google Docs for collaboration, and
sought new ways to incorporate the latest technology into
his curriculum.
Jacobs is a consummate professional who is respected by his
colleagues as well as his students and their parents. He is a high-
energy teacher who infl uences colleagues to grow professionally
and to uphold USM standards.
HANNAH REIMER
Transitioning from the corporate world to the realm of education,
Hannah Reimer has brought a tireless work ethic, creativity, talent,
and high expectations to her role as 7th-grade English teacher.
Reimer has always been inspired to move forward in her
profession, and her professional development record speaks
to that quest of continual improvement in order to best serve
her students.
“One of the things that drew me to USM was the emphasis on
professional development,” Reimer said. “There are a lot of
networks around the city, and I was able to build relationships
and connections that have benefi tted my curriculum. Those
connections are all thanks to professional development and
the wonderful support that we receive here.”
Reimer’s network of experts and artists has been instrumental
in building her unit on genocide, culminating in the memorial
project that her students work on during much of the second
semester each year. Students work closely with architects, artists,
and professors from the Milwaukee Institute of Art and Design to
hone their projects, and then present their fi nal memorials to a
professional panel.
STEVE BERTUCCI
Upper School Math Teacher and Department Chair Steve Bertucci
is known as a passionate and fi ery supporter of his students and
the math department.
What is not as widely known is how often Bertucci gives of himself
freely, compassionately, and selfl essly. He is the ideal colleague.
He gives good and constructive feedback, fi ghts hard for his
department as a Chair, maintains an objective perspective in
regard to institutional prerogatives, and volunteers quickly to
take on extra work or manage diffi cult situations.
However, the most important reason that Bertucci is deserving of
this award is for his work with students. He is known for his ability
to help students make connections between the math concepts
he teaches and their real-world application.
“I try to mix in a little humor with the math to break up the lesson,
and fi nd a common chord that might resonate with them,”
Bertucci said.
In addition to those connections, Bertucci is always willing to
provide his students with extra help, working with many students
before and after school. It is an honor to recognize an educator
as dedicated to his students, and teaching, as Bertucci is.
ELAINE GRIFFIN
Upper School English Teacher and Department Chair Elaine
Griffi n is marked by her calm, quick wit, and devotion to her
students. She is a highly respected teacher whose students
look forward to class because of her special mastery at guiding
collaborative round-table discussions. In addition, Griffi n works
tirelessly to help students improve their writing skills.
“Students need to be shown what good writing looks like and how
effective arguments are structured,” Griffi n said. “In class, we
use a technique called ‘workshopping a paper’ in which student
drafts are examined and critiqued by the whole class.”
Griffi n is also willing to consider all perspectives and put herself
in her students’ shoes. She elected to take several Spanish
courses at USM in order to better understand the workload and
perspective of her students.
“Being a student means being vulnerable, and teachers often
forget that,” Griffi n said. “I’m much more empathetic having
been a student so recently.”
To learn more about the Charles F. Wright Technology
and Innovation in Teaching Awards, also given by USM,
visit www.usmk12.org/news.
15
86725 USMTodayFall2014.indd 17 86725 USMTodayFall2014.indd 17 11/4/14 3:28 PM11/4/14 3:28 PM
Steve Johnson brings passion, experience to USM orchestra program
16 USM TODAY | FALL 2014
86725 USMTodayFall2014.indd 18 86725 USMTodayFall2014.indd 18 11/4/14 3:28 PM11/4/14 3:28 PM
First-year orchestra teacher Steve Johnson believes
that music education nourishes a child’s growth and
development, and in his thirty years of experience
working with students across musical disciplines, he
has seen that impact fi rsthand. Research shows that
experiences in music education enhance student
learning by strengthening important cognitive functions,
including the ability to pay close attention and think
critically, and have also been linked to improving a child’s
physical and intellectual development. But he describes
an additional outcome of a quality music education.
“The sense of accomplishment that a student feels
after mastering a challenging passage is very rewarding
for the student,” Johnson said. “The pride that develops
is so important to a student’s sense of self.”
Johnson works with USM students in all three
divisions. He teaches Upper School and Middle School
Orchestra, and works in an after-school setting with two
orchestras in the Lower School—one for beginners, and
one for those with some experience.
“A great thing about leading an orchestra program
that works with students across grade-leveIs is that I
get to see the students develop and grow over time,
both as individuals and as musicians,” Johnson said.
Johnson’s own interest in music stems from growing
up in a musical family. As a child he played piano,
tuba, and later, violin. Another instrument of choice
is his voice. He is currently a member of Midwest
Vocal Express, an international award-winning male
a cappella chorus. His diverse interests and
experiences also include a marching band performance
in the Tournament of Roses’ Rose Parade—a career
highlight. Johnson served as assistant director for
the band.
“Music is my passion,” Johnson said. “I love sharing
that passion, both as a performer, as well as with
my students.”
A little inspiration is sometimes required. The
complexity involved in learning a musical instrument
and the time commitment required to master it can
be challenging.
Johnson encourages his students, telling them,
“You’ve got to learn to budget your time. That’s an
important life skill. But you’ve also got to give yourself
permission to fail. I always tell the students that
permission to fail leads to success. When you fi rst
start working on a piece, I’m giving you permission
to not do it correctly, so give yourself permission to
not do it correctly. But as you practice, you’ll work out
the bugs and you will be successful. That applies to
lots of things outside of music, too. So you see, music
builds skills that transfer to academics, athletics, and
life in general—whether you know it or not. I’m sneaky
like that!”
“Music is my passion,” Johnson said. “I love sharing that passion, both as a performer, as well as with my students.”
17
86725 USMTodayFall2014.indd 19 86725 USMTodayFall2014.indd 19 11/4/14 3:28 PM11/4/14 3:28 PM
USM Welcomes New Director of Enrollment Management
When Eric Peters accepted his position as director of enrollment
and fi nancial aid at The Tatnall School, he told his head of
school he would only leave for one of two reasons: if he
was offered a head of school position at another school,
or if University School of Milwaukee came calling.
Peters answered that call this past summer when he was hired
as USM’s director of enrollment management. He comes to
USM with work experience that varies geographically, but has
always been focused on enrollment. He began his career
working in college admissions at three universities, but missed
the close daily contact with students. It was then that he made
the transition to independent schools by taking a position
as dean of admission and college counseling at Wayland
Academy in Wisconsin—his home state. He then transitioned
to a similar position at Tatnall in 2010, prior to joining USM.
When asked why he pursued a role with USM, Peters
responded that he came here for a few main reasons.
“First, I believe strongly in independent school education.
Second, being able to come back home to Wisconsin was a
major draw. Third, I get to work for one of the top independent
schools in the country.”
Working at USM is a real boon for Peters, both professionally
as well as personally. He enjoys the fact that his job is to
promote the best school in the state. Refl ecting on his new
position at USM, he recalls one of his favorite quotes from
the former head of the National Association of Independent
Schools, Pat Bassett: “Leadership: Why does the tyranny of
immediate demands overwhelm the imperative of addressing
the larger challenges the future demands?” Peters believes
that having a position that allows him to focus on sustainability
in enrollment—and ultimately the sustainability of quality
enrollment for future years—is what will lead USM to
continued success.
USM is also a place he feels he can plant roots. Peters’
wife, Shannon, was hired as a senior kindergarten assistant
teacher at the School, and their twin daughters, BellaBella ’28 and
MonicaMonica ’28, are in junior kindergarten. He and his family are
already feeling part of this welcoming community. They look
forward to the drive to campus each morning and are excited
to become even more involved in the School community and
its traditions for years to come.
