THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 263, No. 25, Issue of September 5, pp. 12384-12390,1988 Printed in U. S. A.

Cloning of Authentic Human Epidermal Growth Factor as a Bacterial Secretory Protein and Its Initial Structure-Function Analysis by Site- directed Mutagenesis*

(Received for publication, December 22, 1987)

David A. EnglerS, Rise K. Matsunami*, Stephen R. Campion$, Claude D. Stringer, Audrey Stevens, and Salil K. Niyogi From The Protein Engineering and Molecular Mutagenesis Program and The University of Tennessee-Oak Ridge Graduate School of Biomedical Sciences, Biology Division, Oak Ridge National Moratory, Oak Ridge, Tennessee 37831-8077

A synthetic chimeric gene, coding for the human epidermal growth factor fused to the signal peptide of Escherichia coli alkaline phosphatase, was cloned into E. coli under the transcriptional control of the trp-lac (tac) promoter. Following induction with isopropyl- thiogalactoside, the secretion of the correctly processed protein product into the bacterial periplasm was de- tected and quantitated by its specific binding to the epidermal growth factor receptor. The purified protein was identical to authentic human epidermal growth factor in size, amino acid composition, primary se- quence, receptor binding, and stimulation of receptor protein-tyrosine kinase activity. Based on interspecies homologies, structural considerations, and reported studies with peptide fragments, structure-function analysis was initiated with alterations of targeted amino acid residues by oligonucleotide-directed muta- genesis. The receptor binding affinity of each mutant, relative to the wild type, was measured by both radi- oreceptor competition and receptor tyrosine kinase stimulation assays. In general, the values obtained by the two methods were in agreement for each species of epidermal growth factor and followed the order: wild type > GluZ4 4 Gly > Aspz7 - Gly 3 Pro7 + Thr > TyrZ9 - Gly > Leu47 4 His. The relatively low values obtained with the last two mutants suggest that Tyr2’ and Leu47 may be important for the biological activity of human epidermal growth factor.

Epidermal growth factor (EGF),’ a 6-kDa (53 amino acid

* This work was supported by the Office of Health and Environ- mental Research, United States Department of Energy under Con- tract DE-AC05-840R21400 with the Martin Marietta Energy Sys- tems, Inc. A preliminary account of this work was presented at the 78th Annual Meeting of the American Society of Biological Chemists (Engler, D. A., Matsunami, R. K., Campion, S. R., Foote, R. S., Mural, R. J., Larimer, F. W., Stevens, A., and Niyogi, S. K. (1987) Fed. Proc. 46, 1996). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

3 Supported by National Cancer Institute Predoctoral Training Grant CA 09104.

Supported by National Cancer Institute Postdoctoral Training Grant CA 09336.

The abbreviations used are: EGF, epidermal growth factor; hEGF, human epidermal growth factor; mEGF, mouse epidermal growth factor; ssDNA, single-stranded DNA, RF, replicative form; IPTG, isopropyl-P-D-thiogalactopyranoside; HPLC, high performance liquid chromatography; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

residues) polypeptide with three internal disulfide bonds (Fig. l), was first purified from male mouse submaxillary glands and shown to stimulate precocious eyelid opening and tooth eruption in newborn mice (Cohen, 1962). Human EGF was subsequently purified from urine by Cohen and Carpenter (1975) and simultaneously by Gregory (1975), who called it “urogastrone” based on its ability to inhibit gastric acid secre- tion. Following their primary structure determination of uro- gastrone, Gregory and Preston (1977) were able to show that the two molecules were identical. EGF stimulates cell growth and proliferation through high-affinity ligand binding to its specific cell-surface receptor: the EGF receptor (for reviews on EGF and its receptor, see Carpenter and Cohen, 1979; Goustin et al., 1986; Stoscheck and King, 1986; Carpenter, 1987). The binding of EGF to its receptor mediates a variety of biochemical processes. There are changes in the intracel- lular pH and free calcium, increased glycolysis and protein synthesis, autophosphorylation on tyrosine residues besides tyrosine phosphorylation of certain endogenous cellular pro- teins by the EGF receptor kinase, and increased transcription of specific genes, ultimately leading to increased DNA repli- cation and cell division.

