Transplanting encephalomyocarditis virus-infected porcine islet cells reverses diabetes inrecipient mice but also transmits the virus

Introduction

Encephalomyocarditis virus (EMCV) is a cardio-virus belonging to the Picornaviridae family thatinfects many animal species including rodents,non-human primates, and domestic pigs. The virushas been associated with endemic infections in pig

herds worldwide that can result in acute fatalmyocarditis, reproductive failure, or asymptomaticinfections [1]. Pathogenesis studies have shown thatEMCV is disseminated through blood to multipleorgans, including the brain, heart, lungs, kidneys,liver, spleen, pancreas, tonsils, skeletal muscle andlymph nodes of infected pigs, but persists only in

Brewer L, LaRue R, Hering B, Brown C, Njenga MK. Transplantingencephalomyocarditis virus-infected porcine islet cells reverses diabetesin recipient mice but also transmits the virus.Xenotransplantation 2004; 11: 160–170. � Blackwell Munksgaard, 2004

Abstract: Previous studies demonstrated that porcine encephalomyo-carditis virus (EMCV) caused acute and persistent infection in themyocardium, central nervous system, and spleen of non-human primates(cynomolgus macaques); and it productively infected primary humancardiomyocytes, suggesting that the virus may pose a risk in pig-to-human transplantation. Recently, transplantation of myocardial andpancreatic tissues from acutely infected pigs transmitted the virus torecipient mice, resulting in acute fatal EMCV disease. Here, we exam-ined whether porcine islet cells (PICs), which are under clinical trial fortreatment of type I diabetes in humans, are susceptible to porcineEMCV, and whether EMCV-infected PICs could function in vivo toreverse diabetes. PICs were infected with EMCV in vitro for 5 h, andresulting insulin production compared with that produced by uninfectedPICs. Subsequently, infected PICs were transplanted intra-abdominallyor under the kidney capsule of C57BL/6 mice, and both virus trans-mission and PIC function analyzed. PICs were highly susceptible toporcine EMCV, resulting in a 1500-fold increase in production ofinfectious virus within 5 h of inoculation and cytolysis that destroyed upto 50% of cells within 96 h. However, as long as they were viable,infected PICs produced insulin at levels comparable with uninfectedPICs. Intra-abdominal transplantation of 2000 PICs, infected with oneplaque forming unit (pfu) per cell of porcine EMCV, into C57BL/6 micetransmitted the virus resulting in acute fatal EMCV disease character-ized by hind limb paresis and paralysis and acute respiratory distress in40% of recipient mice. More importantly, transplantation of 2500EMCV-infected PICs under the kidney capsule of diabetic C57BL/6mice (glucose level ‡350 mg/dl) reversed diabetes in 83% of recipientmice (glucose level £170 mg/dl); however these mice succumbed toacute EMCV disease transmitted by the xenograft 5 days after trans-plantation. EMCV infection does not appear to affect insulin productionby PICs, but infected xenografts can transmit the virus to recipientanimals, resulting in severe disease.

Laurie Brewer,1 Rebecca LaRue,1

Bernhard Hering,2 Corrie Brown3

and M. Kariuki Njenga11Department of Veterinary Pathobiology, Universityof Minnesota, St Paul, MN, 2Department of Surgery,University of Minnesota, Minneapolis, MN,3Department of Pathology, University of Georgia,Athens, GA, USA

Key words: xenozoonosis – porcine encephalomyvirus – porcine islets – virus transmission –diabetes

Address reprint requests to M. Kariuki Njenga,Department of Veterinary Pathobiology, University ofMinnesota, 1971 Commonwealth Avenue, St Paul,MN 55108, USA (E-mail: njeng001@tc.umn.edu)

Received 11 June 2003;Accepted 15 September 2003

Xenotransplantation 2004: 11: 160–170Printed in UK. All rights reserved

Copyright � Blackwell Munksgaard 2004

XENOTRANSPLANTATION

160

myocardial and central nervous system cells [2–5].The clinical presentation and pathogenesis ofEMCV-induced disease in humans are not clearlyunderstood. On one hand, antibodies to EMCVhave been detected in humans with no discernibleillness, and reports have associated EMCV infec-tion with a mild febrile condition [1, 6, 7]. On theother hand, the virus has been isolated frompatients with encephalitis and meningitis; and aporcine strain of EMCV has been shown toproductively infect primary human cardiomyocytes[1, 3, 8]. In addition, virulent EMCV strains havepreviously been isolated from non-human pri-mates, and experimental infection of cynomolgusmacaques with a porcine isolate of EMCV resultedin severe pathologic lesions, primarily in the heartand brain [5, 7].Xenotransplantation research has focused on

using pig tissues and cells, including heart valves,skin, hepatocytes, and neural cells to treat variousdiseases in humans [9, 10]. Transplantation of pigislet cells (PICs) to treat type I diabetes, whichafflicts millions of people, is perhaps the mostimmediate goal for xenotransplantation research-ers, for a number of reasons. First, pigs and humanshave almost identical physiological glucose ranges(70 to 100 mg/dl for humans, 70 to 105 mg/dl forpigs) and pig insulin has been used for over 70 yr totreat type I diabetes in humans [9, 11]. Secondly,transplantation of pig islet cells instead of wholepancreases is advantageous because it is minimallyinvasive (requiring intravenous injection); and theworst outcome of PICs engraftment is graft rejec-tion that would result only in a return to insulininjections [11]. In contrast, failure of whole pan-creas transplants or related complications canresult in death of the recipient [12, 13]. Thirdly,recently developed technologies such as cell encap-sulation can aid in preventing destruction of thetransplanted cells by the recipient’s immune system,thus minimizing the use of severe immunosuppres-sive therapies following transplantation that canhave devastating effects [9].Several PICs-to-human transplant trials have