“I see USM as a lifestyle, not just a job. I love this school and
relocated from Delaware to be here because I see this as a
‘forever school.’ I can’t say enough about how happy I am to
be here.”
Leadership: Why does the tyranny of immediate demands overwhelm the imperative of addressing the larger challenges the future demands?
USM TODAY | FALL 201418
86725 USMTodayFall2014.indd 20 86725 USMTodayFall2014.indd 20 11/4/14 3:28 PM11/4/14 3:28 PM
Margy Stratton Norman ’84
Greg Smith
How has USM impacted our lives?This year, in celebration of “50 Years of USM,” and in preparation for the next 50 years
and beyond, University School of Milwaukee is focused on increasing contributions
through the Annual Giving Program to support USM’s mission. As the members of the
USM community consider their ongoing support of the School, we ask everyone to
consider: How has USM impacted your life?
Starting here with the co-chairs of the Annual Giving Program, Margy Stratton NormanMargy Stratton Norman ’84
and Greg Smith, we are learning that every person has his or her own reasons for
giving. What are your reasons for supporting our School?
2014-2015 Annual Giving CabinetMembers of the Annual Giving Cabinet are ambassadors of the School’s Annual Giving Program. These volunteer leaders work together to solicit support for the School from alumni, faculty, parents, grandparents, staff , parents of alumni, and friends. We are so grateful for their tremendous eff orts!
Co-ChairsGreg SmithMargy Stratton Norman ’84
Grandparent Division Co-ChairsCarol and Bob Puetz
Alumni Division Co-ChairsF.R. Dengel III ’83Natasha Misra ’04
Parent of Alumni Co-ChairsFred Geilfuss ’71 and Anne Hamilton
Faculty and Staff Division
Lower SchoolPatti Ptak
Middle SchoolAdam Moreno
Upper SchoolRebecca Schwartz
Administrative Staff Julie Piwowarczyk
“Since joining the USM community fi ve years ago, my wife and I have felt strongly about the Annual Giving Program, as it ensures that the exceptional educational experiences that our children have received so far will be available for them in the years to come, as well as for others.
“One of the most important aspects of the Annual Giving Program is the support it provides our dedicated faculty, whether through support for salaries or by providing the most innovative instructional tools. The Annual Giving Program also contributes
to our ability to maintain and upgrade our world-class facilities and build reserves for future maintenance and improvement needs.
“Margy and I want the USM community to recognize that any gift they can give is truly appreciated and makes a positive and immediate difference to the education
of our children.”
Greg Smith and his wife, Nancy, are the parents of CharlieCharlie ’17, LaurenLauren ’19, and HarrisonHarrison ’22.
Additionally, Smith is a new member of the USM Board of Trustees.
“After celebrating my 30th USM reunion this fall, I realized that still quite fresh in my mind are many academic and athletic memories from my years at USM. It is because of memories such as Mrs. Read reading “The Yearling,” to us on the rug in Lower School, visiting authors signing books to me at the Book Fair each year, and memorizing sonnets for Mrs. Hill—along with lessons learned from motivating coaches such as Mr. Bruemmer—that I cannot imagine my children learning anywhere else at this time in their lives.
“These fond memories are why my husband and I send our children to USM. Annual Giving supports the very types of experiences that inspired me and that foster lifelong intellectual curiosity. By serving in this role, I hope to help ensure that the students at USM come away from this great place with fond memories
and a deep love of learning.”
Margy Stratton NormanMargy Stratton Norman ’84 and her husband Greg Norman are the parents of EllieEllie ’19, MimiMimi ’21
and AnnieAnnie ’25. Active in the Parents’ Association for many years, Stratton Norman is currently
co-chairing the author visits for the PA.
19
86725 USMTodayFall2014.indd 21 86725 USMTodayFall2014.indd 21 11/4/14 3:28 PM11/4/14 3:28 PM
www.usmk12.org/annualgiving | 414.540.3336
1. Exceptional education changes lives2. USM is your community 3. Develop tomorrow’s
leaders 4. To honor someone special 5. Pride in your alma mater 6. Passionate and inspiring teachers 7. Outstanding curriculum
8. Designate your gift 9. Gifts are vital to USM’s revenue 10. It feels good11. Celebrate students’ academic excellence 12. Fuel intellectual curiosity
13. Gifts are immediate and impactful 14. Empower our students 15. Spark curiosity16. Create vibrant student life 17. Rich fine arts experiences in all grades
18. It’s your way to give back 19. USM is a top college-preparatory school 20. Preparestudents for the future 21. Help fund a future Nobel Prize winner 22. Your employermatches your gifts 23. Innovative educational practices 24. Inspire School spirit 25. Incredible fi eld trips 26. Championship athletic achievements 27. Create a welcoming,inclusive environment 28. Children are our future 29. Enable alumni to live purposeful lives 30. Supplies for our little Picassos 31. Help set an Annual Giving Program record 32. USM science labs drive innovation 33. Exceptional extracurricular activities 34. Help write USM’s story for the next 50 years 35. Impactful student retreats36. Encourage a lifelong love of learning 37. Foster critical thinking in students38. Cause spontaneous smiles 39. Support hands-on experiential learning
40. Impact every student, teacher, and classroom 41. The Common Trust philosophy42. Changing the world begins here 43. Athletic opportunities for all students
44. Tuition alone doesn’t cover the cost of a USM education45. Make a difference 46. Make a worthwhile investment
47. Giving is contagious (and deductible) 48. Innovative technology 49. Help shape global citizens
50. USM has impacted your life
USM TODAY | FALL 201420
86725 USMTodayFall2014.indd 22 86725 USMTodayFall2014.indd 22 11/4/14 3:28 PM11/4/14 3:28 PM
How has USM impacted your life?As members of our community—parents, alumni, grandparents, parents of alumni, faculty or staff members, or supportive friends—you understand and value USM’s tradition of academic excellence. During this milestone anniversary year, in honor of “50 Years of USM,” consider what you cherish the most about our School, and fi nd your own meaningful reason to join our community of donors.
While in the past we’ve asked for Annual Giving Program support throughout the year, our “50 Years of USM” effort will be featured from November 3 through December 31, 2014. Please consider making your gift today. Together, we can ensure USM’s continued success, both this year and for the next 50 years and beyond.
21
86725 USMTodayFall2014.indd 23 86725 USMTodayFall2014.indd 23 11/4/14 3:28 PM11/4/14 3:28 PM
From delivering singing telegrams in college to delivering
marketing plans for Apple’s Steve Jobs, life has always been
about enthusiasm, hard work, and most importantly, a clear
vision for Liz AllenLiz Allen ’84.
“I’ve been lucky enough to work with some world-class
companies and brands,” Allen said. “I’ve noticed that I gravitate
towards creative opportunities and challenges that appreciate a
strong work ethic.”
Allen currently serves as the chief marketing offi cer for At
Home Group Inc., leading a rebranding effort for a series of home
décor superstores, and has an extensive background directing
marketing efforts for several high-profi le organizations.
After graduating from Butler University, Allen worked for ad
agencies in San Francisco and New York, servicing accounts for
Levi’s and Sprint, among other clients. She was then recruited for
the position of director of marketing at Boston Market, where she
managed fi ve agencies as the brand steward.
But it was upon her return to San Francisco in 1997 that Allen
received an opportunity of a lifetime, as she was hired to work
alongside Silicon Valley luminary Steve Jobs to help rebuild
Apple Computers worldwide.