Only a few studies have been reported on EGF‘s structure- function relationships. Using synthetic peptide segments, Ko- moriya et al. (1984) showed that both the linear and cyclic forms of the B-loop peptide, containing amino acid residues 20-31 (see Fig. l ) , were weakly active in both receptor binding and biological stimulation in cell culture (0.003% of EGF). Fragments from other loops were inactive. Heath and Merri- field (1986) showed that EGF-(15-33) was l/104 as active as EGF in receptor binding and stimulation of DNA synthesis. EGF-(32-53) was even less active, and EGF-(45-53) was inactive. The possible importance of residues at the COOH and NH2 termini of EGF has also been investigated. Both hEGF and mEGF that lacked 1 or 2 residues from the COOH terminus retained full receptor binding ability and biological activity both in vivo and in vitro (Gregory, 1975; Cohen and Carpenter, 1975; Hollenberg and Gregory, 1977). Removal of 5 or 6 residues from the COOH terminus from both hEGF and mEGF led to marked reduction in receptor binding and mitogenic activity in vitro, although EGF-(1-47) elicited a normal response with respect to inhibition of gastric acid secretion (Hollenberg and Gregory, 1980). Rat EGF (which lacks the COOH-terminal 5 residues present in both mEGF and hEGF) and three molecular variants of EGF (EGF-(2- 48), EGF-(3-48), and EGF-(4-48)), isolated from rat submax- illary glands, all appeared equipotent in both receptor binding and mitogenic assays (Simpson et al., 1985). These results suggest the apparent lack of importance of the first few

12384

Cloning and Site-directed Mutagenesis of Human EGF 12385

.OH

FIG. 1. Schematic representation of secondary structural features of hEGF (adapted from Cooke et al., 1987). Solid lines indicate disulfide bridges, and hydrogen bonds are indicated by dashed lines. Residues 49-53 were added for completeness; however, dashed circles indicate that no rigid secondary structural characteristics have been assigned to these residues. Amino acid residues marked with asterisks indicate those positions at which amino acid substitution mutants have been generated (see text).

residues at both ends of EGF in determining biological activ- ity.

In order to identify, in a systematic fashion, the amino acid residues in an intact molecule of hEGF that are essential for its binding to the EGF receptor and its stimulation of the receptor tyrosine kinase activity, we have utilized site-directed mutagenesis. Our aim was to produce a clone of authentic hEGF with the proper NHz-terminal asparagine and to facil- itate construction of mutant hEGF molecules via site-directed mutagenesis. Because of its commercial applications ranging from wound healing, inhibition of gastric acid secretion, and wool harvesting, EGF has been cloned in several forms by various industrial laboratories. Some of these forms were unsuitable for our purpose since they produced hEGF as a fusion protein (Smith et al., 1982; Sumi et al., 1985) or required exogenous protease treatment to liberate mEGF (Allen et al., 1987). Human EGF was produced in yeast and secreted into the medium (Brake et al., 1984), but this would require proc- essing of large volumes of medium and site-directed mutagen- esis techniques that would be cumbersome. Oka et al. (1985) produced hEGF as a secretory protein in Escherichia coli under conditions of phosphate limitation when a hybrid gene encoding hEGF joined to the signal peptide of alkaline phos- phatase was placed under the control of the phoA promoter, but proprietory considerations precluded general distribution of their clone.

We report here the cloning of hEGF as a secretory protein in E. coli by placing a synthetic DNA encoding hEGF and the signal peptide of E. coli alkaline phosphatase under the tran- scriptional control of the E. coli trp-lac (tac) promoter, thereby allowing its induction by IPTG. Studies of the purification of the properly processed authentic hEGF from the bacterial periplasmic space, its properties, and initial site-directed mu- tagenesis of hEGF are also described.

EXPERIMENTAL PROCEDURES

Materials Chemicals, Enzymes, and Polymers-Common chemicals and re-

agents were purchased at the highest level of purity readily available. Other commercial materials and vendors were as follows: T4 poly- nucleotide kinase, unlabeled nucleotides and nuclease p, from Phar- macia LKB Biotechnology Inc.; [Y-~'P]ATP (4500 Ci/mmol) and [cY-~'P]~ATP (3000 Ci/mmol) from ICN Radiochemicals; deoxynucle-

oside phosphoramidites from American Bionetics; E. coli DNA polym- erase I (Klenow large fragment) and T4 DNA ligase from Boehringer Mannheim; restriction endonucleases from Bethesda Research Lab- oratories or New England Biolabs; Polygram Cel300 PEI/UVZW from Sybron/Brinkmann; wheat germ agglutinin-agarose from United States Biochemical Corp.; and ampicillin and (Glu4,Tyrl), from Sigma. EGF, purified from mouse submaxillary glands, was purchased from Collaborative Research.

Bacterial Strains, Plasmid, and Phage-E. coli JM107 (A(lnc-pro), endAl, gyrA96, thil, hsdRl7, supE44, relAl, (F'traD36, proAB+, lncIqZAM15)) (Yanisch-Perron et al., 1985) was used as the host for M13 vectors and for expression of hEGF. E. coli BNN45 (metB, thi-, hsdR, lncY, supE44, supF) (Murray et al., 1977) was routinely used as a cloning host. The expression plasmid pFL142 was a gift of Dr. F. W. Larimer (Biology Division, Oak Ridge National Laboratory) and contains the tac promoter under the regulatory control of the lactose repressor-operator and two Shine-Dalgarno sequences. M13mp19 DNA (Norrander et al., 1983) from the E. coli-specific filamentous phase M13 was used as the sequencing vector. The phage DNA was purified from CsC1-banded phage as described earlier (Niyogi and Mitra, 1978).