been conducted and the results are promising. Aclinical trial conducted in Sweden in the early 1990sdemonstrated that transplanted PICs could surviveand produce insulin in human recipients, althoughnot enough to eliminate the need for insulininjections [9]. In Mexico, four of 12 diabeticchildren implanted with PICs in subcutaneousvascularized collagen tubes demonstrated morethan a 40% reduction in their need for exogenousinsulin and produced measurable amounts of por-cine C-peptide, indicative of PIC function [14]. Onepatient no longer required insulin injections 2 yr

after the procedure [15]. Unfortunately, concernsregarding transmission of viruses during xenotrans-plantation have stalled progress towards increasedclinical use of pig tissues to treat human disease.For example, a proposed clinical trial in the CookIslands designed to study the effects of transplant-ing encapsulated PICs into human patients withtype I diabetes received widespread criticism frompublic health officials and xenotransplantationexperts who insisted that the risk of transferringporcine viruses, particularly porcine endogenousretroviruses (PERVs), was still too high [16].Much of the ongoing research to address pig-

to-human viral xenozoonoses has involved evalu-ating the risk of transferring PERVs, whosegenomes can integrate into host cellular DNA,and herpesviruses, which can establish latent infec-tions. So far, there has been no evidence of infectionwith PERVs or porcine herpesviruses in humanpatients who have undergone porcine xenoper-fusion procedures or received porcine islet or neuralcell transplants [17–19]. The continuing concernregarding viral transmission despite the findings onPERVs and herpesviruses indicates that negativefindings may not completely reassure the publicregarding the risk of pathogen transmission. Analternative direction for the field is to accept thepossibility that transmission of pig viruses tohumans may occur once xenotransplantation ofpig tissues becomes routine, and to conductresearch to understand the associated risk anddevelop therapeutic and prophylactic strategies tocontrol such outcomes. We recently demonstratedthat transplantation of EMCV-infected porcinepancreatic and myocardial tissues resulted in trans-mission of EMCV with accompanying encephalitisin recipient mice [20]. The goal in this study was todetermine whether porcine EMCV could infectPICs, and to determine whether transplantingEMCV-infected PICs would reverse diabetes inmice.

Material and methods

Virus

Encephalomyocarditis virus-30 (EMCV-30), a por-cine field strain isolated in Minnesota in 1987, waspropagated as described previously [3]. Virus wastitered by plaque assay on HeLa cells and stored at)80 �C.

Islet cell isolation

Pig islet cells were prepared at the DiabetesInstitute for Immunology and Transplantation at

Transplanting virus-infected PICs reverses diabetes

161

the University of Minnesota as described previ-ously [21]. Briefly, islet cells were isolated from pigpancreases by digesting with Liberase PI (RocheMolecular Biochemicals, Indianapolis, IN, USA)and purified with OptiPrep (Nycomed Pharma,Oslo, Norway) gradients on a COBE 2991 cellseparator (Gambro BCT, Inc., Lakewood CO,USA). Islet cells were counted and expressed asislet equivalents (IEQ), with one islet equivalenthaving a mean diameter of 150 lm. Islets werecultured for 24 h at 37 �C in complete M199(Mediatech, Herndon, VA, USA) with 10% heat-inactivated donor pig serum prior to distribution.Viability was assessed using fluorescein diacetate/propidium iodide staining, and function assessedusing glucose-stimulated insulin release assay.Total insulin, DNA content and islet cell compo-sition was determined. Freshly isolated PICscontained approximately 40% insulin-producingb-cells, the rest being glucagon-, somatostatin- andpolypeptide-secreting and supportive cells.

Infection of porcine islet cells

PICs were cultured in complete M199 with 10%heat-inactivated donor pig serum in T-25 cultureflasks for several hours prior to inoculation. Cellswere sedimented by gravity and excess mediaaspirated from the flasks prior to inoculation withEMCV-30. Inoculations were performed by mixingislets with virus in a 500 ll volume of media for 1 hto allow viral adsorption, followed by the additionof 2 ml of culture medium for the remainder of theinfection period. Following infection, cells werewashed twice in Hanks’ balanced salt solution(HBSS) and collected for plaque assay analysis,trypan blue staining, insulin release assay ormounted onto glass slides for immunohistochemis-try. Islet cells used for intra-abdominal transplan-tation were washed twice in HBSS and resuspendedin 1 ml of sterile phosphate buffered saline (PBS) toeliminate phenol red. Islet cells used for renalsubcapsular transplantation were washed twice inM199 without pig serum, centrifuged at 500 rpmfor 30 s and aspirated into sterile P20 tubing(Becton Dickinson, Franklin Lakes, NJ, USA)followed by centrifugation at 1000 rpm for 5 min.

