Transcription and Translation Practice

TACGCTGACGAGAAATTAATTTCCTTGACT

Write the mRNA

Translate the mRNA into a protein.

Chapter 18

Your mama is a llama…Well, she actually just shares many genes with a llama. So do you. No

spitting, please.

I. Bacteria, Environment, & Gene ExpressionA. Operons

1. A group of genes involved in the same process controlled by one promoter.

a) Called a transcription unit2. One long mRNA is produced for all the genes.

a) Proteins are translated separately…not one big protein.

3. Operator – control module for transcriptiona) Contained within the promoter or between

promoter and start siteb) Controls access of RNA pol to genes

4. Benefit: One on/off switch controls all genes in pathway

a) Called coordinate control

B. The Tryptophan Operon (Repressible Operon – usually anabolic)

1. Five genes encode enzymes for tryptophan synthesis.

2. Default setting in “on” for transcriptiona) trp repressor binds operator to turn

transcription off.1) trp repressor is allosteric protein2) in absence of tryptophan, trp repressor is off3) when tryp is present, it binds repressor, activating it so it turns off operon4) Tryp is a corepressor in this instance

Trp repressor is a regulatory gene.

It is expressed continuously but not necessarily in

its active form

C. Lac Operon (Inducible Operon – usually catabolic)

1. Three genes involved in lactose digestiona) Default setting is off

2. lacI is a repressor protein. (regulatory gene)

a) Synthesized in an active formb) An inducer protein (allolactose) binds

to lacI protein and inactivates it.1) Allolactose is a form of lactose so

when you eat dairy it is there.Both of these operons are under negative control. Negative because the object that binds the operator of the operon is a repressor.

D. Positive Regulation of the Lac Operon1. The Battle between Good (glucose) and

Not-as-good (lactose)a) Meaning the cell will use glucose as

food source if it is available.2. Catabolite Activator Protein (CAP) is a

gene activatora) Default state is inactiveb) When glucose is scarce, cAMP is

produced.c) cAMP binds CAP and activates it, which

goes and activates the lac operon.3. If glucose is present, then CAP is inactive

and operon is much less active, even if lactose is present.

II. Eukaryotic Gene RegulationA. Differential Gene Expression

1.The expression of different genes by cells with the same genome.

2. Differentiated cells express a low percentage of the total # of genes

3.Many different control points for control of gene expression

B. Control via Chromatin Structure1. location of promoter relative to histones.2. location in heterochromatin or euchromatin3. Chemical modification of histones

a) N terminus of histones is accesible for modification

b) acetylation – prevents binding to neighboring nucleosomes.1) makes DNA more accessible

c) methyl groups – makes DNA less accesibled) phosphate next to methyl – makes DNA

more accessible.e) histone code hypotesis – modification of

histones determines chromatin structure and therefore gene regulation

4. DNA methylationa) inactive DNA is highly methylated

1) inactive X-chromosomesb) removal of methylation activate histone

acetylation…gene expressionc) seems to be more permanentd) genomic imprinting – methylation of

either paternal or maternal allele for expression from one chromosome only.

5. Epigenetic Inheritancea) changes in phenotype (appearance)

or gene expression caused by mechanisms other than changes in the underlying DNA sequence

b) passed on from one cell to another in DNA replication and cell division

c) often involves modifications to chromatin

d) often a factor in development and differentiation of cells.

C. Regulation of Transcription Initiation1. Control elements play a key role

a) sequences of DNA where other proteins bind to control transcription.

2. Transcription Factorsa) general transcription factors required

for all transcription

b) Enhancers and specific transcription factors1) proximal control elements – located

close to promoter2) distal control elements – located farther

away…called enhancersa} may be upstream or downstreamb} other proteins may bend DNA bringing enhancer closer to promoter

c} proteins binding at enhancer interact with RNA pol to initiate transcription.d} repressors may block RNA pol or prevent other transcription factors from interacting with RNA pol.e} repressors may affect chromatin structure via recruitment of histone modifiersf} seems to be a common method for silencing genes

c) Combinatorial control of expression1) enhancers have binding sites for

multiple proteins (control elements)2) however only one or two proteins

may bind enhancer3) combination of control elements

controls transcription.

d) coordinately controlled genes1) some genes that work on the same

process are located near each other in genome.

2) changes in chromatin structure affect all those genes at one time

3) some related genes share a promoter but create multiple mRNAs (bacteria operon only one mRNA)

4) more often, combination of control elements controls all genes in the group (like metabolic pathway genes) even if on different chromosomes.

5) sometimes an extracellular signal enters the cell and binds a transcription factor activating it and allowing for the expression of multiple related genes (steroid production)

6) signalling molecules can do the same thing via signalling pathways.

D. Post transcriptional control of expression1. RNA processing

a) alternative RNA splicing1) different RNA from same mRNA due

to splicing differences2) controlled by regulatory proteins

b) mRNA degradation1) specific sequences in the

untranslated region (UTR) dictate how long an mRNA exists

2. Initiation of Translationa) regulatory proteins may bind

mRNA and prevent translationb) some stored mRNA in eggs (not

chicken) have no poly-A tail…no translation.

1) poly A tail added later in development.

c) global control of general translation factors

1) in eggs translation factors are inactive until fertilization occurs.

