JOURNAL OF BACTERIOLOGY, Sept. 1988, p. 4047-4054 Vol. 170, No. 90021-9193/88/094047-08$02.00/0Copyright © 1988, American Society for Microbiology

Transcriptional Regulation of the virA and virG Genes ofAgrobacterium tumefaciens

STEPHEN C. WINANS, RANDALL A. KERSTETTER, AND EUGENE W. NESTER*

Department of Microbiology, University of Washington, Seattle, Washington 98195

Received 17 March 1988/Accepted 6 June 1988

We have used transcriptional and translational fusions between various vir gene promoters and the lacZ geneto study the regulation of vir genes. Like other vir promoters, the virA promoter was induced by acetosyringonein a virA virG-dependent fashion. In addition to being induced by acetosyringone, the virG promoter wasparially induced by acidic growth conditions and by starvation for inorganic phosphate. These two conditionsappeared to act synergisticafly. The response to low pH and to phosphate starvation occurred in the absenceof the Ti plasmid and must therefore have been mediated by chromosomal genes. Two transposon-generatedmutations were obtained which attenuated induction by low pH. One of these transposons was cloned al,ngwith flanking DNA; the flanking DNA was sequenced (858 base pairs total), and the predicted amino acidsequence showed homology with a family of proteins including the Rhizobium leguminosarum nodl gene, manyof whose members bind ATP and have been implicated in active transport systems. These results are discussedas possible explanations for previous observations that the induction of the octopine vir regulon (i) occurs onlyin acidic media and (ii) shows hyperbolic kinetics after a long lag phase.

The ability ofAgrobacterium spp. to transfer and integratea defined segment of their DNA (the T-DNA) into thenuclear DNA of dicotyledonous plants makes them the onlygenerally accepted example of an organism able to transfergenetic material between the procaryotic and eucaryotickingdoms. This property has caused one member of thegenus, Agrobacteri(m tumefaciens, to be widely exploitedas a means to create transgenic plants and as a model systemfor studying bacterial phytopathogenicity (for reviews, seereferences 2, 10, 14, 22, and 36). At least 21' genes (vir genes)organized in six transcriptional units encoded by the residentTi plasmid and 4 genes encoded on the chromosome (chvA,chvB, exoC, and att) are required for the infection process(4, 11, 19, 32). These genes mediate the processing andtransfer of the T-DNA to plant cells, most likely as a linear,single-stranded molecule (1, 34, 35, 42).The transcription of most of these vir genes is significantly

elevated by culturing bacteria with plant cells or tissues (33)or by adding any of a class of substituted phenolic com-pounds such as acetosyringone (31). The induction of the virregulon depends upon the virA and virG gene products (37).A second group (38) reported that transcription of a virG::lacZ fusion was stimulated by low pH but not by acetosy-ringone or cocultivation. The fusion used in that studydisrupted the only copy of the virG gene in the cell. A thirdgroup reported that a chromosomal gene may-also play a rolein the transcriptional regulation of the virC and virD genes(8).DNA sequence analysis of the virA and virG gene prod-

ucts has revealed amino acid homology to a family of twocomponent regulatory systems (17, 24, 28, 40). Insightsabout the properties of these homologous proteins in otherregulatory systems have led to a model in which virAencodes a two-domain transmembrane protein with a peri-plasmic receptor for inducer molecules and a cytoplasmicprotein kinase. By analogy to the NtrB and NtrC proteins(23), VirA may, upon receiving an inducing signal, phos-phorylate VirG, thereby converting it from an inactive form

* Corresponding author.

to a form capable of binding to vir promoters and activatingtheir transcription.

This study refines and extends the observations of earlierstudies and provides new insights in several areas. We havetested the hypothesis that all known genes whose transcrip-tion is induced by acetosyringone are controlled by VirA andVirG. We have also retested the response of the virA andvirG promoters to acetosyringone and other environmentalstimuli and have initiated a genetic analysis of a chromo-somally encoded regulatory system controlling the expres-sion of virG.

MATERIALS AND METHODSEnzymes and reagents. Restriction endonucleases were

purchased from either New England BioLabs, Inc., orBethesda Research Laboratories, Inc.; the Sequenase DNAsequencing kit was from U.S. Biochemical Corp. 5-Bromo-4-chloro-3-indolyl-,-D-galactopyranoside (X-Gal) was fromBoehringer Mannheim Biochemicals. o-nitrophenyl-P-D-ga-lactopyranoside, isopropyl-,3-D-thiogalactopyranoside, car-benicillin, tetracycline, and calcofluor were purchased fromSigma Chemical Co., and [35S]dATP was purchased fromDupont, NEN Research Products.

Strains and plasmids. A. tumefaciens A348 is a derivativeof A136, which harbors the Ti plasmid pTiA6NC (29). A136is a derivative of strain C58 lacking the nopaline Ti plasmidpTiC58. Escherichia coli DH5a was purchased from Be-thesda Research Laboratories. Plasmid pTZ18R was pur-chased from U.S. Biochemical Corp. E. coli POII1734,which contains Mu dII1734 (6), was obtained from M.Casadaban. pMC1403 (5) was obtained from S. Lory. M13helper phage M13KO7 (J. Vieira and J. Messing, MethodsEnzymol., in press) was obtained from J. Vieira. E. coliMM294(pRK604), which harbors Tn5-132 (in which the neogene of TnS has been replaced by the tet gene of TnlQ [12])on the narrow host range, self-mobilizable plasmidpRK2013, was obtained from J. Leigh. pUCD2 (9) wasobtained from T. Close, and pTB108 was obtained from T.Bradshaw.