Glucose-stimulated insulin release assay

Insulin release assays were performed at the Dia-betes Institute for Immunology and Transplanta-tion at the University of Minnesota. Islet cells wereincubated in RPMI-1640 containing 30 mg/dl glu-cose for 30 min at 37 �C, divided into aliquots, andincubated in RPMI-1640 containing 30 mg/dl or

300 mg/dl glucose for 1 h. Immunoreactive insulin(IRI) in the cell supernatants was detected usingenzyme immunoassay and measured at 450 nm(PowerWaveX, Bio-Tek Instruments, Winooski,VT, USA) with mammalian insulin as a standard.Correction for DNA content was performed usingPico Green (Molecular Probes, Eugene, OR, USA)detection at 520 nm (FL600 Microplate Fluores-cence Reader, Bio-Tek Instruments). Samples wereanalyzed against an eight-point standard curve (0.0to 1.0 lg/ml) of k-DNA. Glucose-stimulatedDNA-corrected insulin release was expressed asng IRI/ng DNA/h, and the stimulation indexcalculated as the ratio of stimulated (300 mg/dl)to basal (30 mg/dl) insulin release.

Transplantation of PICs into normal and diabetic mice

Six-week-old male C57BL/6 mice (Jackson Labor-atories, Bar Harbor, MA, USA) were housed inanimal facilities at the University of Minnesotaunder the care of University of MinnesotaResearch Animal Resources. To determinewhether infected PICs can transmit the virus torecipient mice, two non-diabetic mice were intra-abdominally engrafted with 20 000 EMCV-infec-ted PICs (10 pfu/cell for 4 h), and another 10non-diabetic mice engrafted with 2000 EMCV-infected PICs (1 pfu/cell for 4 h). One controlmouse was engrafted with 20 000 uninfected PICs,and two with 2000 uninfected PICs. To determinewhether EMCV-infected PICs can reverse diabetes,C57BL/6 mice were made diabetic by one or twoinjections of 220 mg/kg streptozotocin (Sigma–Aldrich, St Louis, MO, USA) intraperitoneally.Daily blood glucose levels were analyzed startingon day 4 after streptozotocin injections and themice considered diabetic (ready for PIC xeno-grafts) after two consecutive blood glucose meas-urements of ‡350 mg/dl. Diabetic mice weremaintained with saline and insulin injections(Novolin R, Novo Nordisk Pharmaceuticals,Princeton, NJ, USA; HumulinN, Eli Lilly andCompany, Indianapolis, IN, USA) as requireduntil PIC transplantation. PICs were transplantedin the renal subcapsular space following a flankincision to expose the left kidney. An incision wasmade in the kidney capsule near the caudal pole, apocket created under the capsule, and 2500 PICsinfused using P20 plastic tubing connected to aHamilton syringe. Six mice received EMCV-infec-ted PICs (1 pfu/cell for 5 h), and two mice receiveduninfected PICs. Two mice received only streptoz-otocin injections as diabetes controls, and onemouse received no treatments to serve asnormal glucose control. Blood glucose levels were

Brewer et al.

162

monitored daily following surgery. All mice thatunderwent surgery were given analgesia (0.5 mg/kgtorbugesic) for two days and antibiotics (4 mg/mlamoxicillin in drinking water) for 5 days. Killingwas carried out using 6 mg/gm sodium pentobar-bital injected intraperitoneally at the onset ofclinical signs of illness or at up to day 12 if noclinical signs developed. Sera and brain, heart,kidney, liver, spleen, skeletal muscle and pancreassections were collected for virus detection. Sera andhalf of each organ were immediately frozen at)80 �C for RNA isolation and reverse transcrip-tion-polymerase chain reaction (RT-PCR) orplaque assay analysis. The remaining tissue sam-ples were fixed in formaldehyde, embedded inparaffin and sectioned at 4 l thickness for immu-nohistochemistry or stained with hemotoxylin andeosin for histopathologic analysis.

Immunohistochemical detection of EMCV antigens and porcineinsulin

Encephalomyocarditis virus antigens and porcineinsulin were detected in PIC slide preparations, andEMCV antigens detected in mouse tissue sectionsby immunohistochemistry. Formalin-fixed para-ffin-embedded mouse tissue sections were dewaxedin xylene and hydrated in ethanol washes, whereasfresh PIC cytospin slides were fixed in cold acetonebefore immunostaining. All slides were washed inPBS and incubated in 0.5% hydrogen peroxide for30 min at room temperature to inactivate endo-genous peroxidases. Blocking was carried out using10% normal goat serum in PBS at room tempera-ture for 30 min, followed by a 1 h incubation atroom temperature with a 1 : 100 dilution ofpolyclonal rabbit anti-EMCV antibodies producedin our laboratory. Following three washes in PBS,peroxidase-conjugated goat anti-rabbit IgG(Kirkegaard and Perry, Gaithersburg, MD, USA)was applied at a 1 : 50 dilution for 1 h at roomtemperature. Slides were washed in PBS, colordeveloped by the addition of 3,3¢-diaminobenzidinechromogen (DAB, Vector Laboratories, Burlin-game, CA, USA), and counterstained with2% methyl green (Sigma–Aldrich). To performco-localization of porcine insulin, EMCV stainedPIC slides were incubated with a 1 : 25 000 dilutionof monoclonal mouse anti-insulin (Sigma-Aldrich)for 20 min at room temperature. Slides were washedthree times in PBS and incubated for 20 min at roomtemperature with a 1 : 250 dilution of peroxidase-conjugated goat anti-mouse IgG (Kirkegaard andPerry). Following PBS washes color was developedby the addition of TrueBlueTMPeroxidase Substrate(Kirkegaard and Perry).