Methods Synthesis and Purification of Oligonucleotides-Twelve single-

stranded deoxyoligonucleotides, ranging in length from 34 to 40 bases, were synthesized in a Systec Model 1450 automated DNA synthesizer utilizing phosphoramidite chemistry (Sinha et al., 1984). Each oligo- nucleotide was purified twice by electrophoresis through 16% poly- acrylamide gels containing 8 M urea (Atkinson and Smith, 1984). 5'- End analysis to check the purity of the final product was as follows. Each oligonucleotide (7 pmol) was phosphorylated at the 5' terminus in a 30-pl reaction mixture containing 50 mM Tris-C1 (pH 7.6), 10 mM MgCI,, 0.1 mM spermidine, 0.1 mM EDTA, 5 mM dithiothreitol, 0.9 p~ [Y-~'P]ATP (500 Ci/mmol), and 10 units of polynucleotide kinase. After incubation at 37 "C for 1 h, the reaction mixture was heated at 65 "C for 10 min, and the oligonucleotide was purified by gel filtration on Bio-Gel P-10 equilibrated with 10 mM triethylam- monium acetate (pH 7.0). Following lyophilization to concentrate the oligonucleotide to about 1500 cpmlpl, 1 p1 of the oligonucleotide was dissolved in 10 mM sodium acetate (pH 5.3) and 20 units of nuclease PI to a final volume of 10 pl. Following complete enzymatic hydrolysis at 37 "C for 1 h, the reaction mixture was spotted onto polyethyleni- mine-cellulose thin-layer chromatography plates and developed in 1 M LiCl until the solvent front reached 10 cm. Chromatograms were dried and autoradiographed overnight at room temperature, and the labeled 5'-mononucleotide of the oligonucleotide hydrolysate was determined from its RF value relative to cold 5'-deoxynucleoside monophosphate standards.

Construction of phoA SignallhEGF Gene-Each single-stranded oligonucleotide, 3, 5, 7 , or 9 (200 pmol), was annealed with its respective complementary single-stranded oligonucleotide, 4, 6, 8, or 10 (200 pmol), in a 25-p1 reaction mixture containing 15 mM Tris-C1 (pH 7.5) and 75 mM NaCl to form double-stranded oligonucleotides with 5"overhangs of 6-9 bases (Fig. 2). Annealing was performed in a stepwise fashion, as described below, to preclude the formation of any secondary hairpin structures. Each reaction mixture was first heated for 10 min at 10-15 "C above the empirically calculated temperature of dissociation (Meinkoth and Wahl, 1984) and then at 20 "C below the temperature of dissociation for 15 min, followed by slow cooling to room temperature over a period of 1 h. The resulting double-stranded complex was phosphorylated at its 5' termini as described above, except that a molar ratio of cold ATP to 5'-oligo- nucleotide ends of 5:l (2000 pmol of cold ATP, 400 pmol of 5'- oligonucleotide ends) was used in a 50-pl reaction with 50 nCi of [Y-~'P]ATP to follow the efficiency of the 5'-end labeling reaction. Single-stranded oligonucleotides 2 and 11 (200 pmol each) were phosphorylated at their 5' termini and then annealed to 200 pmol each of their respective complementary single-stranded oligonucleo- tides, 1 and 12, that were left as the 5'-OH species. Leaving the two 5' termini unphosphorylated on oligonucleotides 1 and 12 prevented concatemerization of the final ligated gene product prior to insertion into the expression vector.

The six double-stranded oligonucleotides with complementary sin- gle-stranded termini were ligated together (to form the phoA signal/ hEGF genetic construct) in a 100-pl reaction mixture containing 50 pmol of each double-stranded pair in 20 mM Tris-C1 (pH 7.5), 10 mM MgCl2, 2 mM dithiothreitol, 1 mM ATP, and 24 units of T4 DNA

12386 Cloning and Site-directed Mutagenesis of Human EGF ligase. Ligation was carried out at 14 “C for 24 h. The ligation efficiency was greater than 85% as determined by agarose gel electro- phoresis.

Transfer of phoA SignallhEGF Genetic Construct into Expression Vector-Ten ng of the phoA signal/hEGF genetic construct was added to 100 ng of the 2731-base pair Ncol-EagI fragment from the expres- sion vector pFL142. Ligation was carried out as described above, but for 18 h with 6 units of T4 DNA ligase in a reaction volume of 10 pl. E. coli BNN45 was transformed with various dilutions of the ligation mixture by the procedure of Hanahan (1985) and plated by serial dilution onto LB medium containing 25 pg/ml ampicillin. Plasmid DNA was prepared from ampicillin-resistant colonies by the alkaline lysis method (Birnboim and Doly, 1979) and screened by digestion with Hind111 and agarose gel electrophoresis to determine which plasmid DNA had the hEGF insert. Plasmid DNA containing the hEGF insert, called pEGF-I, was digested with BamHI to liberate a 300-base pair fragment which was subcloned into the BamHI site of M13mp19 RF DNA. E. coli JM107 was transfected (Hanahan, 1985) with this DNA preparation and plated on LB medium using top agar containing 0.3 mM IPTG and 0.03% X-Gal (5-bromo-4-chloro-3- indolyl P-D-galactopyranoside) to select for plaques containing the BamHI fragment. Phage ssDNA was isolated and sequenced by the dideoxynucleotide chain termination protocol (Sanger et al., 1977) to verify the correct sequence of the phoA signal/hEGF gene construct.