Fusion of promoters of virA, virC, virD, virG, pinF, and a

4047

on January 26, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4048 WINANS ET AL.

new inducible locus to the lacZ gene. (i) virA. A 4.4-kilobaseKpnI fragment of DNA containing the virA gene was intro-duced into the unique KpnI site of the broad-host-rangeplasmid pUCD2. The resulting plasmid, pTB108, was muta-genized with Mu dII1734 (6), which creates translationalfusions between a target gene and the lacZ gene. The fusionused in these studies (pRAK28) resulted from an insertion ofMu dII1734 approximately 1.1 kilobases from the start codonof VirA.

(ii) virC. Plasmid pSM379 (which contains a virC::lacZfusion [32]) and the broad-host-range vector pVK102 (16)were digested with BglII, ligated together, and used totransform E. coli DH5a to Knr and Tcr. Transformants werealso screened for P-galactosidase activity, using X-Gal, andfor sensitivity to carbenicillin. The resulting plasmid,pSW161, contained the large BglII fragment of pVK102 andthe BglII fragment of pSM379 which contained the virC::lacZ fusion.

(iii) virD. pSW162 was constructed by using the sametechnique as for pSW161 but using pSM400, which containsa virD::lacZ fusion (37).

(iv) virG. pSW164 contains a BglII-PstI fragment contain-ing the complete virG gene (40) cloned into pUC18 Cmr,using a gap created by digestion with BamHI and PstI.pSW164 was digested with EcoRI and BamHI, and anEcoRI-BamHI fragment containing the virG promoter andabout three-fourths of the virG gene was inserted into a gapin plasmid pMC1403 created by digestion with EcoRI andBamHI. The resulting plasmid, pSW173, containing a virG::lacZ translational fusion, was digested with SalI and PstIand ligated with the broad-host-range plasmid pUCD2 afterdigestion with the same enzymes, creating pSW174. pSW174contains only 111 base pairs (bp) of DNA upstream of theinducible transcription start site (37).

(v) pinF. pSM229 (32) containing a pinF::lacZ fusion wasdigested with BamHI; the fragments were ligated uponthemselves and used to transform strain DH5a to Knr.Colonies were screened for ,3-galactosidase activity, usingX-Gal, and for sensitivity to carbenicillin. The resultingplasmid, pSW202, contained two BamHI fragments: onecontaining vector pVK102 and the other containing thepinF: :lacZ fusion.

(vi) Novel inducible locus. A lacZ fusion was made to aninducible locus which lies about 8 kilobases toward theT-DNA from virE by Tn3HoHol insertion mutagenesis ofpVCK228 (unpublished observations), thus creating pPT520.

Induction of vir genes. Unless otherwise stated, the virgenes were induced in "induction broth": AB salts (7), 2.5mM phosphate, 3% sucrose, and 20 mM morpholineethane-sulfonic acid (MES), pH 5.5. Acetosyringone was added as a100 mM stock solution to a final concentration of 200 ,uM.These components were generally filter sterilized and com-bined prior to use, although in other studies we havecombined and autoclaved all components except acetosy-ringone in volumes up to 12 liters. The same medium wasincorporated into agar plates by the addition of 1% Difcoagar and 40 jxg of X-Gal per ml. Bacteria were grown to anoptical density at 600 nm of 1.0 in AB broth (7), centrifuged,and then suspended at a 200-fold concentration in watercontainivg 10% glycerol, aliquoted, and frozen at -70°C.For incuction, thawed bacteria were suspended in water,used to inoculate 6.0 ml of induction broth to an initialoptical density at 600 nm of 0.05 in a 15-ml culture tube, andincubated at 28°C on a reciprocal shaker (160 oscillations permin). At the indicated time intervals, 1.5 ml of cell suspen-sion was removed and frozen at -70°C. When sampling was

completed, all aliquots were thawed, and ,-galactosidasewas assayed (20).Transposon mutagenesis with TnS-132. A 1.0-ml portion of

each stationary-phase culture of strains A348(pSW174),which contains a virG::lacZ fusion, and MM294(pRK604)was filtered onto a membrane filter (Millipore Corp.) andallowed to mate overnight on L-agar plates at 30°C. The cellswere suspended and plated onto plates containing inductionbroth (pH 6.0), 0.025 mM phosphate, 4 ,ug of tetracycline perml (to select for transposition of TnS-132 from pRK604), 30,ug of carbenicillin per ml (to counterselect cells lackingpSW174), 40 jig of X-Gal per ml, and 1% Difco agar. Onsimilar plates lacking tetracycline, nonmutagenized cellsform medium blue colonies, so mutants having either ele-vated or depressed levels of expression could be recovered.Approximately 15,000 colonies were screened. Inoculationof kalanchoe leaves with Agrobacterium strains was per-formed as described previously (39).

Nucleotide sequence analysis. DNA cloned into pTZ18Rwas packaged by infection of strains with phage M13KO7.Single-stranded DNA was purified and sequenced on bothstrands, using methods described in the Sequenase kit (U.S.Biochemical Corp.), with either the "reverse" primer sup-plied with the kit or a custom synthesized primer (AAACGGGAAAGGTTCCG) complementary to a region of TnS DNA31 to 47 bp from its termini.