Virus detection by plaque assay

Levels of infectious virus in PICs and mouse tissueswere determined using plaque assay as describedpreviously [22]. Briefly, harvested tissues wereweighed and homogenized in RPMI-1640 media,sonicated for two 1-min cycles to release virus, andcentrifuged at 1733 · g for 10 min. Supernatantswere diluted 10-fold (10)1 to 10)6) in RPMI-1640and added to duplicate wells of confluent HeLacells in 12-well plates. Harvested PICs were washedto remove unattached virus, sonicated, and thesupernatants serially diluted before being added toconfluent HeLa cells. After virus attachment,infected HeLa cells were overlaid with pre-warmed0.4% agarose and incubated at 37 �C for 30 h forplaque development. The average number ofplaques formed was calculated from duplicatewells and expressed as plaque forming units pergram of mouse tissue or per number of PICs.

Encephalomyocarditis virus RNA detection by reversetranscription-polymerase chain reaction

Nested RT-PCRwas used to detect EMCVRNA inmouse tissues as described previously [3], usingprimers designed from the recently sequencedEMCV-30 strain [5]. RNA was extracted frommouse tissues using TRIzol� (Invitrogen, SanDiego, CA, USA), and reverse transcribed usingan oligo-dT primer and the Superscript IITM kit(Invitrogen). A first round of PCR was performedusing primer pairs specific to the VP1 or VP2 viralcapsid protein genes ofEMCV, followedbya secondPCR round using nested primers for the same genes.VP1 primers used for outer PCR were GCCTCAGTTTGACCCTGCTTATG for the 5¢ primer andCGGCTCTCGGAGTCATGTCAATC for the 3¢primer (product size 592 bp); primers for the nestedPCR round were CGTCTCACAGAAATTTGGGGCAAC for the 5¢ and CCAGGCTTCCTGTGTTGTCAAATC for the 3¢ end (product size 340 bp).VP2 primers used for outer PCR were CAGTAGGCCGTCTTGTTGGTTATG for 5¢ and CACTTCAAGATCCACGGTGGTGTTG for the 3¢ pri-mer (product size 499 bp); primers for the nestedPCRwereGGCACTGTTCATGATGGAGAACACfor the 5¢ end and GGTGATCCATAGCAAAGGGACCTTTC for the 3¢ end (product size 350 bp).

Results

EMCV-30 productively infects PICs

Porcine islet cells were inoculated with 2 pfu ofEMCV-30/cell for 8 h and harvested for detection

Transplanting virus-infected PICs reverses diabetes

163

of viral antigens within the cells using the immuno-peroxidase system. As demonstrated in Figure1(B), viral antigens were reproducibly detected inover 60% of the infected cells. Further, by 8 hpost-infection (PI), a decrease in islet cluster sizes

was evident, accompanied by a dramatic increasein cellular debris, indicative of picornaviral cyto-lysis. To specifically confirm that insulin-producingb (islet)-cells were infected with EMCV, co-loca-lization using anti-pig insulin antibodies (blue

Fig. 1. Detection of viral antigens in EMCV-infected PICs and cell lysis caused by EMCV infection. PICs were inoculated with 2 pfuEMCV/cell for 8 h and harvested for intracellular viral antigen detection using immunohistochemistry. No antigens were detected inuninfected cells (A), whereas viral antigens were detected in over 60% of infected cells (B). Double immunostaining for insulin (blue)and EMCV antigens (brown) confirmed that the insulin-producing b (islet) cells were infected with EMCV (C and D, solid arrows).An uninfected islet cell is shown using an open arrow (C). PICs inoculated with 0.1 pfu EMCV/cell for 24 h contained dead cellsdetected by trypan blue primarily in the periphery of islet cell clusters (E). By 96 h post-inoculation, up to 70% of the islets in anycluster were positive for trypan blue staining, with cytolysis resulting in reduction in cluster sizes (F).

Brewer et al.

164

staining) and anti-EMCV antibodies (brown stain-ing) were performed and cells immunoreactive forboth antigens identified by light microscopy (Fig.1C,D, solid arrows). Uninfected insulin-producingislet cells were also identified within the infectedcell preparation (Fig. 1D, open arrow). To studythe effects of prolonged EMCV infection, PICswere inoculated with 0.1 pfu/cell for 24, 48, and96 h and stained with trypan blue to determine celldeath. At 24 h PI, cell death was evident primarilyat the periphery of the islet cell clusters (Fig. 1E),associated with a reduction in cluster sizes. By 96 hPI, cells taking up trypan blue were evidentthroughout the clusters, with up to 70% of thecells staining blue and cluster sizes reduced by upto 50% compared with uninfected islet clusters(Fig. 1F). Death of the islet cells was attributableto EMCV infection because uninfected islets con-tained few non-viable cells at 96 h. Further,similarly harvested PICs can survive for up to30 days in culture with minimal loss (Jeff Ansite,personal communication).To determine whether infectious EMCV parti-

cles were produced by infected PICs, a single-stepgrowth curve was performed by infecting freshlyisolated PICs with 2 pfu/cell and harvesting virusafter 1, 3, 5 and 8 h. As demonstrated in Figure 2,EMCV infection resulted in a typical picornaviral

growth curve with a lag phase of 3 h followed byexponential production of infectious virus 3 to 5 hfollowing inoculation. Virus production reached aplateau 5 to 8 h after inoculation (Fig. 2). The1500-fold increase in EMCV demonstrates that pigislet cells are highly susceptible to infection withEMCV-30.