Expression of hEGF-An overnight culture of E. coli JM107 har- boring the pEGF-1 plasmid was grown in LB medium containing 25 pg/ml ampicillin and then diluted 100-fold into the same medium and grown at 37 “C and 250 rpm in a rotary shaker. In general, when the A600 of the culture had reached 0.5, expression of hEGF was induced by the addition of IPTG to a 1 mM final concentration. The culture was allowed to grow for an additional 6-8 h or until hEGF production was maximal, at which time the cells were harvested by centrifugation.

Purification of hEGF-The hEGF sequestered in the periplasm was isolated from the cell pellet by resuspension in ice-cold 1 M Tris- C1 (pH 9.0), 2 mM EDTA and standing in ice for 20 min. The hEGF in the TrisFDTA fraction was precipitated by the addition of (NH4),S04 to 60% saturation with stirring at 4 “C for 1 h. After centrifugation at 39,000 x g for 30 min, the pellet was resuspended in and dialyzed against 25 mM ammonium acetate (pH 5.8). The dialyzed fraction was loaded onto a column (2.3 X 40 cm) of Sephadex G-75 equilibrated with 25 mM ammonium acetate (pH 5.8) and eluted with the same buffer. The fractions containing hEGF activity were pooled and concentrated by Amicon filtration through a YM-2 (Mr cutoff = 2,000) filter. The concentrate was further purified by reverse- phase chromatography through a Vydac 218TPS column (4.6 X 250 mm) on a Waters Model 840 HPLC system utilizing an 18-34% CH3CN gradient in 10 mM NaPO, (pH 7.2) buffer.

Amino Acid Composition Analysis and Protein Sequencing-Amino acid composition analysis was carried out according to standard methods (Moore and Stein, 1963) utilizing a single-column procedure and a Beckman Model 121” analyzer. Cysteine determination as cysteic acid was accomplished after dimethyl sulfoxide oxidation (Spencer and Wold, 1969). Tryptophan determination was accom- plished after hydrolysis in mercaptoethanesulfonic acid (Penke et al., 1974).

Sequencing of the carboxymethylated hEGF was performed on an Applied Biosystems 470A gas-phase protein sequenator. Carboxy- methylation of the purified hEGF was carried out in a 50-p1 reaction mixture containing 7 M guanidine HCl, 100 mM NaP04 (pH 8.0), 0.36 mM hEGF, 35 mM recrystallized iodoacetate, 10 mM dithiothreitol, and 3 mM EDTA for 15 min in the dark at room temperature and stopped by the addition of dithiothreitol to a final concentration of 100 mM.

EGF Receptor Binding Assay-Specific binding of hEGF to the EGF receptor on purified membrane fractions from the human epi- dermoid carcinoma cell line A431 (kindly provided by Dr. J. E. De Larco, Monsanto Research Laboratory) was as described (Carpenter, 1985). A431 cells were grown in Dulbecco’s modified Eagle’s medium + 10% fetal calf serum. A431 cell membranes were isolated as de- scribed (Akiyama et al., 1985). ’251-hEGF was prepared by the chlor- amine-T method (Hunter and Greenwood, 1962) to an average spe- cific activity of 120,000 cpm/pmol hEGF.

Assay of EGF Receptor Tyrosine Kinase Activity-The tyrosine kinase activity of the EGF receptor, partially purified from A431 cell membranes by chromatography on a wheat germ agglutinin-agarose column as described by Akiyama et al. (1985), was assayed by meas- uring the incorporation of 32Pi from [Y-~*P]ATP into the synthetic

polypeptide substrate (Glua,Tyr,), having an average M, of 35,000 (Braun et al., 1984). Solubilization of the receptor with Triton X-100, receptor preincubation, and assay conditions were similar to those described by Akiyama et al. (1985) with modifications by Koland and Cerione (1988). With 0.25 M (NH4)2SO4 and 0.05% Triton X-100 in the assay mixture, the receptor kinase activity was strongly EGF- dependent, as observed by Koland and Cerione (1988). Assays were initiated by the addition of [y3’P]ATP (1,3 Ci/mmol) and (Glu4,Tyrl), to final concentrations of 75 p~ and 0.5 mg/ml, respec- tively, in a final volume of 100 pl. After a 10-min incubation at room temperature, the reaction was stopped by the addition of 1 ml of 5% trichloroacetic acid containing 10 mM sodium pyrophosphate. The acid-insoluble material was collected on 25-mm Millipore HAWP filters which were then washed extensively with the same solvent, dried, and counted for radioactivity using an appropriate liquid scin- tillant. The kinase activity reported here included the incorporation of 32Pi into both the polypeptide substrate and the receptor. The contribution of the latter was found to be less than 2% of the total activity.

