Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.
-
Upload
lee-rodgers -
Category
Documents
-
view
219 -
download
0
Transcript of Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.
![Page 1: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/1.jpg)
Tryptophan Synthase in Chlamydia
Angela GhristLori Scott
![Page 2: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/2.jpg)
BackgroundIntracellular parasites: viruses, bacteria (Chlamydias,
Rickettsias), and protozoa (plasmodia) (CDC website)Tryptophan biosynthesis genes are found to varying
degrees within the Chlamydiaceae family (“Kegg pathway” program)
Immune response of humans to Chlamydia infection involves the release of interferon. This activates an enzyme that degrades tryptophan, thereby reducing Chlamydia reproduction inside the host cell (PubMed)
Tryptophan is an essential amino acid in humans
![Page 3: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/3.jpg)
![Page 4: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/4.jpg)
TaxonomyLineage (full): root; cellular organisms; Bacteria; Chlamydiae/Verrucomicrobia group;
Chlamydiae; Chlamydiae (class); Chlamydiales
Chlamydiaceae– Candidatus Clavochlamydia
• Candidatus Clavochlamydia salmonicola– Chlamydia
• Chlamydia muridarum • Chlamydia suis• Chlamydia trachomatis
– Chlamydophila • Chlamydophila abortus • Chlamydophila caviae • Chlamydophila felis • Chlamydophila pecorum • Chlamydophila pneumoniae • Chlamydophila psittaci
TaxBrowser in NCBI
![Page 5: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/5.jpg)
Available Genomes• Completed Candidatus Protochlamydia amoebophila UWE25 proteins;• Completed Chlamydia muridarum Nigg proteins; • Completed Chlamydia trachomatis A/HAR-13 proteins; • Completed Chlamydia trachomatis D/UW-3/CX proteins; • Completed Chlamydophila abortus S26/3 proteins; • Completed Chlamydophila caviae GPIC proteins; • Completed Chlamydophila felis Fe/C-56 proteins; • Completed Chlamydophila pneumoniae AR39 proteins; • Completed Chlamydophila pneumoniae CWL029 proteins; • Completed Chlamydophila pneumoniae J138 proteins; • Completed Chlamydophila pneumoniae TW-183 proteins
NCBI – Genomic Biology
![Page 6: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/6.jpg)
Enolase
NCBI - Genome Blast Search and Tree Building
![Page 7: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/7.jpg)
DendrogramEnolase
Unrooted tree (generated by Phylip's Drawtree)
Workbench, ClustalW
![Page 8: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/8.jpg)
ObservationThere are multiple serovars of Chlamydia
tachomatis, distinguished by route of infection.
QuestionAre there differences in their trp genes?
![Page 9: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/9.jpg)
Comparison of Ocular (A) and Genital (D) TrpA Genes
trpA_D CTTCTACAAAGGGACTTAGATTATCTACGCAGACTAAAAGACGCGGGAATAAATGGTGTGtrpA_A CTTCTACAAAGGGACTTAGATTATCTACGCAGACTAAAAGACGCGGGAATAAATGGTGTG trpA_D TGCGTTATAGATCTTCCAGCACCTTTATCACACGGAGAAAAATCTCCATTTTTTGAAGATtrpA_A TGCGTTATAGATCTTCCAGCACCTTTATCACACGGAGAAAAATCTCC---TTTTGAAGAT trpA_D CTTTTAGCTGTAGGATTGGATCCTATTTTGCTTATTTCTGCAGGGACAACGCCGGAGCGGtrpA_A CTTTTAGCTGTAGGATTGGATCCTATTTTGCTTATTTCTGCAGGGACAACGCCGGAGCGG trpA_D ATGTCTTTAATACAAGAATACGCAAGAGGCTTTCTGTATTATATCCCATGTCAAGCTACGtrpA_A ATGTCTTTAATACAAGAACACGCAAGAGGCCTTCTGTATTATATCCCATA-CAAGCTACG
![Page 10: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/10.jpg)
Ocular vs. Genital Tryptophan Synthase
Polymorphisms in Chlamydia trachomatis tryptophan synthase genes differentiate between genital and ocular isolatesJ. Clin. Invest. Harlan D. Caldwell, et al. 111:1757 doi:10.1172/JCI17993
![Page 11: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott.](https://reader036.fdocuments.in/reader036/viewer/2022081809/5a4d1b6a7f8b9ab0599b2c5b/html5/thumbnails/11.jpg)
QuestionHas the Chlamydia L serovar that causes a
systemic lymph node infection retained the tryptophan synthase (trpA) gene like the genital serovars, as opposed to acquiring nonsense mutations like the ocular serovars?