Encephalomyocarditis virus infection of PICs does not affectinsulin production in vitro

As described above, EMCV-infected PICs under-went lysis that was evident starting from 8 h PI.Because extensive viral replication in PICs wasevident within 5 h (Fig. 2), we selected 5-h infectedPICs (2 pfu/cell) to determine whether virus infec-tion affected insulin responsiveness. Infected cellswere stimulated with basal (30 mg/dl) and high(300 mg/dl) glucose levels, and resultant insulinproduction determined. In two independent experi-ments, high glucose stimulation of uninfected andinfected islets resulted in a 1.5- to 3.3-fold increaseover basal insulin production in uninfected cells,and a 1.9- to 3.7-fold increase in production inEMCV-infected cells (Table 1). No significantdifferences in DNA-corrected insulin productionwere observed between the infected and uninfectedPIC populations, indicating that EMCV-30 infec-tion did not alter the ability of viable cells toproduce insulin during a short-term (5 h) infection.

Transplantation of infected PICs transmits EMCV to recipient mice

To first establish a model of PIC-to-mouse EMCVxenozoonosis, we intra-abdominally transplanted20 000 PICs infected with a high dose of EMCV(10 pfu/cell for 4 h) into mice (n ¼ 2) and demon-strated transmission of the virus and acute fatalEMCV disease characterized by hind limb paresis,paralysis, lethargy, hunched posture, ruffled furand respiratory distress within 5 days. A controlmouse transplanted with 20 000 uninfected PICSremained healthy throughout the experiment. Toreflect the number of PICs used experimentally toreverse diabetes in mice, 2000 PICs infected with1 pfu of EMCV-30 per cell for 4 h were transplan-ted intra-abdominally into mice (n ¼ 10). Plaqueassay of 2000 identically infected PICs revealedthat the xenografts contained a total of 25 pfu ofEMCV at the time of transplant (4 h PI). Four ofthe ten mice that received 2000 infected PICsdeveloped severe clinical signs of EMCV diseaseand were killed between days 5 and 8 PI. Theremaining six mice did not develop overt clinicalillness, and were killed on day 12 PI for tissuecollection. In addition, all diabetic mice that

Fig. 2. Single-step growth curve demonstrating EMCV repli-cation in PICs. PICs were inoculated with 2 pfu EMCV-30/celland harvested at 1, 3, 5 and 8 h for plaque assay detection ofinfectious virus particles within the cells. The results demon-strated a typical picornaviral growth curve, with a lag phase of1 to 3 h, followed by exponential virus production (1500-foldincrease) within the next 2 h (5 h after inoculation). Viralproduction began to plateau 8 h after inoculation as PICsunderwent lysis.

Transplanting virus-infected PICs reverses diabetes

165

received intrarenal EMCV-infected PIC xenografts(n ¼ 6) developed signs of EMCV disease 5 daysafter transplantation. Control mice that receiveduninfected PICs remained healthy throughout theexperiment period. Other studies conducted in ourlaboratory have demonstrated that mice injectedintraperitoneally with as few as 4 pfu of EMCV-30can develop fatal EMCV disease [5].

Transplanting EMCV-infected PICs reverses diabetes

To determine whether EMCV-infected PICs couldfunction in vivo, 2500 EMCV-infected PICs (1 pfu/cell for 5 h) were implanted under the kidneycapsule of six diabetic mice. In five of six mice(83%), blood glucose levels dropped from‡350 mg/dl to an average of 92 mg/dl in <24 hfollowing transplantation. As shown in Figure 3,blood glucose levels remained at or below thenormal blood range (150–170 mg/dl) during theentire experiment period (7 days after transplanta-tion). Two diabetic mice transplanted with unin-fected PICs demonstrated similar drops in bloodglucose 24 to 48 h following surgery (Fig. 3). As apositive control, left nephrectomy was performedon one uninfected PIC xenograft-recipient mouse6 days post-transplantation and the mouse becamediabetic within 24 h, indicating that the xenograftwas responsible for the restoration of normalglucose levels after induction of diabetes. Twostreptozotocin-injected mice that did not receivePIC xenografts had elevated blood glucose levels(‡350 mg/dl) throughout the duration of the study.One mouse not injected with streptozotocin (STZ)or transplanted with PICs served as a normalcontrol and maintained normal blood glucose levelsthroughout the study. All six mice that receivedEMCV-infected PICs developed signs of EMCVdisease including hunched posture, ruffled fur, hindlimb paresis or paralysis, lethargy and respir-atory distress on day 5 following transplantation

surgeries and were euthanized. In contrast, none ofthe control mice (uninfected PIC xenograft recip-ients) developed signs of EMCV disease.

Pathogenesis of EMCV in PICs-recipient mice

Histopathologic changes characteristic of EMCVinfectionwere observed in brains andhearts of intra-abdominal and intrarenal recipients of EMCV-infected PICs (Fig. 4, top panels), in agreementwith previous studies that have identified these

Fig. 3. Transplantation of EMCV-infected PICs reverses dia-betes in C56BL/6 mice. Following diabetes induction in miceby intraperitoneal injection of 220 mg/kg of streptozotocin(STZ), blood glucose levels increased to over 350 mg/dl (dia-betic) within 4 to 5 days of STZ injection. Transplantation of2500 EMCV-infected PICs under the kidney capsule of sixdiabetic mice resulted in a decrease in glucose levels (below170 mg/dl) within 24 h, whereas the levels remained high(‡350 mg/dl) in two diabetic mice that did not receive PICxenografts. The rate and levels of glucose restoration byinfected PIC xenografts were similar to those observed in adiabetic mouse that received uninfected PICs. Glucose levels ina non-diabetic mouse (no STZ injection) remained normalthroughout.