2) light and darkness can also control translation factor activity

3. protein processing and degradationa) proteins are often modified after

translationb) modification proteins controlled by

phosphate addition and removalc) regulation could also occur at the

transportation level.d) protein lifespan is also controlled

1) tagging of proteins with ubiquinone signals their degradation by proteasomes.

2) mutations in proteasomes can cause cancer

III. Non-protein coding RNAs and Gene ExpressionA. Effect of miRNAs

1. microRNAs (miRNA) bind to sequences in mRNA

2. Production of miRNAa) Once transcribed, fold back upon

themselves creating multiple hairpinsb) Hairpins are cut from one another by

the Dicer and one of the hairpin strands is removed

c) miRNA binds and protein and whole complex binds mRNA

d) Binding of miRNA complex either blocks translation or signals for degradation

B. RNA interference and small interfering RNA1. Experimentally: injection of double

stranded RNA blocked gene expression of mRNA with same sequence

2. siRNA do the same thinga) siRNA differ from miRNA is that they

come from much longer double stranded RNA

b) Many siRNAs come from one double stranded RNA

c) siRNAs identified in fruit flies and c. elegans

C. Chromatin Remodeling and Silencing by small RNAs

1. Important for formation of heterochromatin in yeast

2. Bind to DNA and recruit enzymes that modify DNA making it heterochromatin

3. Evidence: inactivation of Dicer results in no heterochromatin formation in chicken and mouse cells

IV. Differential gene expression and cell differentiation

Embryonic DevelopmentCell differentiation – the process by which

cells become specialized in structure and function.

Morphogenesis – physical processes that give an organism its shape.

Big Question: How do different sets of activators come to be present in two cells?

A. Cytoplasmic Determinants and Inductive Signals1. Proteins and mRNA are present in the

unfertilized egg (cytoplasmic determinants)a) Not evenly distributed throughout the eggb) First cell divisions result in unequal

distribution of the proteins and RNA in new cells

c) Different proteins = different genes activated

2. Cell-cell interactions also play a role (induction)

a) Binding of cell surface receptors (signalling pathways) results in activating of different genes

B. Sequential regulation of gene expressionsDetermination – the events that lead to the

observable differentiation of a cell• Once determination occurs, it is

irreversible1. Determination caused by the expression

of genes which encode of tissue specific proteins

2. Master Regulatory Genesa) Key genes involved in the

determination of a cellb) Often these are transcription factors

that activate other tissue specific proteins

C. Pattern formation: setting up the body plan1. Begins very early

a) Establishment of the major axes of the embryo

b) This positional information is provided by cytoplasmic determinants and inductive signals

2. Drosophilaa) Fed drosophila mutagens and then

looked at dead larvae with pattern formation mutations.

1) Identified 1200 genes involved in pattern formation

2) 120 genes involved in segmentation

b) Axis establishment in drosophila1) Maternal effect genes are genes that

encode for proteins or mRNA that are put into the egg during oogenesisa} often called egg polarity genes

2) Example: bicoida} bicoid mutants have no anterior end…two posterior ends formb} there must be a morphogen gradient meaning a gradient of proteins involved in anterior posterior identityc} found experimentally that bicoid mRNA is concentrated at one end of egg.d} if inject bicoid protein into different places of the embryo get anterior formation occuring in multiple places.

V. Cancer mutations and the cell cycleA. Types of Genes associated with Cancer

1. Growth factors, growth factor receptors, intracellular molecules of signalling pathways

2. Viruses can also cause cancera) HPV (Papillomaviruses) – cervical

cancer1) Sexually transmitted disease2) Debate to vaccinate young girls (11-

12)3) Will it encourage them to be

sexually active if they are protected from a STD?

3. Oncogenes and proto-oncogenes– Proto-oncogene is a gene involved in

the cell cycle. It is called an oncogene when a mutation in it causes cancer

a) Usually mutation causes and increase in the amount of protein produced or the proteins activity

b) Causes: 1) movement of DNA – cancer cells

often have broken chromosomes (one piece translocated onto another) and gene is placed near an enhancer that expresses it more than normally.

2) amplification of DNA – increase in the number of copies in the cell

3) mutation in control element or gene

4. Tumor-supressor genesa) Normal versions of these genes inhibit

cell divisionb) Functions

1) Repair damaged DNA2) Cell adhesion to other cells or ECM3) Components of cell-signaling pathways

B. Interference with Cell-signaling pathways1. ras proto-oncogene

a) G-protein involved in a growth factor receptor. Activates a kinase

1) Normal end result is increase in cell division

2) Mutation in ras results in hyperactive protein that is always activating kinase.

2. p53a) Transcription factor that stimulates

proteins that inhibit cell cycle when there is DNA damage

1) p53 also controls DNA repair genes.2) p53 can also activate apoptosis

genes if DNA damage is too significant

C. Multi-step model for cancer development1. Multiple mutations are necessary for cancer

to develop.2. Since there are two copies of almost every

gene, both copies must often be mutated.3. Cancers usually involve one oncogene

mutation or mutations in multiple tumor supressor genes

4. Hence, cancer more likely to develop later in life

D. Genetic Predisposition to Cancer (Inheritance)1. If you inherit one bad gene, you are closer to

developing cancer than someone who hasn’t.