Tutorial 11

32
Tutorial 11 RNA Structure Prediction

description

Tutorial 11. RNA Structure Prediction. RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan – microRNA prediction. RNA secondary structure types. Rfam. http://rfam.sanger.ac.uk/. - PowerPoint PPT Presentation

Transcript of Tutorial 11

Page 1: Tutorial 11

Tutorial 11

RNA Structure Prediction

Page 2: Tutorial 11

RNA Structure Prediction

• Rfam – RNA structures database

• RNAfold – RNA secondary structure prediction

• tRNAscan – tRNA prediction

• TargetScan – microRNA prediction

Page 3: Tutorial 11

RNA secondary structure types

Page 4: Tutorial 11

Rfam

• The Rfam database is a collection of RNA families, each represented by multiple sequence alignments and consensus secondary structures.

http://rfam.sanger.ac.uk/

Page 5: Tutorial 11

Rfam

Different search modes

http://rfam.sanger.ac.uk/

Page 6: Tutorial 11

Search Rfam

Page 7: Tutorial 11

The secondary structure

Page 8: Tutorial 11

:::::: free extremes((())) Stem<<<>>> Internal Stem______ Loop,,,,,, Internal loop

Structure representations

Page 9: Tutorial 11

RNA secondary structure prediction

GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA

Page 10: Tutorial 11

RNA structure prediction by Vienna RNA package

RNAfold server minimum free energy structures and base pair probabilities from single RNA or DNA sequences.

RNAalifold server consensus secondary structures from an alignment of several related RNA or DNA sequences. You need to upload an alignment.

RNAinverse server design RNA sequences for any desired target secondary structure.

Page 11: Tutorial 11
Page 12: Tutorial 11

RNAfold

• Gives best stabilized structure (structure with minimal free energy (MFE))

• uses a dynamic programming algorithm that exploits base pairing and thermodynamic probabilities in order to predict the most likely structures of an RNA molecule (partition function algorithm).

Page 13: Tutorial 11

RNAfold - input

RNA sequence

Page 14: Tutorial 11

Minimal free energy structure

Frequency of the structure

RNAfold - output

Sequence-Structure alignment

Best “average” structure

Page 15: Tutorial 11

Graphic representation

Coloring options

Page 16: Tutorial 11

Minimal free energy

Folding Probabiliy

Mountain Plot

• A mountain plot represents a secondary structure in a plot of height versus position.

• The height m(k) is given by the number of base pairs enclosing the base at position k.

• Loops correspond to plateaus and stems correspond to slopes.

• The closer the two curves, the better defined the structure.

centroid

Entropy

Page 17: Tutorial 11

RNAfold structure representations

Page 18: Tutorial 11

RNAalifold - input

Alignment

Page 19: Tutorial 11

RNAalifold - output

Page 20: Tutorial 11

RNAinverse - input

Page 21: Tutorial 11

RNAinverse - output

Page 22: Tutorial 11

tRNAscan

• Detection of tRNA genes in raw genomic sequence orother types of sequence inputs.

http://lowelab.ucsc.edu/tRNAscan-SE/

Page 23: Tutorial 11

Sequence

tRNAscan - input

Page 24: Tutorial 11

tRNAscan - results

Page 25: Tutorial 11

http://trna.nagahama-i-bio.ac.jp/

Page 26: Tutorial 11

MicroRNA - reminder

Page 27: Tutorial 11

• Search for predicted microRNA targets in mammals (/worm/fly) 3’ UTRs.• Find conserved 8mer and 7mer sites that match the seed region of each miRNA. • Predictions are ranked based on the predicted efficacy of targeting as calculated using the context+ scores of the sites

Page 28: Tutorial 11
Page 29: Tutorial 11
Page 30: Tutorial 11
Page 31: Tutorial 11

Mir 31 - broadly conserved* microRNA

* conserved across most vertebrates, usually to zebrafish

Page 32: Tutorial 11

Mir 136 - conserved* microRNA

* conserved across most mammals, but usually not beyond placental mammals