Table 1. Effect of encephalomyocarditis virus (EMCV) infection on porcine islet cells (PIC) insulin production in vitro

Experiment PICs statusa

Insulin release at low glucoseb

(ng IRI insulin/ng DNA/h · 10)4)Insulin release at high glucoseb

(ng IRI insulin/ng DNA/h · 10)4) Fold stimulation Average fold stimulation P-valuec

1 Uninfected 1.85 € 0.16 6.18 € 1.62 3.34 3.12 0.21791.99 € 0.09 5.76 € 0.69 2.89

1 Infected 1.64 € 0.12 5.02 € 0.79 3.07 3.411.50 € 0.12 5.62 € 1.96 3.75

2 Uninfected 4.57 € 1.92 11.9 € 4.31 2.60 2.07 0.95798.88 € 2.55 13.6 € 4.83 1.53

2 Infected 6.31 € 0.36 15.3 € 2.37 2.43 2.175.15 € 2.04 9.86 € 1.46 1.91

aPICs were infected with 2 pfu EMCV/cell for 5 h.bData are mean of three readings from each of two samples € SD.cCalculated using means comparison of insulin release during high glucose stimulation in paired t-test.

Brewer et al.

166

tissues as the primary sites of viral replication.Reactive endothelial cells, perivascular cuffing, andfoci of gliosis characterized brain lesions whereasmyocardial lesions were necrotic with fragmenta-tion of sarcoplasm and infiltration of inflammatorycells. This was supported by PCR analyses thatdemonstrated high levels of viral RNA in theseorgans following primary PCR (Fig. 4, middlepanels), and plaque assay that demonstrated 6 to 8logs of infectious EMCV particles in the brains and4.7 to 6.9 logs in the hearts of mice that developedclinical disease following intra-abdominal trans-plantation with infected PICs (Fig. 5B). Subse-quent nesting PCR reactions revealed the presenceof EMCV RNA in blood, kidney, liver, spleen, andskeletal muscle (Fig. 4, bottom panels). There weresimilar patterns of RNA dissemination in mice thatreceived a high (20 000) and low (2000) number ofEMCV-infected PICs and developed clinical signsof disease (Fig. 4, middle and bottom panels,

Fig. 5A). Tissues from the 2000 EMCV-infected(1 pfu/cell) PIC-recipient mice that did not developclinical disease (n ¼ 6) demonstrated variability inthe dissemination of EMCV RNA when analyzed12 days after transplantation, with the highestincidence (66.3%) of viral RNA in the brain.RNA was detected less frequently in heart, kidney,liver, spleen, skeletal muscle and pancreas samples(Fig. 5A). Because the mice that developed clinicaldisease and the mice that did not develop clinicaldisease were sacrificed at different time points (5 to8 days PI vs.12 days PI), these findings cannot bedirectly compared. Tissues from mice transplantedintra-abdominally with 2000 uninfected PICs(n ¼ 2) were negative for EMCV RNA. Immun-operoxidase staining demonstrated EMCV anti-gens in the brain, heart, and liver of mice thatreceived 20 000 infected PICs intra-abdominally.However, apart from small areas of necrosis in thespleens, no pathological changes were observed in

Fig. 4. Histopathologic changes in EMCV-infected PIC-recipient mice and detection of viral RNA in their tissues. Hematoxylin andeosin sections from a C57BL/6 mouse engrafted with 20 000 EMCV-infected PICs demonstrating perivascular cuffing (arrow) in thecerebral cortex (top left), and an area of necrosis with fragmentation of sarcoplasm and infiltration of inflammatory cells (arrow) inthe myocardium (top right). Primary (middle panel) and nested (bottom panel) RT-PCR reactions using VP2 primers to detectEMCV RNA in brain (B), heart (H), kidney (K), liver (L), spleen (Sp), skeletal muscle (SM), and serum (S) in recipient C57BL/6 micetransplanted with EMCV-infected PICs. Recipient mice that developed clinical EMCV disease had high levels of EMCV RNA in thebrain and heart as demonstrated by primary PCR reactions (middle panels). Subsequent nested PCR reactions detected lower levelsof viral RNA in the rest of the organs (lower panels). Because of the high level of viral RNA, the nesting PCR reaction of brain andheart samples had two visible bands, the larger (499 bp) representing the primary reaction product, and the smaller (350 bp)representing the nesting reaction product. Patterns of virus dissemination are from two mice that received a high number (20 000) ofinfected PICs (left middle and bottom panels), and two that received a low number (2000) of infected PICs (right middle and bottompanels).

Transplanting virus-infected PICs reverses diabetes

167

the kidneys, skeletal muscles, or livers. No lesionswere observed in the uninfected control mouse.

Discussion

Previous studies have demonstrated that porcineEMCV persisted in pig myocardial and CNS cellsfor up to 90 days, and was associated with extensivepathological changes, apoptosis, and viral antigenexpression [3]. More importantly, porcine EMCVproductively infected primary human cardiomyo-cytes [3, 5], indicating that the virus may pose a riskin pig-to-human transplantation. In adult cyno-molgus macaques, EMCV caused severe acutemyocarditis and persistent infection in the myocar-dium, CNS, and spleen [5]. Recently, transplanta-tion of myocardial or pancreatic tissues fromacutely infected pigs transmitted the virus torecipient mice, resulting in acute fatal EMCVdisease [20]. To address a more clinically relevantquestion, we examined whether PICs, which areunder clinical trial for treatment of type I diabetesin humans, are susceptible to porcine EMCV, andwhether infected PICs function in vivo (producephysiologically effective levels of insulin) andtransmit the virus. The results demonstrate thatPICs are highly susceptible to EMCV-30, a strainisolated from naturally infected pigs, resulting in a1500-fold increase in infectious virus particles