RESULTS

Regulation of virC, virD, pinF, and a novel inducible locus.Stachel and Zambryski (37) reported that induction of pinFrequired at least VirG, while that of virC and virD required atleast VirA, and suggested that induction of pinF, virC, andvirD may therefore require both regulatory proteins. Wetested their hypothesis by introducing a virC::lacZ, a virD::lacZ, or a pinF::lacZ fusion into Agrobacterium strainscontaining either a wild-type Ti plasmid or a Ti plasmidcontaining mutations in either virA or virG. As predicted(Fig. la, b, and c), a mutation in either virA or virG abolishedinduction. Another gene which is inducible by acetosy-ringone has been localized to a region about 8 kilobases fromthe 3' end of virE (unpublished observations); induction ofthis gene also depended upon VirA and VirG (Fig. ld).

Regulation of virA and virG. Plasmids containing a virA::lacZ translational fusion (pRAK28) or a virG::lacZ transla-tional fusion (pSW174) were introduced into the Agrobacte-rium strains having the same genetic backgrounds as aboveand tested for induction. The virA promoter was inducedabout ninefold by acetosyringone in a wild-type strain, whileinduction was not observed in strains containing a virA or avirG mutation (Fig. 2A). A second virA::lacZ fusion con-structed with Mu dII1734 showed similar results (data notshown). In two previous studies (32, 37), the virA promoterwas reported not to be inducible. We retested all three of thevirA::lacZ fusions used in those studies (pSM202, pSM211,and pSM409) and also found that they were not induced byacetosyringone (data not shown). Possible explanations forthis discrepancy are provided in the Discussion.

Induction of the virG promoter appears to have twocomponents. In agreement with previous studies (37), fullinduction of virG required a virA+ virG+ genotype andacetosyringone (Fig. 2B), while a lower level of inductionwas observed in strains containing a mutation in either thevirA or the virG gene. The vir+ strain, when cultured ininduction broth lacking acetosyringone, showed the samelevel of induction as observed with the virA or virG mutants

J. BACTERIOL.

on January 26, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

A. TUMEFACIENS virA AND virG GENES 4049

B~~~~~~~~~~~~~~~~~~~~~~~~~i5 10 16.5 24 5 10 16.5 24

E'1C D

75- 400

0 12 24 0 12 24TIME (HOURS)

FIG. 1. Transcriptional induction of virC, virD, pinF, and a novel inducible locus by acetosyringone. Strains previously grown in AB brothand frozen at -70°C were used to inoculate 6.0-ml cultures of induction broth containing or lacking 200 ,uM acetosyringone as described inMaterials and Methods. Induction of the: (A) virC promoter of pSW161; (B) virD promoter of pSW162; (C) pinF promoter of pSW202; and(D) a novel inducible promoter on pPT520. Symbols: (0) A348; (A) A348 virA226 or A348 virA237; (0) A348 virG; (A) A348 cultured inmedium lacking acetosyringone.

with acetosyringone. We term this partial induction "mediashift induction" because it occurred when bacteria wereshifted from AB broth to induction broth. The virG promoterwas induced to the same levels by using a strain lacking theTi plasmid (see below), indicating that all regulatory proteinsrequired for media shift induction must be encoded by eitherthe chromosome or the large cryptic plasmid present instrain A136. Media shift induction was not observed for anyother vir or pin promoter.

Induction of virG by low pH and phosphate starvation. Weundertook to determine what properties of induction brothwere responsible for media shift induction of virG. AB brothand induction broth differ in the following respects: the pHof the former is 7.0, while that of the latter is 5.5; concen-tration of phosphate of the former is 25 mM, while that of thelatter is 2.5 mM; the former does not contain MES, and ABbroth contains 0.5% glucose as the sole carbon source, whileinduction broth contains 3% sucrose. We therefore preparedinduction broth modified in each of these properties andtested each broth for media shift induction. We found thatmedia shift induction was due to the low pH of inductionmedia. Incubation in induction broth at pH 5.5 induced virG,while incubation in the same broth at pH 7.0 did not (Fig. 3).This finding is entirely consistent with the observation ofVeluthambi et al. (38) that a virG::lacZ fusion present on the

900

io 5000

0 ~~~~~~~~~300

01 00 7 24 0 4 6 14

TIME (HOURS) TIME(HOURS)

FIG. 2. Transcriptional induction of virA and virG. Strains andinduction conditions were the same as described in the legend toFig. 1. Induction of the: (A) virA promoter of pRAK28; (B) virGpromoter of pSW174. Symbols are the same as in Fig. 1.

VOL. 170, 1988

on January 26, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4050 WINANS ET AL.

0

o1d300-

0~~~~

A-~~~~O~~~~~~~

0 5 12 24TIME(HOUR S)

FIG. 3. Partial induction of virG by acidic growth media andphosphate starvation. A136(pSW174) was cultured as in inductionbroth without acetosyringone and modified in the following ways:(A) no modifications; (A) pH 7.0; (A) pH 7.0, no phosphate; (0) pH5.0, no phosphate.