“In my four years at Apple, we resurrected a company and
created ideas that I was really passionate about,” Allen said.
“During that time, I built an incredible 160-person team that
developed all facets of the worldwide marketing for Apple,
including the Apple stores, Apple.com, e-commerce, product
names, and packaging. It was all-consuming and amazing.”
After Apple, Allen ran marketing for LucasArts, the video game
arm of the George Lucas/Star Wars empire, and then moved to
executive roles with The Gap and Cost Plus World Market before
settling in with At Home.
The origin of much of Allen’s marketing savvy can be traced
back to the balance and scope of her educational experiences
at USM.
“I think USM was really great at providing a liberal arts
foundation and nurtured my creative and analytical abilities in
tandem,” Allen said. “There were so many opportunities available,
in and out of the classroom, to try new things and stretch my
interests and talents.”
Allen credits former Drama Director Dale Gutzman and former
Upper School Music Teacher Ernie Brusubardis for her ability
to create and execute a marketing campaign, much like a fi ne
arts performance.
“Being a lead marketer is much like directing a performance—
setting a vision, inspiring others, and bringing all the details
together to create something fabulous for your audience.”
In retrospect, Allen felt as though she could try and excel at
anything at USM, and credits the breadth of her academic and
extracurricular offerings as foundational to her future success.
“Overall, my School experience instilled a great work ethic
in me and encouraged me to always be curious and open to
learning. I don’t think you can ask for much more than that.”
To read an extended Q and A with Liz AllenLiz Allen ’84,
visit www.usmk12.org/alumniprofi les.
Creativity, Vision Spur SuccessLiz Allen ’84Liz Allen ’84
Liz Allen ’84
USM TODAY | FALL 201422
86725 USMTodayFall2014.indd 24 86725 USMTodayFall2014.indd 24 11/4/14 3:28 PM11/4/14 3:28 PM
Charlie Wright Jr.Charlie Wright Jr. ’04 has taken an unusual path back home to
the Milwaukee area, transitioning from an English major living on
the east coast to his current role as sales and marketing manager
at Rheocast Co., a die casting facility.
The greater Milwaukee community, and University School of
Milwaukee, are glad that he did.
While studying English at Boston College, where he graduated
Cum Laude in 2008, Wright spent summers shoveling sand in
the brass foundry of his family’s business, the Fall River Group.
Wright was instantly hooked on the heat of the furnace and the
glowing molten brass, leading to his path from studying literature
to sales at Rheocast.
“An English degree might not seem like a natural fi t for
manufacturing, but it enables me to think critically when
analyzing business issues, and to think about how to tackle
production challenges in a logical way,” Wright said.
Wright has stayed connected with USM since graduation,
serving on the Alumni Association Board, making annual
giving calls, and attending local alumni events. He is active in
the greater Milwaukee community, as he serves on the Board
of Directors of Goodwill Industries and on the Development
Committee of the Milwaukee Public Museum. He also manages a
charity fund at the Greater Milwaukee Foundation.
“After graduating from college and moving back to Wisconsin, I
wanted to reconnect with the School,” Wright said. “I have great
memories growing up at USM, and I wanted to get involved to
help support the organization in its educational mission because
my experience was so positive.”
One of those local alumni events he attended was Reunion
Weekend 2014, where Wright reunited with his classmates from
the Class of 2004 to learn more about each individual’s journey
since they parted ways as seniors.
“One of USM’s greatest assets is the high quality of your
classmates,” Wright said prior to the Weekend’s events. “I’m really
looking forward to learning about the interesting and diverse
paths that my classmates have taken over the past 10 years. I’m
eager to hear about their accomplishments in life after School.”
Refl ecting on his time at USM, Wright most misses his
engagement with faculty members on a daily basis.
“I truly get nostalgic when I think about everything I learned
from my teachers, and how well-rounded their instruction was,”
Wright said. “Their passion and dedication stimulates excellence
not only in academics, but also in extracurricular activities.”
As the School celebrates “50 Years of USM,” Wright is excited
for the future here.
“The School looks very different today from when I graduated
in 2004. There are additions and renovations happening all over
the place,” Wright said. “It’s a very exciting time and I would like to
see the School continue to invest in its facilities, especially in its
creative spaces like the art studios and theater.”
Liz Allen ’84
Charlie Wright Jr. ’04
Charlie Wright Jr. ’04Charlie Wright Jr. ’04
Committed to Community, School, and Family Business
23
86725 USMTodayFall2014.indd 25 86725 USMTodayFall2014.indd 25 11/4/14 3:28 PM11/4/14 3:28 PM
Reunion WeekendSeptember 18-20, 2014
For the fi rst time in over two decades, University School
of Milwaukee celebrated Reunion Weekend in September,
uniting with Homecoming to bring the entire USM
community together in honor of “50 Years of USM.”
Alumni enjoyed touring the School and taking Alumni enjoyed touring the School and taking
in several classes, including this one led by in several classes, including this one led by
former faculty member John “J.S.” Stephens former faculty member John “J.S.” Stephens
during Friday’s Back-to-School Day.during Friday’s Back-to-School Day.
MDS Class of 1964
MCD Class of 1964
USM TODAY | FALL 201424
86725 USMTodayFall2014.indd 26 86725 USMTodayFall2014.indd 26 11/4/14 3:28 PM11/4/14 3:28 PM
Thursday and Friday EventsFestivities kicked off on Thursday with the annual Welcome Reception
at the Milwaukee Country Club, where USM and predecessor school
alumni enjoyed reconnecting and reminiscing with fellow classmates
and former teachers. Several milestone reunion classes held their
class parties to coincide with the reception, a lovely start to their
multi-day gatherings.
On Friday, USM welcomed alumni to campus to experience a day in
the life of a student. Alumni from the Class of 1964 and earlier enjoyed
the Classics Breakfast, at which Head of School Laura Fuller provided
an update about the School. The Breakfast was followed by campus
tours led by current students and faculty members. Alumni relished
the opportunity to engage in the classrooms and enjoyed connecting
with students and faculty. USM also welcomed retired faculty members
Mary “Peetie” Basson and John “J.S.” Stephens, who both led
engaging lessons in their areas of expertise with many of their
former students. Alumni then cheered alongside current students
during the All-School Homecoming Pep Rally.
To cap off the day’s events, alumni joined current USM families for
food, fun, and fellowship during the All-School BBQ prior to the
Homecoming football game.
Members of the MCD, MDS, and MUS Classes of 1959
Several milestone reunion classes gathered Several milestone reunion classes gathered
at Thursday evening’s Welcome Reception at Thursday evening’s Welcome Reception
at the Milwaukee Country Club. at the Milwaukee Country Club.
25
86725 USMTodayFall2014.indd 27 86725 USMTodayFall2014.indd 27 11/4/14 3:28 PM11/4/14 3:28 PM
Alumni took in a series of USM Alumni took in a series of USM
Homecoming athletic events Homecoming athletic events
on Saturday morning, followed on Saturday morning, followed
by the Varsity Club Luncheon by the Varsity Club Luncheon
featuring Von Mansfi eld ’78 featuring Von Mansfi eld ’78
(third from left below).(third from left below).
The Class of 2004 and the Class of 1979 enjoyed
their individual class parties on Saturday evening.