within 5 h of inoculation. Because in vivo studieshave demonstrated EMCV infection of porcinepancreatic tissue during the acute phase of thedisease [5, 20], the finding that PICs can be infectedwas not surprising. However, the level to which isletcells supported EMCV replication was significant.To date, PIC susceptibility to and transmission

of porcine viruses other than porcine endogenousretroviruses has not been well studied. PERVs canbe released from PICs [23], porcine aortic endo-thelial cells [24], and porcine peripheral bloodmononuclear cells [25]; and can infect human cellsin vitro [23–26]. Studies with severe-combinedimmunodeficient (SCID) mice have reported thatPERV infection can be transmitted through trans-plantation of PICs [27], although attempts toproduce PERV infections in other animal modelshave failed [28]. Further, no PERVs have beendetected in human patients following treatment ortransplantation with porcine cells or tissues [17–19,29–31]. An important point made in PERV studiesis that so far, no disease has been associated withthe virus, either in pigs or humans. However,studies have shown that PICs are susceptible to thehuman Coxsackie B virus (CBV), as well as humanand monkey rotaviruses [32, 33]. Infection of fetalPICs with human CBV, a picornavirus, resulted ina rapid and progressive decrease in insulin contentand decreased insulin responsiveness, whereas

Fig. 5. Number of EMCV-infected PIC recipient mice positive for EMCV RNA in various tissues. Most tissues from four mice (tworeceived 20 000 PICs, two received 2000 PICs) that developed clinical signs of EMCV disease contained EMCV RNA, whereas fewertissues were positive in the six mice (2000 PICs) that did not develop clinical signs of illness (A). Plaque assay demonstrated 4.7 to 8logs of infectious EMCV particles in the brain and heart of two mice (2000 PICs) that developed clinical signs of EMCV illness,whereas there were few or no infectious particles in the liver of these mice (B).

Brewer et al.

168

infection with other human picornaviruses resultedin either poor virus replication or no infection at all[32]. Studies using monkey and human rotavirusesrevealed varying susceptibilities of mouse, monkey,and porcine islet cells to the viruses. Humanrotaviruses replicated in monkey islets to lowtiters, whereas both human and monkey rotaviru-ses replicated in both mouse and pig islet cells tohigher titers [33].In our studies, EMCV-infected PICs underwent

cytolysis in vitro that resulted in destruction of upto 50% of cells within 96 h, similar to resultsobserved using CBV. However, as long as the cellsremained viable, their responsiveness to glucosestimulation in vitro was comparable with thatproduced by uninfected PICs. Our findings differedfrom previous results demonstrating that PICsinfected with human CBV had decreased respon-siveness to insulin stimulation, starting at 24 h PIand reaching their lowest levels of up to 10-folddecreases in responsiveness 1 to 3 weeks afterinfection [32]. To further investigate our findings,we intrarenally transplanted EMCV-infected PICsinto diabetic mice and demonstrated reversal ofdiabetes that lasted until the onset of EMCVdisease 5 days after transplantation. During thatperiod, glucose levels in infected xenograft recipi-ent mice were similar to those observed in anuninfected PIC-xenograft recipient mouse.Transplantation of EMCV-infected PICs (1 pfu/

cell) intra-abdominally into C57BL/6 mice trans-mitted the virus resulting in acute fatal EMCVdisease, characterized by hind limb paresis andparalysis and acute respiratory distress, in 40% ofthe recipient mice. These findings are similar tothose observed following transplantation of myo-cardial or pancreatic tissues from EMCV-acutelyinfected pigs into immunocompetent and immuno-deficient mice, with the development of clinicaldisease starting from day 2 post-infection [20]. Thepathogenesis of EMCV in PIC-recipient mice wassimilar to that observed in EMCV infected mice,pigs, and macaques, with the highest amount ofviral replication and associated pathologic changeslocalized in the brain and myocardium [3, 5, 20].The risk to human recipients by virus-infected pigxenografts, as well as survival and efficient functionof xenografts transplanted into humans carryingzoonotic viruses, needs to be addressed before pig-to-human transplantation can be readily accepted.Our findings that EMCV-infected PICs producephysiologically effective levels of insulin providehope that viral infections, particularly those asso-ciated with non-cytolytic xenogenic viruses, maynot result in xenograft failure for human PICxenograft-recipients.

Acknowledgements

This work was supported by the National Insti-tutes of Health grant HL04369-01. We thankJeremy Alley, Humphrey Lwamba, Jeff Ansite,Hui-Jian Zhang and Andrew Friberg for theirassistance.

References

1. Murnane TG. Encephalomyocarditis. In: Beran GW,sect. ed. CRC Handbook Series in Zoonoses, Section B:Viral Zoonoses, vol. 2. CRC Press, 1981.

2. Billinis C, Paschaleri-Papadopoulou E, Psychas Vet al. Persistence of encephalomyocarditis virus (EMCV)infection in piglets. Vet Microbiol 1999; 70: 171.

3. Brewer LA, Lwamba HCM, Murtaugh MP et al.Porcine encephalomyocarditis virus persists in pig myo-cardium and infects human myocardial cells. J Virol 2001;75: 11621.