Ti plasmid was inducible by low pH but not by acetosy-ringone. Shifting cells from AB broth to MS- plant cell broth(pH 5.7; see reference 21) resulted in a similar stimulation oftranscription.

Since the media shift induction resulted from low pH, arather stressful environment, we tested other stresses thatalso might induce virG. We cultured cells in induction brothlacking various nutrients and found that starvation for inor-ganic phosphate also caused partial induction (Fig. 3). Star-vation for magnesium, sulfate, or ammonium did not causeinduction, nor did anoxia or UV irradiation (data notshown). Whether the two inducing conditions might actcooperatively was tested by incubating cells in inductionbroth lacking inorganic phosphate at pH 5.5. These condi-tions greatly stimulated transcription (Fig. 3). The level ofinduction was significantly greater than the sum of the twotreatments alone, indicating that they act synergistically. Noother vir promoter was induced by either of these treat-ments.

Isolation of mutations affecting media shift induction. Wedevised a plate assay, described in Materials and Methods,to screen for mutants unable to carry out media shiftinduction. Of the approximately 15,000 colonies examined,30 colonies had an altered level of P-galactosidase activity.Of these, 12 were completely white. These probably had thetransposon inserted into the lacZ gene of pSW174, sincethey were resistant to higher levels of tetracycline than allother transductants, as would be expected of the higher tetAgene dosage of any insertion in pSW174. These mutantswere not characterized further. Two additional mutants werelighter blue than the wild type, and 16 mutants were darkerblue than the wild type. Liquid 13-galactosidase assays witho-nitrophenyl-p-D-galactopyranoside were performed on all18 strains. The two mutants forming light blue colonies didindeed have lower levels of P-galactosidase (see below),while surprisingly, the 16 strains that gave rise to dark bluecolonies did not have elevated levels of enzyme whenassayed in liquid (data not shown). Since liquid assays wereperformed after cell lysis, it is possible that the mutants

riij. S. tteLLuatiUoLin VIiUICiliC Uy a ClVL MULanL Ou iWaiUMMU

leaves. Strains (left) A348(pSW174) and (right) A348 chvDI(pSW174) were grown on AB agar and used to inoculate woundedkalanchoe leaves. Pictures were taken 3 weeks after infection.

which formed dark blue colonies were more permeable toX-Gal than the wild type.The two mutants that showed lower levels of P-galacto-

sidase were used to inoculate kalanchoe leaves. One mutant(provisionally denoted chvD, for chromosomal vir) wasseverely attenuated in virulence (Fig. 4), while the othermutant (which may lie in the same gene) appeared to show amore moderate deficiency (data not shown). In liquid assays

'u

Co

0

0-J

0

CJI-z

B

0

/0

o/ft

0 12 24 0 12 24 0 12 24

TIME (HOURS)

FIG. 5. Attenuated induction of virG by acidic growth media andphosphate starvation in a chvD mutant. Strains A348(pSW174) (0)and A348 chvDl(pSW174) (D) were cultured as in induction brothwithout acetosyringone and modified in the following ways: (A) nomodifications; (B) pH 7.0, no phosphate; (C) pH 5.5, no phosphate.

J. BACTERIOL.

on January 26, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

A. TUMEFACIENS virA AND virG GENES 4051

GTCTT-TACAACCAATTGATGATGACTATT CTCATCATGAAACCTCCCATGATC

GccTGAGAGATAcCAcAccCTCTTCTGACADGcEcGDTGATTTKMccAcGTGcG

XZ| ZM M! "" SS ---^D R L L i YGACAGCCTCAGAACCTGTCTG GTTCTAT TGGCAAATOAGATGCGCATGCAGT AGCCcGT CTD G N S LQE E K A K L Q C P a DF m T D v P S L e F A L E

GCCGTAACCGGCCTTTC CGTGGTGAGCGGGTGTGGATCTTcCAGCTCTTGCTTGcCCTGACCTOCTGR mb A G A

CTGCTTGACGAACCOTACCAACTGGCTGAC AACACCATCGCTGGCTCGGCAAAAGCAGACTATCCC¢GCLLD E P I N H

RA L E H LR Y P Go~~~~~~~ I 3 !1 e31eI;E RL S L R G K

GCCGTGATGATGATCACCCACGACCTCTACTTCCTCGACAACGTCACCcACTATGGCTCGATAGGGTCTCGTAGC

^JY i i ^ i E E AI | e c 3 M c v AI ^ iGACATTCCCTACGAC cGGCTATCTTGC A AcACACTGGACG 1 Y E G N Y S A Y L 0 A K A K R M Q 0 E A R E DK

GOCCTCGCGCCAGAA GOCGATCAGCCGCCAGCAGGAMATGGATCOCTTCCACOCCCCMAAGCTCGCCAGACGAAGTCCAAGA S R 0 K A I S R E Q E W I A S S P K A R Q T K S K

CGCAGTATCcG GTTATGACAGCTCGTAGGGTCCGCTGAAAACCGTCGTCCXGAGA ACGCGCAGATCGTCATTCCGA R I R R Y D E L V E A A E N R R P G D DQ I V I P