USM TODAY | FALL 201426
86725 USMTodayFall2014.indd 28 86725 USMTodayFall2014.indd 28 11/4/14 3:28 PM11/4/14 3:28 PM
Saturday EventsContinuing the festivities on Saturday morning, alumni had the
rare opportunity to enjoy a guided bus tour of Milwaukee Country
Day School, Milwaukee Downer Seminary, Milwaukee University
School, and the German English Academy. Led by Lower School
Art Teacher Bob Geniusz and Carolyn and John “J.S.” Stephens, the
tour included a trip through several downtown Milwaukee landmarks
and visits at the predecessor schools’ former locations.
On-campus events concluded on Saturday afternoon with former
Badgers and Packers standout Von Mansfi eldVon Mansfi eld ’78, who delivered an
engaging presentation at the Varsity Club Luncheon. The luncheon
also featured the announcement of the Varsity Club Athletic Hall
of Fame, with the fi rst class to be inducted at a special banquet on
June 6, 2015.
A special thanks goes out to the milestone reunion coordinators for
their efforts in planning and hosting their various class-organized
parties at homes and local venues throughout the remainder of the
weekend, where the celebrations continued.
USM appreciates all of the alumni who participated in the festivities.
Be sure to mark your calendar and plan to join us from September
24-27 for Reunion Weekend 2015!
Alumni enjoyed a guided bus tour of the former Alumni enjoyed a guided bus tour of the former
Milwaukee Country Day School, Milwaukee Milwaukee Country Day School, Milwaukee
Downer Seminary, and Milwaukee University Downer Seminary, and Milwaukee University
School campuses on Saturday morning School campuses on Saturday morning
(three photos at right).(three photos at right).
27
86725 USMTodayFall2014.indd 29 86725 USMTodayFall2014.indd 29 11/4/14 3:28 PM11/4/14 3:28 PM
William L. Randall MUS’48
passed away peacefully on June 23,
2014 at the age of 83. Randall excelled
at tennis during his tenure at Milwaukee
University School and was awarded
“greatest contributor of the year” award
upon graduation. He later received
his bachelor’s degree from Dartmouth
College and a law degree from the
University of Michigan Law School before
serving as an attorney and banker for 37
years, retiring as president and chairman at U.S. Bank.
A lifelong advocate for public service, Randall was a founder and
fi rst president of the United Performing Arts Fund; chairman of the
Performing Arts Center and Boys and Girls Clubs of Greater Milwaukee;
a trustee of the Medical College of Wisconsin; a trustee and board
chairman of the Faye McBeath Foundation; and director of numerous
organizations, including Alverno College and Milwaukee Academy
of Science. At 35, Randall was the youngest president in the history
of the Rotary Club of Milwaukee, and was recognized with honorary
degrees from the Milwaukee School Of Engineering and the Medical
College of Wisconsin. Randall also founded USM’s Alumni Association
Board in 1964 and served as its fi rst president in 1964 and 1965. He
was recognized as the Alumnus of the Year in 1968, an annual award
that preceded the current Alumni Service Award.
Randall is survived by his wife of 59 years, Wendy Shea Randall Wendy Shea Randall
MDS’50; daughters Rebecca Randall (Paul Gigot) and Cynthia
Randall (Paul Albrecht); sons Kip (Karen) and Kevin (Lynn); a sister,
Judy Randall ThompsonJudy Randall Thompson MUS’51; and fi ve grandchildren.
Cindy Zautckespent a peaceful afternoon and evening
with the family she loved, and drew her last,
gentle breath on June 4, 2014.
Zautcke received her bachelor’s degree in
German and English from Luther College,
and earned her master’s in education
at Vanderbilt University. She displayed
an unwavering passion for education
that included work as a teacher, school
founder, classroom volunteer, and charter school advocate. Returning
to Milwaukee in 1990, she taught at-risk students at Grand Alternative
High School, and helped found El Puente High School. Zautcke
later lobbied for the state’s fi rst charter school law, and served as
a policy expert, resource, advocate, and leader for charter schools
in Milwaukee. Over the past 10 years, Zautcke became a parent,
committed volunteer, and leader at University School of Milwaukee,
where she recognized and helped support a community of gifted and
passionate teachers who shaped the lives of her children.
To honor her legacy and commitment to education, the Zautcke-
Ostermeyer family has established the Cindy Zautcke Memorial
Scholarship Fund at USM with the goal of supporting students from
the city of Milwaukee wishing to attend the School. The scholarship
will be awarded to a student from a low- to middle-income family that
demonstrates outstanding achievement in academics, character,
leadership, and community service.
Zautcke is survived by her husband of 29 years, Michael Ostermeyer;
children BillyBilly ’11, JohnJohn ’16, and LizLiz ’17; sister Katy Zautcke Thomas;
mother Ranae Zautcke Stavish, nieces, nephews, cousins, colleagues,
and countless friends.
Charles Spraguepassed away on June 22, 2014, at the age
of 64, at home surrounded by his loving
family and friends, after a brief but valiant
battle with esophageal cancer. As part
of his lifelong dedication to education,
Sprague served as a University School
of Milwaukee Trustee from 2002-2007,
holding positions on the Finance and
Development Committees of the Board.
He was also a member of both the School’s
Next Generation Campaign and Annual Giving Cabinets. Some of
his favorite memories included joining students at Lower School and
Middle School lunch tables, watching USM theater productions, and
following the USM boys’ hockey team to state. He believed in “History
Rules” and the benefi ts of a Harkness roundtable discussion.
Sprague was raised in Short Hills, N.J. and graduated from The Pingry
School in 1967 and Yale University in 1971. After a year of service in the
New Jersey National Guard, he matriculated to New York University,
where he earned joint JD-MBA degrees in 1976. He moved to the
Milwaukee area in 1994 to serve as general counsel and executive
vice president at Fiserv. He retired in February 2014. Sprague was
passionate about reading and learning and served on the Milwaukee
In Memoriam
USM wishes to acknowledge and celebrate the lives of our dearly departed
alumni and friends. We thank them for enriching our lives throughout their friendship.
USM TODAY | FALL 201428
86725 USMTodayFall2014.indd 30 86725 USMTodayFall2014.indd 30 11/4/14 3:28 PM11/4/14 3:28 PM
Public Library’s Foundation Board since 2007. He was also a founding
member of the General Counsel Forum of Milwaukee.
He is survived by his loving wife of 29 years, Mary Hamilton Sprague,
beloved daughter Martha H. Sprague HeitmanMartha H. Sprague Heitman ’06, son-in-law Timothy Timothy
HeitmanHeitman ’06, and brother John Arthur Sprague.
Polly Haebler Van Dyke MDS’51
passed away on August 17, 2014 at the age
of 80.
Van Dyke was born in New Rochelle, N.Y.
in 1933, attended Milwaukee Downer
Seminary through 11th grade, and
graduated from the Masters School in
Dobbs Ferry, N.Y. in 1951. She attended
Connecticut College and later graduated
from Stanford University in 1955.
Van Dyke was a member of the University School of Milwaukee Board
of Trustees from 1968-1978 and served as president from 1973-1976.
She also served as a trustee on the Endowment Board and received
the Alumni Service Award in 1997.
Through their generosity over the years, Polly and her husband William William
MCD’49 established the William and Polly Van Dyke Scholarship Fund
and the William and Polly Van Dyke Endowment Fund, and were
members of the USM Heritage Society as a result of their deferred
gift commitment. Thanks to their thoughtful generosity, their Funds will
continue to support USM students and faculty in perpetuity.
Van Dyke was very active in the Milwaukee community, and served
on the Board of the Milwaukee Foundation; the Board of Directors
at Columbia Hospital and the Planned Parenthood Association of
Wisconsin; and the Board of Trustees at Carroll College. She was
also actively involved with the Milwaukee Symphony Orchestra and
the Green Tree Garden Club.