4. Gainer JH. Encephalomyocarditis virus infections inFlorida. J Am Vet Med Assoc 1967; 151: 421.

5. Larue R, Myers S, Brewer L et al. A wildtype porcineencephalomyocarditis virus containing a short poly(C)tract is pathogenic to mice, pigs and cynomolgus maca-ques. J Virol 2003; 77: 9136.

6. Kirkland PD, Gleeson AB, Hawkes RA, Naim HM,Broughton CR. Human infection with encephalomyo-carditis virus in New South Wales. Med J Aust 1989; 151:176.

7. Wells SK, Gutter AE. Encephalomyocarditis virus:epizootic in a zoological collection. J Zoo Wildl Med 1989;20: 291.

8. Gajdusek C. Encephalomyocarditis infection in child-hood. Pediatrics 1955; 16: 819.

9. Lanza RP, Cooper KC. Xenotransplantation of cells andtissues: application to a range of diseases, from diabetes toAlzheimer’s. Mol Med Today 1998; 4: 39.

10. Fredrickson JK. He’s all heart...and a little pig too: alook at the FDA draft xenotransplant guideline. Food andDrug Law J 1997; 52: 429.

11. Gordon AT. Report from the International Workshop onXenotransplantation: International Issues in Transplan-tation Biotechnology, Including the Use of Non-Human Cells, Tissues and Organs. New York City, 18-20March 1998.

12. Gruessner AC, Sutherland DE. Analysis of UnitedStates (US) and non-US pancreas transplants reported tothe United Network for Organ Sharing (UNOS) andinternational pancreas transplant registry (IPTR) as ofOctober 2001. Clin Transpl 2001; 41.

13. Hopt UT, Drognitz O. Pancreas organ transplantation.Short and long-term results in terms of diabetes control.Langenbeck’s Arch Surg 2000; 385: 379.

14. Valdes R, Elliott R, Dorantes L et al. Safety andpreliminary efficacy of porcine islets and Sertoli cellsimplanted into an autologous collagen generating device intype I diabetic humans. Xenotransplantation 2001; 8: 1.

15. Valdes R. Correspondence. Lancet 2002; 359: 2281.16. Archer K, Mclellan F. Controversy surrounds pro-

posed xenotransplant trial. Lancet 2002; 359: 949.17. Gunzburg WH, Salmons B. Xenotransplantation: is the

risk of viral infection as great as we thought? Mol MedToday 2000; 6: 199.

Transplanting virus-infected PICs reverses diabetes

169

18. Herring C, Cunningham DA, Whittam AJ, Fernan-

dez-Suarez XM, Langford GA. Monitoring xeno-transplant recipients for infection by PERV. Clin Biochem2001; 34: 23.

19. Tucker AW, Galbraith D, Mcewan P, Onions D.Evaluation of porcine cytomegalovirus as a potentialzoonotic agent in xenotransplantation. Transpl Proc 1999;31: 915.

20. Brewer LA, Brown C, Murtaugh MP, Njenga MK.Transmission of porcine encephalomyocarditis virus(EMCV) to mice by transplanting EMCV-infected pigtissues. Xenotransplantation 2003; 10: 569.

21. Brandhorst H, Brandhorst D, Hering BJ, Bretzel

RG. Significant progress in porcine islet mass isolationutilizing liberase HI for enzymatic low-temperature pan-creas digestion. Transpl 1999; 68: 355.

22. Njenga MK, Asakura K, Hunter SF et al. The immunesystem preferentially clears Theiler’s virus from the graymatter of the central nervous system. J Virol 1997; 71: 8592.

23. Patience C, Takeuchi Y, Weiss RA. Infection of humancells by an endogenous retrovirus of pigs. Nat Med 1997;3: 282.

24. Martin U, Kiessig V, Blusch JH et al. Expression of pigendogenous retrovirus by primary porcine endothelial cellsand infection of human cells. Lancet 1998; 352: 692.

25. Wilson CA, Wong S, Muller J et al. (Type cretrovi-rus released from porcine primary peripheral bloodmononuclear cells infects human cells. J Virol 1998; 72:3082.

26. MartinU,WinklerME, IdM et al. Productive infectionof primary human endothelial cells by pig endogenousretrovirus (PERV). Xenotransplantation 2000; 7: 138.

27. Laan LJW, van der Lockey C, Griffith BC et al.Infection by porcine endogenous retrovirus after isletxenotransplantation in SCID mice. Nature 2000; 407:501.

28. Specke V, Tacke SJ, Boller K, Schwendemann J,Denner J. Porcine endogenous retroviruses: in vitro hostrange and attempts to establish small animal models.J Gen Virol 2001; 82: 837.

29. Heneine W, Tibell A, Switzer WM et al. No evi-dence of infection with porcine endogenous retrovirus inrecipients of porcine islet-cell xenografts. Lancet 1998; 352:695.

30. Paradis K, Langford G, Long Z et al. Search for cross-species transmission of porcine endogenous retrovirus inpatients treated with living pig tissue. Science 1999; 285:1236.

31. Patience C, Patton GS, Takeuchi Y et al. No evidenceof pig DNA or retroviral infection in patients with short-term extracorporeal connection to pig kidneys. Lancet1998; 352: 699.

32. Roivainen M, Ylipaasto P, Ustinov J, Hovi T,Otonkoski T. Screening enteroviruses for b-cell tropismusing fetal porcine b-cells. J Gen Virol 2001; 82: 1909.

33. Coulson BS, Witterick PD, Tan Y et al. Growth ofrotaviruses in primary pancreatic cells. J Virol 2002; 76:9537.

170

Brewer et al.