GTCGCCAGCGTCTGGGCCGTGTCGTTATCGAJU8X>LAAACCTCACCAAGTCCTATGGCGATCGGGTTCTCATCGAA

AACCTGACCTTCAAGTGCCTCCGGOCTTGTCGGTGTGAT ----CG TGCAGGTAAGACCACACTGTTTfib1E i G G I FiTeZ5ifCGCATGATCACCGGTCAGGAACAGCCAGATAGCGGTTCGGTGACCGTTGOOGAGACX;TGCAOCTCTOATACGTCGAC

iIT 0 a s vI G E T V H L GYV D|;|L m S v fiL G A Q E P aQ

FIG. 6. Amino acid (aa) homology between an internal fragment of ChvD and the NodI protein. (Top line) An 858-bp DNA sequencecloned from Agrobacterium chromosome on either side of TnS-132. All TnS-132 DNA and one copy of the 9-bp direct repeats generated uponinsertion have been removed. Overlined letters denote sequences present as direct repeats flanking the transposon. (Middle line) Inferredamino acid sequence in the +1 reading frame. (Bottom line) Internal fragments of the NodI protein aligned with ChvD to show amino acidhomology. Amino acid residues shown in black boxes are either identical or similar to their counterparts in ChvD.

for P-galactosidase, these mutants showed an attenuatedresponse to both low pH and phosphate starvation. Theresponses of the chvD mutant are shown in Fig. 5; the othermutant showed similar properties (data not shown). We arecurrently testing the hypothesis that chvD is indeed a chro-mosomal gene; that no plasmid-coded genes are necessaryfor regulation strongly suggests that this gene ought to bechromosomally localized.DNA sequence of a fragment of the chvD gene. To clone the

region containing the transposon insertion, chromosomalDNA of the mutant strain was digested with SalI, shotguncloned into the E. coli plasmid vector pTZ18R, and used totransform strain DH5a to Tcr. Since TnS-132 lacks internalSalI sites, this procedure resulted in cloning the entiretransposon with 526 bases on the left and 341 bases on theright. These flanking sequences were subcloned and se-quenced on both strands. These sequences were used todetermine the sequence of that portion of the gene prior totransposon insertion. The resulting sequence, 858 bp inlength, was translated in all possible reading frames andfound to have no stop codons in either the +1 or the -1reading frame, while all other reading frames containednumerous stop codons. The amino acid sequences predictedby these two reading frames were used to search the PIR

protein data base (release 14; 4,721 sequences) of the Na-tional Biomedical Research Foundation for homologousproteins, using the FASTP algorithm (18). While the -1reading frame did not show significant similarity to anyprotein in the data base, the + 1 reading frame showed aminoacid homology to a family of bacterial ATP binding proteins,most of whose members play a role in active transport (13).The alignment of the + 1 reading frame with the nodl geneproduct of Rhizobium leguminosarum, which gave the high-est similarity score (i.e., 163), is shown in Fig. 6; other highscores (in parentheses) were obtained against nine otherproteins, including E. coli HisP (140), MalK (127), OppD(139), and PstB (91).The homology between chvD and nodl appears in two

noncontiguous regions. Amino acids 5 to 80 of NodI showhomology to the carboxy terminus of the ChvD fragment,while amino acids 90 to 223 of NodI show homology to theamino terminus. This may mean that the putative ATPbinding domain ofChvD is present in two copies, as is foundin the E. coli RbsA protein (13), or that it has in some waybecome permuted with respect to the other members of thisgene family. The standard deviation scores obtained fromthe RDF algorithm of Lipman and Pearson (18) were 15.8and 14.9 for these two regions, respectively, indicating a

VOL. 170, 1988

on January 26, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4052 WINANS ET AL.

very strong probability that ChvD and NodI are evolution-arily related.

DISCUSSION

We have explored several aspects of the transcriptionalregulation of Agrobacterium virulence genes. First, we haveshown that VirA and VirG are required for the induction ofvirC, virD, pinF, and another inducible locus to the right ofvirE. The tzs gene of the nopaline Ti plasmid pTiT37, whichencodes a cytokinin biosynthetic enzyme, has also beenfound to be inducible by acetosyringone in a virA virG-dependent manner (15). In agreement with that study, wefound that mutations in virA completely abolish induction,while others (37) report that such mutations greatly attenuateinduction. The reasons for this discrepancy are not clear. IfvirA mutations only attenuated induction, one would have topostulate that an inducer can activate VirG by a VirA-independent informational pathway (for example, using aprotein functionally analogous to VirA). Our finding thatvirA mutations abolish induction indicates that no suchmechanism need exist.We also reexamined regulation of the virA and virG genes

themselves. We questioned the previous finding (32) that thevirA promoter is expressed constitutively for two reasons: (i)the virA promoter contains a dodecanucleotide sequencesimilar to a family of sequences (TNCAATTGAAAPy)found within all inducible vir promoters (41); (ii) the virAgene of the nopaline plasmid pTiC58 is inducible by acetosy-ringone (27). Lack of induction of the three previouslycharacterized Tn3HoHol insertions (32) could be explainedby the observation that insertions within a given gene canresult in quite different levels of P-galactosidase activity, forreasons that are not clear. Although the level of inductionwas lower than for other vir genes, the induction wasreproducible and could not be accounted for by experimentalvariation. The cellular concentration of VirA protein alsohas been observed to increase during vir gene induction (J.Ward and E. W. Nester, manuscript in preparation).