Van Dyke was preceeded in death by her husband William and her
sister Ann Haebler FrantzAnn Haebler Frantz MDS’48. She is survived by her sister Ellen Ellen
Haebler SkoveHaebler Skove MDS’45; daughters Kathryn Van DykeKathryn Van Dyke ’75, Helen Van Helen Van
Dyke KingDyke King ’79, and Ellen Van Dyke HoltgersEllen Van Dyke Holtgers ’81; and many nieces,
nephews, grandchildren, and other relatives.
John Marshall “Jack” Olson ’67
passed away in Anchorage, Alaska on July
10, 2014 at the age of 65 after suffering a
stroke while traveling with his family. Olson
had a passion for English literature, which
he studied at Princeton University and later
at Oxford University. After earning his J.D.
at Yale Law School, Olson practiced in the
areas of Trusts & Estates and Securities
law at Whyte Hirschboeck and later at
Foley & Lardner, where he spent the bulk
of his career before retiring in 2011. He was known as a trusted and
respected advisor to clients, friends, and family.
Olson loved hunting, fi shing, and spending time with his grandchildren.
He served on the University School of Milwaukee Board of Trustees
from 1980-1985.
Olson is survived by his daughter Sarah Olson ZimmermanSarah Olson Zimmerman ’92 and
son JohnJohn ’95; brother MarkMark ’65; sister DoryDory ’70; and grandchildren Joe Joe
ZimmermanZimmerman ’22, Nate ZimmermanNate Zimmerman ’25, Hedda, Maya, and Sarah Olson.
Constance Pember Godfreydied peacefully at home on August 4, 2014
at the age of 84.
Born in Janesville, Wis., Godfrey was a
dedicated mother to her three sons. She
also was very active in the community and
served as a board member or volunteer
for the Old Indian Agency House, Henry
Francis duPont Winterthur Museum, the
Layton Art Collection, Kilbourn Town
House, the Milwaukee Art Museum, Gunston Hall, the Colonial Dames
of Wisconsin, the Junior League of Wisconsin, and the Woman’s Club
of Wisconsin, among other charitable causes.
Godfrey was preceded in death by her son PieterPieter ’77 and her husband
Dudley Godfrey, Jr. She is survived by her sons Dudley IIIDudley III ’74 and
Adam Adam ’80, and by her fi ve grandchildren Ella Ella ’18 (attended through
8th grade in 2014), Mercy Mercy ’20, Connor, Alyssa, and Ryan.
29
86725 USMTodayFall2014.indd 31 86725 USMTodayFall2014.indd 31 11/4/14 3:28 PM11/4/14 3:28 PM
Updated as of October 20, 2014.
1930s
Florence Bruemmer MahnkeMUS’33August 11, 2014Milwaukee
Walter A. CarlsonMUS’35September 4, 2014Mequon, Wis.
Robert C. BrumderMCD’36October 3, 2014Hartland, Wis.
1940s
William F. Pabst Jr.MCD’42May 28, 2014Port Ludlow, Wash.
Margaret Gregory ReiterMDS’42August 15, 2014Mequon, Wis.
Betty Heinemann BurnsMUS’43May 15, 2014Milwaukee
Donald SimonsMUS’43May 10, 2014Stevens Point, Wis.
John H. SprouleMCD’45August 20, 2014Oconomowoc, Wis.
William L. GuerinMUS’47September 12, 2014Baraboo, Wis.
Thomas R. HendeeMUS’47August 12, 2014New York
Francis D. MurphyMCD’49November 23, 2013San Anselmo, Calif.
1950s
Arthur M. HewittMUS’51July 11, 2014Nashotah, Wis.
Kathyrn Dineen WristonMDS’56September 28, 2014New York
1960s
Jane Innes McGibbonMUS’63July 18, 2014New York
Stephen N. Inbusch’67July 5, 2014Spring, Texas
William K. McKibbage’69March 11, 2013Oakfi eld, Wis.
Van A. Smith’69July 14, 2014Shorewood, Wis.
1980s
Claire J. Ritchie’85August 31, 2014Chicago
FRIENDS
Peggie Hunkel BaumannMother of Tom BaumannTom Baumann ’72, Barbara BaumannBarbara Baumann ’73, and Tracey MooreTracey Moore ’71; Grandmother of Geordy BaumannGeordy Baumann ’04 and Teddy BaumannTeddy Baumann ’09September 19, 2014River Hills, Wis.
In Memoriam
USM wishes to acknowledge and celebrate the lives of our dearly departed
alumni and friends. We thank them for enriching our lives throughout their friendship.
Marion Chester Read MDS’37 passed away and joined her
beloved husband of 63 years Verne R. Read on October 21, 2014.
Additional coverage of her life and contributions to University School
of Milwaukee will appear in the Winter 2015 issue of USM Today.
USM TODAY | FALL 201430
86725 USMTodayFall2014.indd 32 86725 USMTodayFall2014.indd 32 11/4/14 3:28 PM11/4/14 3:28 PM
40sALEXANDER L. ALEXANDER L. PATERNOTTEPATERNOTTEMCD’40enjoys playing bridge and reading, and
wants you to keep the USM news coming!
50sMARY POLLOCK MARY POLLOCK MUELLERMUELLER’59is newly remarried. She is sorry to be
unable to attend her 55th reunion in
Milwaukee. Her husband, Mike Boughton,
is a Caltech physicist who retired from
TRW. “Knowing what I didn’t learn from
Downer in the sciences, this will give ‘the
girls’ a laugh; I continue with art but now
read SCIENCE magazine! My new last
name is Mary Pollock Mueller Boughton.”
90sCURT THOMPSONCURT THOMPSON’94is living in Seattle and has recently changed
jobs. He was previously managing the
fi eld marketing of vitaminwater for many
years, but is now leading marketing
efforts for fi rst aid shot therapy. It’s a
small brand, but the company has big
ambitions of changing the way people
take their over-the-counter medication.
KATHRYNE MARTIN KATHRYNE MARTIN NELSONNELSON’99shared that “Last September, my
husband and I became owners and
directors of Camp Kamaji, a 100-year-old
residential summer camp for girls located
in Northern Minnesota. Kamaji is a home-
away-from-home for girls ages 7-15, and
even for many USM alums such as Julia Julia
Housiaux CaldwellHousiaux Caldwell ’99, Kathy Jacobs Kathy Jacobs
HousiauxHousiaux ’68, KK McGregor NeimannKK McGregor Neimann
’93, Jessica NashJessica Nash ’06 and me! Jason
and I are so excited to be the current
caretakers of such a special place with
so much wonderful history.”
00sJONATHAN R. LHOSTJONATHAN R. LHOST’00received his Ph.D. from the University
of Texas, and has accepted a teaching
position at Lawrence University beginning
in September. He covered the world, from
Abu Dhabi to Oregon, with applications and
will end up working 90 miles from home.
KATIE HINKLE AND KATIE HINKLE AND TOM BURKETOM BURKE’03were married in Milwaukee on Saturday,
August 16. Tom is a Ph.D candidate
in Cell and Molecular Biology at the
University of Chicago, and Katie will
be joining the Chicago offi ce of Sidley
Austin LLP as an associate attorney in
September. Many of their friends from the
Class of 2003 joined in their celebration!
STEPHANIE BLACKSTEPHANIE BLACK’08moved back to Milwaukee to pursue a
Master of Science in Human Nutrition
degree and become a registered dietitian.