Oligonucleotide-directed Mutagenesis of hEGF Gene-Deoxyoligo- nucleotides, degenerate a t 1-3 nucleotides corresponding to the tar- geted codon and/or restriction site (see “Results”) and complemen- tary to the sequences surrounding the targeted sites, were synthesized and purified as described above. The oligonucleotides were phospho- rylated at their 5’ termini as described earlier (Niyogi et a[., 1986). Primed synthesis of covalently closed RF I DNA utilizing the mutant oligonucleotides as primers and the M13 ssDNA containing the hEGF

of Niyogi et al. (1986, 1987) of the “boost protocol” (Nisbet and insert as the template was carried out according to the modifications

Beilharz, 1985). RF I DNA, purified by band sedimentation in alkaline sucrose gradients (Zoller and Smith, 1983), was used to transfect E. coli JM107.

Screening and Characterization of Mutant hEGF Clones-Plaques were transferred to Schleicher & Schuell BA85 nitrocellulose mem- branes, and the filters were hybridized to 3ZP-labeled mutant oligo- nucleotide probes as previously described (Niyogi et al., 1986). Briefly, hybridization was carried out for 1 h at 20 ‘C below the empirically calculated temperature of dissociation. Filters were then washed under stringent temperature conditions for each mutation involved and subjected to autoradiography. Candidate mutant phage from individual plaques were then grown, and RF DNA was isolated and digested with the appropriate restriction endonuclease to utilize loss of the restriction site as a further screening procedure. Phage whose RF DNA lacked the restriction site in question were propagated for the isolation of ssDNA. DNA sequencing (Sanger et al., 1977) of the hEGF gene was used to confirm the mutations and the absence of secondary mutations in other areas of the gene.

Transfer of Mutant hEGF Clones into Expression Vector-BamHI fragments of each mutant clone were removed from the phage RF DNA and ligated into pEGF-1 lacking the 300-base pair BamHI fragment carrying the wild-type hEGF gene. Since the mutant hEGF fragments could insert in either orientation in the expression vector, resulting clones from each ligation were screened for proper insert orientation by EcoRI digestion and agarose gel electrophoresis.

Expression of Mutant hEGF Genes-Expression vectors containing the mutations in the hEGF gene were transformed into E. coli JM107 (Hanahan, 1985). Induction, expression, and isolation of mutant proteins were as described for the wild-type hEGF.

RESULTS

Special Features of phoA SignallhEGF Genetic Constrwt- A synthetic gene that codes for hEGF fused at its amino- terminal end to the E. coli phoA signal peptide was constructed from 12 oligodeoxynucleotides as shown in Fig. 2. Design and construction of the phoA signal/hEGF tandem genes synthet- ically allowed for the insertion of unique restriction sites in the coding region of the construct. Some of these are shown in Fig. 2. The initiator codon for N-formylmethionine of the phoA signal peptide is, in this case, ATG as opposed to the naturally occurring GTG codon (Kikuchi et al., 1981; Inouye et al., 1982). This was necessary for the insertion of thephoA signal/hEGF construct into the NcoI site of the “ATG” expression vector, pFL142, to form pEGF-1 (Fig. 3). The correct sequence and position of the genetic construct in the

Cloning and Site-directed Mutagenesis of Human EGF 12387

Alkaline Phosphatase Signal Peptide MetLysGlnSerThrIleAlaLeuAlaLeuLeuProLeuLeuPheThrPro