In this study, we have not determined whether the stimu-lation of virA expression by acetosyringone occurred at thelevel of transcription initiation or in some other way. How-ever, the finding that VirA and VirG are required suggestsstrongly that the virA promoter is regulated by the samemechanism as other vir promoters. Stachel and Zambryski(37) have demonstrated that vir gene induction occurs at thetranscriptional level, probably at the level of transcriptioninitiation. It was reported in that study that the cellularconcentration of virA mRNA was not affected by vir induc-tion. The most likely explanation for this discrepancy is thatthe relatively modest induction of the virA gene was notdetectable by those methods.Our findings on the regulation of the virG promoter

corroborate and extend observations of Stachel andZambryski (37) and Veluthambi et al. (38). In agreement withthe former study, we found that full induction of the virGpromoter required functional copies of virA and virG and aninducer such as acetosyringone, while partial induction wasobserved in strains containing a mutation in either virA orvirG. We show here that this partial induction is alsoindependent of an inducer such as acetosyringone; rather, itoccurred in response to shifting ofgrowth media. The findingthat media shift induction is due to the low pH of inductionbroth agrees entirely with the findings of Veluthambi et al.(38), who reported that virG was induced eightfold byculturing bacteria in acidic broth but was not induced by

acetosyringone. The lack of induction by acetosyringone intheir study was almost certainly because the strain used wasvirG. In this report, we have shown that Ti plasmid-encodedgenes are not required for media shift induction. Stachel andZambryski (37) reported that virG is expressed from twopromoters, one which they labeled "constitutive" and theother "inducible." It seems plausible that both promotersare actually inducible, one by acetosyringone and the otherby low pH. This hypothesis is currently under investigation.We found that starvation for phosphate also induced virG.

The observed synergy between these inducing stimuli sug-gests that the cellular response to them may be mediatedthrough a single pathway. That the chvD mutation attenuatesthe response to both inducing stimuli supports this hypoth-esis. However, we have not found any precedent for a

regulatory system that responds to both acidic pH andphosphate starvation. A large number of genes inducible byphosphate starvation have been identified in E. coli (38a); toour knowledge, the response of these genes to culturing inacidic media has not been tested. Similarly, there is at leastone other report of bacterial genes induced by low extracel-lular pH (30), and it was not determined whether these geneswere inducible by phosphate starvation. It is difficult at thisstage to hypothesize about the role of chvD in this regulatorysystem, especially since mutations in this gene do not fullyabolish induction. The chvD product appears to play an

ancillary and partially dispensable role in this regulatorysystem. The fact that many or all of ChvD homologs are

involved in active transport (13) suggests that ChvD couldplay a similar role.The induction of virG by low pH may explain the low pH

optimum for the induction of all other vir genes (33). Ac-cording to this view, induction of vir genes may be a

two-step process. In the first step, the virG promoter isinduced by low pH, resulting in elevated levels of VirGprotein. In the second step, the VirA protein, activated byacetosyringone, converts VirG to an active form, which thenfurther activates transcription of its own gene and all othervir genes. At neutral pH, the concentration of VirG proteinwould be too low for the second step to occur, thus prevent-ing efficient induction. Alternatively, the low pH optimumfor induction may be attributable to VirA functioning only atlow pH. Either way, acidic growth conditions may serve asa second signal of the presence of a wounded plant suscep-tible to infection (3). Interestingly, John and Amasino (15)report that a strain harboring the nopaline plasmid pTiT37does not show a low pH optimum for induction of the tzsgene by acetosyringone.That both virA and virG play a positive role in their own

regulation makes them distinctive among bacterial regula-tory genes, among which negative autoregulation is far morecommon. The positive regulation by NtrB and NtrC of theglnApl promoter (from which is expressed g1nA, ntrB, andntrC) provides a second example of positive autoregulation(26). The positive autogenous control of virA and virGprobably creates a positive feedback loop, in which thehigher the concentration of these proteins at any moment,the faster they are produced. This assumes that one or bothof these proteins is rate limiting for induction, which appearsto be the case, since increasing the gene dosage of virGresults in enhanced nicking at T-DNA borders (1, 42). Sucha positive feedback loop may explain the rather slow kineticsof vir gene induction observed here and in earlier studies(40), with little response until at least 6 h after addition of theinducer and very strong induction thereafter.

Positive autoregulation has been interpreted as being

J. BACTERIOL.

on January 26, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

A. TUMEFACIENS virA AND virG GENES 4053

useful to commit a cell irreversibly to a certain physiologicalstate. The most thoroughly studied example is the "de-cision" made by bacteriophage lambda whether to lyse or tolysogenize a host cell (25). By analogy, perhaps Agrobacte-rium makes a similar decision whether or not to commit itselfto the infection process. It is conceivable that the probabilityof a successful infection is rather low or the infection processis energetically costly or both. If so, it might benefit abacterium for the infection process to be an all-or-nothingprocess in which the vir regulon is induced only if theinducing stimulus is perceived over a considerable period oftime and that induction, once undertaken, be as strong aspossible.

ACKNOWLEDGMENTSWe thank P. Totten for use of pPT520 prior to publication and J.

Ward, J. Cangelosi, and S. Porter for helpful discussions.This work was supported by Public Health Service grant 5 RO1

GM 32618-14 from the National Institutes of Health and NationalScience Foundation grant DMB-8315826. S.C.W. was supported byDamon Runyon-Walter Winchell Cancer Fund Fellowship DRG-800.