The program is online through Eastern
Michigan University, and the internship
component is here in Milwaukee with
Wheaton Franciscan Healthcare.
IAN TONNERIAN TONNER’09
married Sarah Breunig on August 9 in
Southwestern Wisconsin. From left 2009
USM classmates Brianna BeckBrianna Beck, Andy ReadAndy Read,
John Luckey Jr.John Luckey Jr. (front), Syed MedhiSyed Medhi (behind),
Ian TonnerIan Tonner, Arjun SawhneyArjun Sawhney (front), Michael Michael
LuckeyLuckey (behind), Lauren FredrickLauren Fredrick, and
Lauren SeeselLauren Seesel. Ian is a process engineer
with Babcock and Wilcox-Megtec Systems,
and Sarah is an E-Commerce Digital
Media Specialist with ShopKo. Ian and
Sarah are both 2013 graduates of the
University of Wisconsin-Madison and
reside in DePere, Wis.
10sHALEY FLAGSTADHALEY FLAGSTAD’14
is a freshman at St. Norbert College and
is a cheerleader for the Green Knights.
She will also cheerlead for the Green Bay
Packers during their 2014 season. Look for
her at Lambeau Field when you’re there!
class notesTHE FOLLOWING PAGE INCLUDES NEWS AND NOTES SUBMITTED PRIOR TO SEPTEMBER 15, 2014
Save the date
for two USM events in Longboat Key and for two USM events in Longboat Key and Naples, Fla. on Thursday, February 12, 2015. Naples, Fla. on Thursday, February 12, 2015. Contact Contact [email protected]@usmk12.org for more for more event information.event information.
To submit a class note: Email your news to [email protected] your news to [email protected]
31
86725 USMTodayFall2014.indd 33 86725 USMTodayFall2014.indd 33 11/4/14 3:28 PM11/4/14 3:28 PM
In 2007, I was a new parent at University School of Milwaukee, having just moved from the Chicago
area. My three boys were entering prekindergarten, senior kindergarten, and 2nd grade, my head
was still spinning from adapting to a new city, house, and school, and yet even at that time, I felt
strongly that USM was the right place for us. I felt that even more after I discovered the incredibly
engaged parent community and the seemingly endless ways to get involved through the Parents’
Association (PA).
Seven years later, I fi nd myself serving as the President of the PA, the umbrella organization
through which parents collaborate and share their time and talents to help provide their children
with the best educational experiences possible. The PA contributes approximately 18,000 volunteer
hours to the life of the School each year, with two-thirds of these hours directly supporting teachers,
administrators, students, and fellow parents, including activities such as assisting with the Preprimary
and Lower School car circles, volunteering for Middle School lunch tables, and organizing Upper
School dances, just to name a few.
The remaining third of our volunteer hours is devoted to fundraising, through a couple of large
traditional events, such as Holiday Shops and Rummage at the Rink, as well as some smaller ones.
Parents’ Association contributes the net proceeds of our fundraisers, which is currently around
$225,000 per year, to the School for capital improvements. We spend an additional $40,000
annually sponsoring School programs and events on a class-wide, division-wide, or School-wide
basis, including assemblies, author visits, Grandparents and Special Friends Day, and Arts Live.
My involvement in the PA is a rewarding one, and I am humbled to serve in my role as President
this year. I am proud of all the ways that our parents fi nd to give back to their children’s school,
since their involvement is critical to the success of USM.
Parents’ Association Board Front from left Megan Wallskog, Jane Lacy, Lisa Wright,
Parents’ Association President Niven Kingwill, Jennifer Reese, and Colleen Polston.
Back from left Nancy Smith, Patricia Fritz Kauffman, Marie Tucker, Melissa Sheppard,
Stacey Radke, Molly Fritz, Jennifer Schoon, and Kristin Sheehan.
Parents’ AssociationBoard 2014-2015
PresidentNiven Kingwill
President-ElectMolly Fritz
TreasurerNancy Smith
SecretaryLisa Wright
Preprimary CoordinatorColleen Polston
Lower School CoordinatorJane Lacy
Middle School CoordinatorMegan Wallskog
Upper School CoordinatorMarie Tucker
Nominations CoordinatorJennifer Reese
Volunteer CoordinatorJen Schoon
Communications CoordinatorMelissa Sheppard
Special Events CoordinatorSara LeBrun-Blashka
Past-PresidentStacey Radke
President Niven Kingwill
Parents’ Association: Our Parents Give Back
USM TODAY | FALL 201432
86725 USMTodayFall2014.indd 34 86725 USMTodayFall2014.indd 34 11/4/14 3:28 PM11/4/14 3:28 PM
Inspiration can come from a variety of places. For Megan DograMegan Dogra ’17,
it was an assembly speaker that inspired a fi erce call to action during
her freshman year. Dr. Lalita du Perron, associate director of the
Center for South Asia at the University of Wisconsin-Madison,
gave a lecture addressing modern-day issues in India that struck
a chord within Dogra, who had just recently joined USM’s Global
Scholars Program.
“Her passion and the issues she was involved with really inspired
me,” Dogra said.
Following the assembly, Dogra conducted her own research
and discovered the tragedy and aftermath of the Bhopal gas
leak disaster on December 3, 1984. More than 40 tons of methyl
isocyante leaked from a carbide plant in Bhopal, India, forming a
gas cloud over the city of 500,000 people. Gas inhalation killed
more than 8,000 individuals, and that number grew to more than
20,000 over the weeks and months that followed. Waste from the
leak still impacts families today, with an estimated 200,000 people,
mostly children, suffering from chronic illnesses related to the leak.
“I wanted to be the voice of these poor, unfortunate, and illiterate
people who have been suffering for more than three decades,”
Dogra said.
Dr. Henry Wend, director of USM’s Global Scholars Program,
connected Dogra with du Perron, and those two got to work raising
funds and awareness for the people of Bhopal. Dogra created a
Facebook page to raise money for second- and third-generation
victims of the leak, with proceeds benefi tting a nutrition program
that provides free meals at the Chingari Rehabilitation Center
in Bhopal.
Dogra also visited Bhopal this past March and met with survivors
and their families. During her visit, she shot footage to be used for
her documentary entitled “Assist Bhopal.” The fi lm was shown at
the Milwaukee Film Festival in September, as part of the Milwaukee
Youth Show.
“What really struck me from speaking with these families is the hope
that they still have,” Dogra said. “Their spirit and resilience has truly
stuck with me.”
Dogra is also planning a benefi t dinner with Ben York, USM’s
service leaning coordinator, at the Bollywood Grill in downtown
Milwaukee this December.
“I witnessed so many powerful, moving experiences during my time
at the clinics,” Dogra said. “I wanted to use the footage to provide a
window for my audience to see what I saw and make a connection
to those people.”
Megan DograMegan Dogra ’17 spends time with a small group in Bhopal, India.
Global Scholar Answers Call to “Assist Bhopal”
33
86725 USMTodayFall2014.indd 35 86725 USMTodayFall2014.indd 35 11/4/14 3:28 PM11/4/14 3:28 PM
preprimary teachers “Think Big” during trip to Italy BY MARGARET MACKEDON BROWNE, SUE JEFFERS & JEN KEPPLER
Think Big Fund
Thanks to the generosity of a USM family during the Next Generation Capital
Campaign, the Think Big Fund was established as a named fund in USM’s
Endowment. Since 2002, the Think Big Fund has provided substantial
professional development opportunities for our faculty on an annual basis,
distinguishing USM from our peer schools. This generous funding helps to
attract and retain talented educational professionals and maintains USM’s
position as an educational leader in the Milwaukee community.