t 1 3-

CATGAAACAGTCTACTATCGCTCTGGCTCTGCTGCCGCTGCTGTTCACTCCG TTTGTCAGATGATAGCGAGACCGAGACGACGGCGACGACAAGTGAGGC I 2

*hEGF+ ValThrLysAlaAsnSerAspSerGluCysProLeuSerHisAspGlyTyr

GTTACCAAAGCGAATTCTGACTCTGAATGCCCGCTGTCTCACGACGGGTAC CAATGGTTTCGCTTAAGACTGAGACTTACGGGCGACAGAGTGCTGCCCATG

&COR I Bsm I

CysLeuHisAspGlyValCysMetTyrIleGluAlaLeuAspLysTyrAla

TGCCTGCACGACGGTGTTTGCATGTACATCGAAGCTTTAGACAAGTACGCA ACGGACGTGCTGCCACAAACGTACATGTAGCTTCGAAATCTGTTCATGCGT

Hind I I I

CysAsnCysValValGlyTyrIleGlyGluArgCysGlnTyrArgAspLeu

TGCAACTGCGTTGTTGGGTACATCGGTGAGCGCTGCCAGTACCGTGACCTT ACGTTGACGCAACAACCCATGTAGCCACTCGCGACGGTCATGGCACTGGAA

Sph I -4 A / l I I

LysTrpTrpGluLeuArgEND 11-

AAGTGGTGGGAGCTCCGTTAAC TTCACCACCCTCGAGGCAATTGCCGG

12’ Eag I

FIG. 2. Design of synthetic genetic construct. Numbered lines encompassing nucleotide sequence designate individual single- stranded oligonucleotides synthesized (see “Methods”). Amino acid sequences for alkaline phosphatase signal peptide (after Inouye et al., 1982) and h E G F (after Gregory, 1975) are delineated by arrows and are shown above the nucleotide sequence. Only those restriction sites discussed in the text are shown.

. “ 6 3 b p

FIG. 3. Expression plasmid pEGF-1 showing relative size of insert and positions of restriction sites. Parentheses indicate the loss of the restriction site NcoI upon insertion into the vector. kbp, kilobase pairs; bp, base pairs.

recombinant plasmid, pEGF-1, were verified by DNA se- quencing.

Expression, Purification, and Characterization of hEGF- Several strains of E. coli were tested as possible host for the expression of hEGF using different media and growth condi-

tions (data not shown). E. coli JM107 was found to be a suitable host for the expression and localization of hEGF in the periplasm. Time course studies showed that upon de- repression of the lac operator of pEGF-1 with l mM IPTG and an 8-h expression time as described under “Methods,” 600-800 pg (as measured by radioreceptor assay) of wild-type hEGF could be liberated in the Tris/EDTA wash per liter of cell culture (-4-5 g of cells, wet weight). Further purification led to the recovery of 300-400 pg of pure EGF/liter of cell culture.

Following the purification protocol described under “Meth- ods,” a single protein migrating with the apparent M, of hEGF on SDS-PAGE was recovered from the HPLC fraction con- taining EGF receptor binding activity. The elution profile from HPLC is shown in Fig. 4. The gel electrophoretic pat- terns of hEGF (and its mutants) are shown in Fig. 5. The isolated protein was subjected to amino acid composition analysis (see Table I) and protein sequencing by Edman degradation. The results of these analyses showed that the purified recombinant hEGF was identical to authentic human EGF (Gregory and Preston, 1977).

The recombinant hEGF competed with mEGF on an equi- molar basis for binding to the EGF receptor (data not shown). Previous studies have shown that mEGF and hEGF are equipotent in their receptor binding ability (Cohen and Car- penter, 1975). The recombinant hEGF was capable of stimu- lating the EGF receptor tyrosine kinase activity, as shown below.

Generation of EGF Mutants by Oligonucleotide-directed Mu- tagenesis-EGFs with single amino acid substitutions were produced, as described under “Methods,” utilizing the oligo- nucleotide primers shown in Table 11. Differential hybridiza-

(0 20 30 40 50 RETENTION TIME (min)

FIG. 4. Typical elution profile of recombinant hEGF off Vydac 218TPS HPLC column. Arrow indicates peak containing EGF receptor binding activity.

k D o 24.0 -

12.4-

6.5- - 3.5-

”“-

FIG. 5. Coomassie Blue-stained SDS-PAGE of recombinant wild-type hEGF and mutant EGFs. Lanes 1 and 8, molecular mass markers; lane 2 , 5 pg of wild-type hEGF; lane 3,3 pg of Pro’ + Thr mutant; lane 4, 3.5 pg of GluZ4 + Gly mutant; lane 5, 1.2 pg of Aspz7 + Gly mutant; lane 6, Tyrm + Gly mutant (upper band, 4.7 pg) and i t s partial breakdown product (lower band, 0.28 pg); lane 7, 3.7 pg of Leu‘? + His mutant. Electrophoretic conditions were essen- tially those of Laemmli (1970). Polyacrylamide concentration in the stacking gel was 5%, and the separating gel consisted of a linear gradient from 10 to 22% polyacrylamide.

12388 Cloning and Site-directed Mutagenesis of Human EGF TABLE I

Amino acid composition of recombinant wild-type hEGF Amino acid

residue Observed” Calculatedb

Asx‘ Thr Ser Glxd Pro‘

Ala

Val Met Ile Leu TYr Phe His LYS TrpB Arg

G ~ Y

Cysf

7.27 0.32 2.90 4.71 1.26 4.10 2.51 4.67 2.78 0.61 2.07 5.32 5.05 0.16 2.10 2.12 1.76 3.02

residues/mol I 0 3 5 1 4 2 6 3 1 2 5 5 0 2 2 2 3

Total 53 Based on a calculated M, of 6217 after 6 N HCI hydrolysis under

reducing conditions, except where noted.

case of the GlyZ9 mutant (lane 6), in which the major protein band was -93% of the total (data not shown). The mobility of wild-type EGF (and of three mutant EGFs) relative to the marker proteins indicated a M, of 6280, close to the calculated M, of 6217 (see Table 1). A slight decrease in the mobility of the His47 mutant and more so of the Glg7 mutant demon- strates the possible effects of these mutations on the migra- tion of such a small protein under these electrophoretic con- ditions.