LITERATURE CITED1. Albright, L. M., M. F. Yanofsky, B. Leroux, D. Ma, and E. W.

Nester. Processing of the T-DNA ofAgrobacterium tumefaciensgenerates border nicks and linear, single-stranded T-DNA. J.Bacteriol. 169:1046-1055.

2. Bevan, M. W., and M.-D. Chilton. 1982. T-DNA of the Agro-bacterium Ti- and Ri-plasmids. Annu. Rev. Genet. 16:357-384.

3. Bolker, T., and A. Weimken. 1986. Dynamics of vacuolarcompartmentation. Annu. Rev. Plant Physiol. 37:137-164.

4. Cangelosi, G. A., L. Hung, V. Puvanesarajah, G. Stacey, D. A.Ozga, J. A. Leigh, and E. W. Nester. 1987. Common loci forAgrobacterium tumefaciens and Rhizobium meliloti exopoly-saccharide synthesis and their roles in plant interactions. J.Bacteriol. 169:2086-2091.

5. Casadaban, M. J., J. Chou, and S. N. Cohen. 1980. In vitro genefusions that join an enzymatically active P-galactosidase seg-ment to amino-terminal fragments of exogenous proteins: Esch-erichia coli plasmid vectors for the detection and cloning oftranslational initiation signals. J. Bacteriol. 143:971-980.

6. Castilho, B. A., P. Olfson, and M. J. Casadaban. 1984. Plasmidinsertion mutagenesis and lac gene fusion with mini-Mu bacte-riophage transposons. J. Bacteriol. 158:488-495.

7. Chilton, M.-D., T. Currier, S. Farrand, A. Bendich, M. Gordon,and E. W. Nester. 1974. Agrobacterium tumefaciens DNA andPS8 bacteriophage DNA not detected in crown gall tumors.Proc. Natl. Acad. Sci. USA 71:3672-3676.

8. Close, T. J., P. M. Rogowsky, C. I. Kado, S. C. Winans, M. F.Yanofsky, and E. W. Nester. 1987. Dual control of the Agrobac-terium tumefaciens Ti plasmid virulence genes. J. Bacteriol.169:5113-5118.

9. Close, T. J., D. Zaitlin, and C. I. Kado. 1984. Design anddevelopment of amplifiable broad-host-range cloning vectors:analysis of the vir region ofAgrobacterium tumefaciens plasmidpTiC58. Plasmid 12:111-118.

10. Depicker, A., M. Van Montagu, and J. Schell. 1983. Plant celltransformation by Agrobacterium plasmids, p. 143-176. In T.Kosuge, C. P. Meridity, and A. Hollaender (ed.), Geneticengineering in plants: an agricultural perspective. Plenum Pub-lishing Corp., New York.

11. Douglas, C. J., R. J. Staneloni, R. A. Rubin, and E. W. Nester.1985. Identification and genetic analysis of an Agrobacteriumtumefaciens chromosomal virulence gene. J. Bacteriol. 161:850-860.

12. Egner, C., and D. E. Berg. 1981. Excision of transposon Tn5 isdependent on the inverted repeats but not on the transposasefunction of Tn5. Proc. Natl. Acad. Sci. USA 78:459-463.

13. Higgins, C. F., I. D. Hiles, G. P. C. Salmond, D. R. Gill, J. A.Downie, I. J. Evans, I. B. Holland, L. Gray, S. D. Buckel, A. W.

Bell, and M. A. Hermodson. 1986. A family of related ATP-binding subunits coupled to many distinct biological processesin bacteria. Nature (London) 323:448-450.

14. Hooykaas, J. J., and R. A. Schilperoort. 1984. The moleculargenetics of crown gall tumorigenesis. Adv. Genet. 22:210-283.

15. John, M. C., and R. M. Amasino. 1988. Expression of anAgrobacterium Ti plasmid gene involved in cytokinin biosyn-thesis is regulated by virulence loci and induced by plantphenolic compounds. J. Bacteriol. 170:770-795.

16. Knauf, V. C., and E. W. Nester. 1982. Wide host range cloningvectors: a cosmid clone bank of an Agrobacterium Ti plasmid.Plasmid 8:45-54.

17. Leroux, B., M. F. Yanofsky, S. C. Winans, J. E. Ward, S. F.Zeigler, and E. W. Nester. 1987. Characterization of the virAlocus of Agrobacterium tumefaciens: a transcriptional regulatorand host range determinant. EMBO J. 6:849-856.

18. Lipman, D. J., and W. R. Pearson. 1985. Rapid and sensitiveprotein similarity searches. Science 227:1434-1441.

19. Matthysse, A. G. 1987. Characterization of nonattaching mu-tants of Agrobacterium tumefaciens. J. Bacteriol. 169:313-323.

20. Miller, J. H. 1972. Experiments in molecular genetics. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

21. Murashige, T., and F. Skoog. 1962. A revised medium for rapidgrowth and bioassays with tobacco tissue culture. Physiol.Plant. 15:473-497.

22. Nester, E. W., M. P. Gordon, R. M. Amasino, and M. F.Yanofsky. 1984. Crown gall: a molecular and physiologicalanalysis. Annu. Rev. Plant Physiol. 35:387-413.

23. Ninfa, A. J., and B. Magasanik. 1986. Covalent modification ofthe glnG product, NRI, and the glnL product, NRII, regulatesthe transcription of the glnALG operon in Escherichia coli.Proc. Natl. Acad. Sci. USA 83:5909-5913.