From left:From left: USM Preprimary Teachers USM Preprimary Teachers
Margaret MacKedon Browne, Sue Jeffers, Margaret MacKedon Browne, Sue Jeffers,
and Jen Keppler traveled to Italy to learn and Jen Keppler traveled to Italy to learn
more about the Reggio Emilia Approach more about the Reggio Emilia Approach
to early childhood education.to early childhood education.
USM TODAY | FALL 201434
86725 USMTodayFall2014.indd 36 86725 USMTodayFall2014.indd 36 11/4/14 3:29 PM11/4/14 3:29 PM
During last year’s frigid Milwaukee winter, as University School
of Milwaukee was forced to declare several “cold days” due
to the extreme weather, we decided to act upon our dream
to travel to Italy and learn more about the Reggio Emilia
Approach to early childhood education. This Approach is an
inspiring educational model in which children are viewed as
strong, capable, and competent. It puts into practice many
of the fundamental aspects of the work of John Dewey, Jean
Piaget, Lev Vygotsky, and connects to the more recent work of
Howard Gardner’s multiple intelligence theory. The curriculum
emerges from the interests of the children. The teachers act
as researchers by providing opportunities, materials, and a
framework for children to explore, problem-solve, and make
conclusions, weaving skills and outcomes into the project work.
The environment acts as the “third
teacher” and enhances the
learning experience.
As USM continues to implement
its Strategic Plan, based around
learning in new and more creative
ways, we were eager to observe,
discuss, and learn fi rst-hand
in order to make authentic,
experiential learning the hallmark of
our Preprimary Program practice. A
cold day away from School gave us the time needed to begin
a grant proposal that would soon take us to a quaint little
municipality in northern Italy where the youngest of children
learn in some of the best early childhood programs in
the world.
In Reggio Emilia, children are thought to have many ways
of learning, showing understanding, and expressing their
interests and creativity. These ways are referred to as “The
Hundred Languages of Children,” and describe one hundred
ways of thinking, creating, dancing, singing, acting, exploring,
and learning. Teachers provide simple materials and guide
learning based on student interests, while children work
collaboratively and gain knowledge through their explorations
and investigations. Children and teachers work together to fi nd
answers to questions. Teachers observe and guide students, and
document and revisit topics of interest to deepen understanding
and represent learning.
Our study tour in Italy was simply amazing. Each morning after
a long walk from our hotel, we gathered in the conference
center—a space dedicated to the teaching of educators from
around the world—to discuss the approach. We met teachers
from near and far, and collaborated and built relationships with
early childhood educators from similar independent schools
in Illinois, Massachusetts, and Missouri. In the afternoon, we
explored project-based learning exhibitions and visited area
preschools. We found small schools with simple classrooms
where very purposeful learning
was taking place. The culture of
the city surrounding the schools
was inspirational. We were struck
by the lack of technology in the
public setting, but amazed at the
use of technology as a learning tool
within the classrooms. Seeing the
children engaged in learning within
their environment was extremely
valuable. Evenings were spent
exploring the city, networking with
many educators, and, most importantly, discussing, refl ecting,
and digesting what we had learned during the day.
Three months later, we continue to marvel at the experience we
had in Italy. We look forward to sharing what we’ve learned with
fellow USM educators and our students and their families, and
integrating much of what we learned into our teaching practice.
Our time together was wonderful and we bonded as colleagues,
happy to have shared this experience together. We are forever
grateful to teach at a school that values professional development.
We were encouraged to “Think Big” and explore the world to
fi nd inspiration that will lead us to continue being the best we
can be, and we did just that.
E,
Teaching is a Teaching is a profession for not profession for not
thinking small.thinking small.LORIS MALAGUZZI
,
From left: USM Preprimary Teachers
Margaret MacKedon Browne, Sue Jeffers,
and Jen Keppler traveled to Italy to learn
more about the Reggio Emilia Approach
to early childhood education.
35
86725 USMTodayFall2014.indd 37 86725 USMTodayFall2014.indd 37 11/4/14 3:29 PM11/4/14 3:29 PM
Bringing Ideas to the Table:Inquiry, Exploration Thrive in Upper School Roundtable Discussions
The presentation and exploration of ideas, a staple of
University School of Milwaukee’s Upper School curriculum,
is perhaps best personifi ed in the School’s roundtable-style
English and Humanities courses.
Originated from the oval “Harkness” table popularized by
the Phillips Exeter Academy beginning in the 1930s, the
roundtable format allows for the exchange of ideas in an
environment in which each student is an active participant.
“Each class really becomes its own community, with its own
fl avor and personality,” said 9th-Grade English Teacher Kate
Gay. “As opposed to just responding to a question, students
must actively prepare and engage with one another in class.
In this way, everyone brings something to the conversation.”
Instead of setting up tables in rows facing a Smartboard and
a lecturing teacher, the format brings all students face-to-face
as they develop key verbal and non-verbal communication
skills. It also encourages students—in an increasingly
technology-centric educational era—to hone essential
interpersonal skills and be present in the moment with
their classmates.
“Looking someone in the eye and explaining an idea in a
clear, concise way will never go out of style,” said Upper
School English Teacher and English Department Chair
Elaine Griffi n. “That skill will always be essential. The format
encourages students to be present in this era of technology
and to develop confi dence in their ability to present contextual
evidence and ask interpretive questions.”
Students work through a Students work through a
text in Kate Gay’s 9th-grade text in Kate Gay’s 9th-grade
English class.English class.
USM TODAY | FALL 201436
86725 USMTodayFall2014.indd 38 86725 USMTodayFall2014.indd 38 11/4/14 3:29 PM11/4/14 3:29 PM
This shared-inquiry model allows daily discussion to be driven
by student interests, since students are able to take the lead
in presenting concrete evidence to support their thoughts,
develop critical thinking skills to articulate their points, and
utilize the freedom to fi nd their own voice.
However, the teacher still plays an essential role—as
facilitator—to keep the group on task and discussion
focused on the text.
“My role is to ask provocative questions and bring the
discussion back to the text,” Griffi n said. “Our students
always fi nd fresh new ways to interpret the text, often
unearthing ideas I hadn’t considered previously. I learn so
much from them, and try to expose them to new ways of
thinking as well. It’s about the process.”
The method also has practical long-term value in preparing
students to talk through and resolve problems in a group
setting, a valuable skill in today’s job market.
“It is great training in terms of developing public speaking
and critical thinking skills, really some of those ‘board room
skills,’ and learning how to debate and defend their ideas in
a civil manner,” Griffi n said. “At its core, the method teaches
students how to think critically through literature.”
37
86725 USMTodayFall2014.indd 39 86725 USMTodayFall2014.indd 39 11/4/14 3:29 PM11/4/14 3:29 PM
After a season of honors, championships,
and accolades, the University School of
Milwaukee athletic program is hungry to
build upon the success of the 2013-2014 season.
“We were fortunate enough to be honored, in one year, for our overall institutional
program as well as the success of our individual teams,” USM Athletic Director
Rick Johns said. “It’s rare to be recognized for both.”
That recognition included being named one of two recipients of the Interscholastic
Sports Program of Excellence award by Coach and Athletic Director magazine, which
honors the nation’s best programs for their overall commitment to promoting a positive
experience for student-athletes. USM also earned two performance-based awards, as
the program was honored by the Milwaukee Journal Sentinel as a Program of the Year,
and took home the Wisconsin Sports Network Cup in the small school division. Both
awards were based on a points-system that rewarded competitive success in boys’ and
girls’ sports.
