Macromolecules Life: Small Picture to Big Picture Macromolecules.
Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional...
-
Upload
doris-warner -
Category
Documents
-
view
215 -
download
1
Transcript of Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional...
![Page 1: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/1.jpg)
Structure and Study of Macromolecules
![Page 2: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/2.jpg)
DNA
mRNA (4%)
Proteins
transcription
translation
functional RNAs (96%)
![Page 3: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/3.jpg)
DNA
All prokaryotic and eukaryotic genomes consist of DNA.
(Some viruses have RNA genomes, e.g influenza viruses.)
![Page 4: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/4.jpg)
DNA (deoxyribonucleic acid)
DNA is a polymer built of deoxyribonucleotides:
![Page 5: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/5.jpg)
![Page 6: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/6.jpg)
Polymerization of deoxyribonucleotides into DNAis catalyzed by DNA polymerase:
Speed of synthesis in replication ≈ 2000 nucleotides/sec.
![Page 7: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/7.jpg)
DNA in cells can be (relatively) short or long, single- or double-stranded, linear or circular.
Examples of genome organization:
Species Genome Size Number of genes
Parvovirus Single-stranded linear DNA 1.6 kb 5
Phage M13 Single-stranded circular DNA 6.4 kb 10
E. coli Double-stranded circular DNA
4,600 kb 4405
H. sapienschromosome 21
Double-stranded linear DNA 47,000 kb 584
![Page 8: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/8.jpg)
3D-structure of DNA
![Page 9: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/9.jpg)
Right- and left-handed DNA helices
![Page 10: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/10.jpg)
3D-structure of DNA
![Page 11: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/11.jpg)
Hydrogen bonds stabilize DNA double helix
![Page 12: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/12.jpg)
Hydrogen bonds
Weak bonds between a positivelycharged donor hydrogen atom anda negatively charged acceptor atom
![Page 13: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/13.jpg)
Hydrogen bonds in DNA
![Page 14: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/14.jpg)
van der Waals forces
Weak attractive forces induced in atoms that are close to each other.
![Page 15: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/15.jpg)
DNA strands can be separated (denatured) bybreaking the hydrogen bonds
Heat and OH- ions (alkali) can break H-bonds
![Page 16: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/16.jpg)
3D-structure of DNA
![Page 17: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/17.jpg)
Hydrogen bond acceptors and donors in the major and minor grooves of DNA
![Page 18: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/18.jpg)
3D-structure of B-DNA
![Page 19: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/19.jpg)
B-DNA is the predominant form of DNA in cells but not the only form
![Page 20: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/20.jpg)
![Page 21: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/21.jpg)
DNA is associated with proteins to form chromatin
![Page 22: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/22.jpg)
Closed circular DNA is normally wound around itself(supercoiled).
![Page 23: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/23.jpg)
The degree of DNA supercoiling can be determined byspecific techniques and visualized by agarose gel electrophoresis.
relaxed ccDNA
linearized ccDNA
moderately supercoiled ccDNA
highly supercoiled ccDNA
![Page 24: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/24.jpg)
RNA
DNA
mRNA rRNA tRNA snRNA snoRNA microRNA siRNA
ribozymes
Protein synthesis
Splicingof mRNA
Processing of rRNA
Regulation of gene expression
Catalysts
![Page 25: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/25.jpg)
RNA
DNA
tRNA
Contains uracil (instead of thymine in DNA)
Sugar-phosphate backbone containsribose (instead of deoxyribose in DNA)
![Page 26: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/26.jpg)
Differences between DNA and RNA
2’ hydroxyl group
Uracil instead of thymine
![Page 27: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/27.jpg)
RNA is synthezised by RNA polymerases
![Page 28: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/28.jpg)
RNA can fold back on itself to form double helices
![Page 29: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/29.jpg)
RNA secondary and tertiary structures
Pseudoknot
Tetraloop
![Page 30: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/30.jpg)
tRNA secondary and tertiary structures
secondary tertiary
![Page 31: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/31.jpg)
RNA secondary structures can be predicted
Quickfold
5’- cgggauguagcgccagcuugguagcgcaugugcuuugggagcauagggucgcagguucgaauccugucaucccga -3’
![Page 32: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/32.jpg)
RNA
DNA
mRNA rRNA tRNA snRNA snoRNA microRNA siRNA
ribozymes
Protein synthesis
Splicingof mRNA
Processing of rRNA
Regulation of gene expression
Catalysts
![Page 33: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/33.jpg)
Examples of ribozymes
![Page 34: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/34.jpg)
RNase P activity
RNA
tRNA
protein
![Page 35: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/35.jpg)
Proteins
DNA
mRNA
![Page 36: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/36.jpg)
Proteins
CatalysisEnzymes
StructureCytoskeletonHairNails
ContractionActinMyosin
TransportHemoglobin
RegulationActivatorsRepressors
ProtectionAntibodiesToxins
StorageSeed proteins
![Page 37: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/37.jpg)
Proteins are synthesized by polymerization of amino acids
General structure ofan L-amino acid Peptide bond formation
![Page 38: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/38.jpg)
The 20 common amino acids specified by the genetic code
![Page 39: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/39.jpg)
Structural organization of polypeptide chains
![Page 40: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/40.jpg)
Rotations are possible around the C-N and C-C bonds of peptide bonds
Peptide bond
![Page 41: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/41.jpg)
a-helices and ß-sheets are common secondary structures of proteins
a-helix ß-sheet
![Page 42: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/42.jpg)
Examples for proteins consisting mostly of a-helices and ß-sheets
a-helix
ß-sheet
a-keratins: hair, wool, skin, horns, nails
ß-keratins: fibers of spiders and silkworm,claws, scales, and beaks ofreptiles and birds.
![Page 43: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/43.jpg)
3D-folding of polypeptide chains is stabilized by:
Hydrogen bondsDisulfide bonds (covalent)Ionic (+ -) interactionsHydrophobic interactionsvan der Waal’s interactions
Note: in cells correct folding of proteins is promoted by chaperones and chaperonins.
![Page 44: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/44.jpg)
Proteins can have sequence and structural motifs
Helix-turn-helix motif Zinc finger motif
![Page 45: Structure and Study of Macromolecules. DNA mRNA (4%) Proteins transcription translation functional RNAs (96%)](https://reader030.fdocuments.in/reader030/viewer/2022032600/56649dab5503460f94a9982e/html5/thumbnails/45.jpg)
Protein domains