24. Nixon, B. T., C. W. Ronson, and F. M. Ausubel. 1986. Two-component regulatory systems responsive to environmentalstimuli share strongly conserved domains with the nitrogenassimilation regulatory genes ntrB and ntrC. Proc. Natl. Acad.Sci. USA 83:7850-7854.

25. Ptashne, M., A. Jeffrey, A. D. Johnson, R. Maurer, B. J. Meyer,C. 0. Pabo, T. M. Roberts, and R. J. Sauer. 1980. How thelambda repressor and cro work. Cell 19:1-11.

26. Reitzer, L. J., and B. Magazanik. 1985. Expression of ginA inEscherichia coli is regulated at tandem promoters. Proc. Natl.Acad. Sci. USA 82:1979-1983.

27. Rogowsky, P. M., T. J. Close, J. A. Chimera, J. J. Shaw, andC. I. Kado. 1987. Regulation of the vir genes of Agrobacteriumtumefaciens plasmid pTiC58. J. Bacteriol. 169:5101-5112.

28. Ronson, C. W., B. T. Nixon, and F. M. Ausubel. 1987. Con-served domains in bacterial regulatory proteins that respond toenvironmental stimuli. Cell 49:579-581.

29. Sciaky, D., A. L. Montoya, and M.-D. Chilton. 1977. Finger-prints of Agrobacterium Ti plasmids. Plasmid 1:238-253.

30. Slonczewski, J. L., T. N. Gonzaliz, F. M. Bartholomew, andN. J. Holt. 1987. Mu d-directed lacZ fusions regulated by lowpH in Escherichia coli. J. Bacteriol. 169:3001-3006.

31. Stachel, S. E., E. Messens, M. Van Montague, and P. Zambryski.1985. Identification of the signal molecules produced bywounded plant cells that activate T-DNA transfer in Agrobac-terium tumefaciens. Nature (London) 318:624-629.

32. Stachel, S. E., and E. W. Nester. 1986. The genetic and tran-scriptional organization of the vir region of the A6 Ti plasmid ofAgrobacterium tumefaciens. EMBO J. 5:1445-1454.

33. Stachel, S. E., E. W. Nester, and P. C. Zambryski. 1986. A plantcell factor induces Agrobacterium tumefaciens vir gene expres-sion. Proc. Natl. Acad. Sci. USA 83:379-383.

34. Stachel, S. E., B. Timmerman, and P. Zambryski. 1986. Gener-ation of single-stranded T-DNA molecules during the initialstages of T-DNA transfer from Agrobacterium tumefaciens toplant cells. Nature (London) 322:706-712.

35. Stachel, S. E., B. Timmerman, and P. Zambryski. 1987. Activa-tion of Agrobacterium tumefaciens vir gene expression gener-ates multiple single-stranded T-strand molecules from the pTiA6T-region: requirement for 5' virD products. EMBO J. 6:857-863.

36. Stachel, S. E., and P. C. Zambryski. 1986. Agrobacterium

VOL. 170, 1988

on January 26, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4054 WINANS ET AL.

tumefaciens and the susceptible plant cell: a novel adaptation ofextracellular recognition and DNA conjugation. Cell 47:155-157.

37. Stachel, S. E., and P. C. Zambryski. 1986. virA and virG controlthe plant-induced activation of the T-DNA transfer process ofA. tumefaciens. Cell 46:325-333.

38. Veluthainbi, K., R. K. Jayjswal, and S. B. Gelvin. 1987. Viru-lence genes A, G, and D mediate the double stranded bordercleavage of T-DNA from the Agrobacterium Ti plasmid. Proc.Natl. Acad. Sci. USA 84:1881-1885.

38a.Wanner, B. 1987. Phosphate regulation of gene expression inEscherichia coli, p. 1326-1333. In F. C. Neidhardt, J. L. In-graham, K. B. Low, B. Magasanik, M. Schaechter, and H. E.Umbarger (ed.), Escherichia coli and Salmonella typhimurium:cellular and molecular biology, vol. 2. American Society forMicrobiology, Washington, D.C.

39. White, F. F., and E. W. Nester. 1980. Hairy root: plasmidencodes virulence traits in Agrobacterium rhizogenes. J. Bac-teriol. 141:1134-1141.

40. Winans, S. C., P. R. Ebert, S. E. Stachel, M. P. Gordon, andE. W. Nester. 1986. A gene essential for Agrobacterium viru-lence is homologous to a family of positive regulatory loci. Proc.Natl. Acad. Sci. USA 83:8278-8282.

41. Winans, S. C., S. Jin, T. Komari, K. M. Johnson, and E. W.Nester. 1987. The role of virulence regulatory loci in determiningAgrobacterium host range, p. 573-582. In D. von Wettstein andN.-H. Chua (ed.), Plant molecular biology. Plenum PublishingCorp., New York.

42. Yanofsky, M. F., S. G. Porter, C. Young, L. A. Albright, M. P.Gordon, and E. W. Nester. 1986. The virD operon of Agrobac-terium tumefaciens encodes a site-specific endonuclease. Cell47:471-477.

J. BACTERIOL.

on January 26, 2020 by guesthttp://jb.asm

.org/D

ownloaded from