But 2014-2015 is a new year, and Johns is intent on fi nding ways to continue to grow the
depth and richness of the program.
“It’s great to have highs like this but we can’t rest on our laurels,” Johns said. “We need
to challenge ourselves to get better, to identify areas that need improvement, and to
work hard on those areas.”
Johns identifi ed building the USM lacrosse program as a focal point, especially at the
Lower School and Middle School levels. A summer LaxCats lacrosse camp was held
on campus last spring, as the program continues to pursue opportunities for growth.
In addition to the development of the lacrosse program, the program is also working
on additional ways to create more connections between athletes across divisions. A
new “Wildcat Fan” initiative, introduced this year by Lower School Athletic Coordinator
Michael Sweet, will pair Upper School mentors with Mighty Cat athletes to help teach
them the fundamentals during their after-school practices. The Mighty Cats then
become designated “fans” of their mentors and engage with
them in a variety of ways, including decorating their lockers
before big games.
“We want to build a strong foundation here and give our
students the opportunity to see what is ahead for them,”
Johns said.
The USM boys’ tennis team capped USM’s 2013-2014 athletic season by winning the WIAA Division 2 state team championship for the eighth time in nine years in June.
Djdade Denson ’14 won the WIAA Division 2 state championship in the triple jump
and placed second in the long jump.
Students from grades 1-8 participated in the LaxCats instructional camp held at USM from April through June.
“It’s all about building those positive connections through athletics and encouraging our young athletes to grow.”
38 USM TODAY | FALL 2014
86725 USMTodayFall2014.indd 40 86725 USMTodayFall2014.indd 40 11/4/14 3:29 PM11/4/14 3:29 PM
The Varsity Club is pleased to recognize generations of outstanding athletic
tradition at University School of Milwaukee and its predecessor schools through the
establishment of the Athletic Hall of Fame. The Varsity Club Athletic Hall of Fame will
forever commemorate a long legacy of exceptional performances and contributions by
former athletes, coaches, teams, and distinguished contributors, while recognizing the
important role of athletics within the culture of the School.
“I am excited about the opportunity the Hall will afford the many coaches and student-
athletes whose signifi cant accomplishments during their time at our schools will be
appropriately recognized,” said Maurie Daigneau, director of special giving at USM.
“The world of sport is an arena that brings forth exceptional qualities and skills in people, and this Hall of Fame will be created to recognize the most exceptional of those accomplishments,” Daigneau said.The intention is that the Hall of Fame will also serve to add historical signifi cance to
participation in USM athletics and inspire current and future athletes by honoring the
many standouts from each of the school’s storied histories.
“The Varsity Club Athletic Hall of Fame will connect different generations of athletes
and unite them in the alumni community,” said Holly PalinHolly Palin ’02, a four-sport USM
athlete who served on the initial Hall of Fame creation committee. “That is what
makes this so special.”
All community members from USM and its predecessor schools will have the
opportunity to nominate a student-athlete, coach, team, or distinguished contributor
through December 1 of each induction year. Classes will be inducted every two years.
The inaugural Varsity Club Athletic Hall of Fame Induction
Banquet will be held on Saturday, June 6, 2015Saturday, June 6, 2015.
For more information or to submit a nomination for
the Varsity Club Athletic Hall of Fame, please visit
www.usmk12.org/athletichalloffame or email
Maurie Daigneau at [email protected].
39
86725 USMTodayFall2014.indd 41 86725 USMTodayFall2014.indd 41 11/4/14 3:29 PM11/4/14 3:29 PM
This article appeared in the Sunday, September 8, 1963 edition of the Milwaukee Journal.
Merger to Go Into Effect in Fall of 1964New Institution to Be Called the University School; It Will Have
Two Campuses.Consolidation of Mil-
waukee Downer seminary, Milwaukee University School, and Milwaukee Country Day School into a single, private institution was announced Saturday.
The merger, approved by the three schools’ boards of trustees and separate meetings, will take effect in September, 1964.
Financial factors and the potential for achiev-ing extremely high quality education by pooling resources led to
the decision.“Everyone concerned
is convinced that the children of this commu-nity will profit by the consolidation, and that it will prove an outstanding contribution to educa-tion at large,” said a letter mailed Saturday to par-ents, alumni, and friends of the three institutions.
1,100 Enrollment Forecast
The merged institution will be named University School, Milwaukee. It is expected to have an ini-tial enrollment of 1,100 boys and girls in nurs-
ery school through high school.
It will operate on two campuses—the present Downer Seminary, 2100 W. Fairy Chasm rd, River Hills, to be called North campus, and the Country Day School, 6401 N. Santa Monica blvd., in Fox Point and Whitefish Bay, as South campus. They are about fi ve miles apart.
Trustees said the consol-idation would provide an endowment of more than two million dollars.
Votes UnanimousDecades of tradition,
school spirit, and family
feeling faced the board members as they held separate meetings Friday noon. Collectively, the three schools have 273 years of history behind them. Downer Seminary dates back to 1848, MUS to 1851, and Country Day to 1917.
The votes of all three boards, however, were unanimous, the chairman said.
The 6.3 acre MUS cam-pus at 2033 E. Hartford av. is to be sold for $2,300,000 to the University of Wis-consin for expansion of the University of Wis-consin – Milwaukee’s
Kenwood campus under an agreement announced July 30. The new merger is expected to make the property available to UWM one year earlier.
On June 30, MUS said it planned to build a new campus on a 40 acre tract it owns in River Hills, across the road from Downer seminary.
But offi cials of all three schools decided that the MUS decision to leave its present campus and get a substantial sum of money for its sale brought about the right conditions for negotiating the consoli-dation.
a look back
To read the article in its entirety,
visit www.usmk12.org/50yearsofUSM.
40 USM TODAY | FALL 2014
86725 USMTodayFall2014.indd 42 86725 USMTodayFall2014.indd 42 11/4/14 3:29 PM11/4/14 3:29 PM
nov18Parent Education – USM’s Strategic Plan with Head of Middle School Pamela Nosbusch
19Upper School Band, Orchestra, and Choir Concert
21Upper School Parent Coffee
dec3Middle School Parent Coffee
5-6Middle School Fall Play
10All-School Holiday Concert
17Middle School Band and Orchestra Concert
18Preprimary Holiday Sing
jan14Grades 5-6 Choral Concert
21Grades 7-8 Choral and World Drumming Concert
23Upper School Parent Coffee
20Celebrate our Seniors Parent Event
25USM Community Book Club Event
26Grandparents and Special Friends Day
Young Alumni Brunch
13USM Community Book Club Event
27-30Lower School Book Fair
29Lower School Show and Share Night
a look aheadUPCOMING EVENTS THROUGH FEBRUARY 01, 2015
September 24-27, 2015
Homecoming & Reunion WeekendSeptember 24-27, 2015
save the date!41
86725 USMTodayFall2014.indd 43 86725 USMTodayFall2014.indd 43 11/4/14 3:29 PM11/4/14 3:29 PM
2100 West Fairy Chasm RoadMilwaukee, WI 53217
ADDRESS SERVICE REQUESTED
On June 8, 1985, University School of Milwaukee celebrated the move from the South Campus to the unifi ed Fairy Chasm Road campus with a day of festivities and fun.
86725 USMTodayFall2014.indd 44 86725 USMTodayFall2014.indd 44 11/4/14 3:29 PM11/4/14 3:29 PM