The expression of mutant EGF proteins under the same conditions as those for wild-type protein resulted in similar yields with the exception of the Asp“ + Gly and Tyrzg + Gly mutants, which produced about 10 and 20%, respectively, of wild-type EGF. The reasons for these lower yields are not yet understood, but do not appear to be related to the relative biological activity of these mutants (see below). Preliminary experiments in this laboratory suggest the need for optimi- zation of growth conditions to enhance the yield of certain mutants in the bacterial periplasm.

Biochemical Properties of Mutant EGF Proteins-Specific binding of the mutant species to the EGF receptor was based on the ability of various concentrations of the mutants to compete with ‘z51-labeled hEGF in the radioreceptor binding assay (as described under “Methods”). The concentration of

Calculated from nucleotide sequence. Five aspartic acid residues and 2 asparagine residues. Four glutamic acid residues and 1 glutamine residue.

the competitor giving 50% inhibition of binding (I&) was estimated graphically for each mutant (see Fig. 6). The rela-

e Determined after oxidation in dimethyl sulfoxide to remove toe- tive binding affinity was calculated from this concentration luting cysteine. compared to that obtained with wild-type EGF. Similarly, the

‘Determined as cysteic acid after dimethyl sulfoxide oxidation. effective concentration of each mutant hEGF resulting in ‘Determined after hydrolysis in 3 N mercaptoethanesulfonic acid. 50% maximal stimulation ofthe EGF receptor tyrosine kinase

tion of mutant oligonucleotide probe to hEGF ssDNA was performed enabling the detection of mutant EGF clones. The loss of an existing restriction endonuclease recognition site due to mutation(s) in the targeted codon or by the introduc- tion of silent mutation(s) elsewhere in the hEGF gene facili- tated screening of mutant hEGF clones, Final confirmation of desired mutations in the hEGF gene and the absence of secondary mutations elsewhere in the gene was routinely obtained by direct sequence analysis.

Purity and Yield of Isolated Mutant Proteins-Wild-type and mutant EGF proteins were purified using identical chro- matographic conditions. All of the mutant proteins eluted at the same position as wild-type EGF during gel filtration on

activity was estimated from its curve representing EGF-dependent kinase activity (see Fig. 7). Relative binding affinity was determined by comparison of this value with that of wild-type EGF. Table I11 shows a comparison of the relative binding affinities of the various mutant hEGF proteins com- pared to the wild-type species, by both radioreceptor compe- tition and receptor kinase stimulation assays. With the pos- sible exception of the Aspz7 + Gly mutant, the relative values obtained by the two assay methods are generally in agreement for each EGF species and follow the order: wild type > GhZ4 + Gly > Aspz7 + Gly Pro7 + Thr > TyrZ9 + Gly > Leu47 + His.

DISCUSSION

Sephadex G-75 (data not shown) and showed similar retention These studies represent an attempt to understand struc- times during HPLC (data not shown), suggesting the absence ture-function relationships of hEGF by applying site-directed of polymerization, of mispairing of sulfhydryls, and of gross mutagenesis to various regions of a recombinant hEGF gene conformational differences from wild-type EGF. SDS-PAGE cloned in a bacterial secretion vector. Placement of the gene of HPLC-purified wild-type and mutant EGFs (Fig. 5) fol- under the transcriptional control of the tac promoter enabled lowed by scanning laser densitometry showed that the purified its induction by IPTG. Expression of hEGF behind the signal proteins were typically >98% homogeneous, except in the peptide for alkaline phosphatase, a normal constituent of the

TABLE I1 Features of mutagenic oligonucleotides

Mutagenic deoxyoligonucleotides were designed and synthesized as described under “Methods.” Mutated codons, introducing amino acid substitutions, are underlined. Mismatches are boldface. Minus sign in parentheses indicates loss of restriction site.

Mutation Length Sequence Monitored restriction

site

Pro7 + Thr 19 5’-ACTCTGAATGT&CTGTC-3’ BsmI (-) Glu“ + Gly 22 5’-CATGTACATC*GCTTAGAC-3’ HindIII (-) Asp” + Gly 22 5’-ATCGAAGCCTTAsAAGTACG-3’ Hind11 (-) Tyr” + Gly 22 5’-TAGACAAGEGCTTGCAACTG-3’ SphI (-) Leu“ + His 18 5’TACCGTGACxAAGTGG-3’ AflII (-)

Cloning and Site-directed Mutagenesis of Human EGF 12389

h E G F

1 0 0 - Wild Type

n o Glu-24 - G l y

2 Asp-27-Gly o Pro-7 - T h r A Tyr-29-Gly A Leu-47 - His

Y Lo

L N

+ 40- V ( L - W a 20-

-

0 1 I I I v 1

10 4 0 160 640 2560 hEGF CONCENTRATION (nM)

FIG. 6. Competition binding curves of IaaI-hEGF versus wild-type and mutant EGFs. Conditions followed are described under “Methods.”

I hEGF

Wild Type Glu-24 -Gly Asp-27-Gly Pro - 7 - Thr Tyr- 29 -Gly

0 30 120 480 1920 7680

hEGF CONCENTRATION (nM)

FIG. 7. Dose-response curves for stimulation of EGF recep- tor tyrosine kinase activity by wild-type and mutant EGFs. Reaction conditions are described under “Methods.”

TABLE I11 Comparison of receptor binding affinity as measured by radioreceptor

competition and receptor tyrosine kinase stirnulation Relative binding affinity

EGF species Radioreceptor Tyrosine kinase competition assay” stimulation assayb

% of wild type Wild type 100 100

Asp” -+ Gly 48 71 Pro7 + Thr 55 53 Ty?@ -+ Gly 17 24 Leu47 -+ His 7 11

~ 1 ~ 2 4 -+ G I ~ 86 84

a Relative binding affinity = ICW (wild type)/ICm (mutant) x 100%. See text under “Results” describing how IC5,, values were derived from Fig. 6.

‘Relative binding affinity = ECW (wild type)/ECW (mutant) X 100%. See text under “Results” describing how ECW values were derived from Fig. 7.

E. coli periplasm, accomplished several desirable results. First, enzymatic cleavage of the signal peptide in vivo produced authentic hEGF with the correct NH2-terminal asparagine,

as confirmed by protein sequence analysis. Second, secretion of hEGF into the periplasm resulted in an initial purification since only about 4% of the E. coli proteins are localized in the periplasm (Neu and Heppel, 1965). Third, extraction of hEGF could be accomplished in a simple one-step procedure liber- ating periplasmic proteins essentially free of contaminating cytoplasmic proteins. Fourth, localization of hEGF in the periplasm sheltered it from cytoplasmic proteases (Swamy and Goldberg, 1981; Itakura et al., 1977; Derynck et al., 1984) and from the high reducing potential in the cytoplasm that could prevent its proper folding. Other small proteins such as insulin are reported to be 10 times more stable in the peri- plasm than in the cytoplasm (Talmadge and Gilbert, 1982).

Chemical synthesis of oligodeoxynucleotides for the con- struction of the chimeric gene allowed for the placement of several unique restriction sites that simplified the mutant screening protocol during site-directed mutagenesis. Engi- neering unique restriction sites at relatively short intervals has rendered the hEGF gene suitable for cassette mutagenesis (Wells et al., 1985), in which the mutant codons can be readily introduced utilizing a short synthetic double-stranded oligo- nucleotide between two successive restriction sites. In addi- tion, a convenient EcoRI site was engineered at the junction of the p h A signal and hEGF genes. This would facilitate the insertion at this site of cloned genes for other proteins that could similarly be secreted into the periplasm.

The choices of amino acid residues selected for mutagenesis were based on the following: ( a ) amino acid residues highly conserved among different species (Simpson et al., 1985; Stos- check and King, 1986); ( b ) data obtained with chemically synthesized EGF peptide fragments (see Introduction); and (c) solution structures of mEGF (Montelione et al., 1987) and hEGF (Cooke et al., 1987), which are based on two-dimen- sional NMR and computer modeling.

Specific mutations were engineered into the human EGF gene by site-directed mutagenesis of Pro7, GluZ4, Asp27, Tyr29, and The purified proteins were tested to determine their ability to displace radioiodinated wild-type hEGF in a competition binding assay, as well as to stimulate the EGF- dependent tyrosine kinase activity of EGF receptors derived from A431 (human epidermoid carcinoma) cells. Values for the receptor binding affinity of each mutant EGF, relative to wild type, were obtained by both methods.

The acidic residues GluZ4 and Asp27 have been observed to be in close spatial proximity to one another and to the aromatic tyrosine residues of the B-loop including TyrZ9 (Montelione et al., 1987). Substitution of either of these acid groups with glycine resulted in somewhat reduced receptor affinity as measured by both competition binding and kinase stimulation assays (Table 111). From the kinase assay partic- ularly, it appears clear that the loss of these acid groups and of the negative charge they possess does not have a severe effect on the ability of EGF to bind in a specific manner with its receptor and to stimulate the receptor’s kinase activity.

A mutation was introduced replacing the highly conserved Pro7 in the A-loop (containing amino acid residues 6-14) with threonine, an amino acid lacking the structural characteristics of the imino acid proline. Structural NMR data have placed Pro7 in close proximity to the aromatic residues of both the A- and B-loops (Montelione et al., 1987). Pro7 resides next to Cys‘, which is involved in an intramolecular disulfide bond thought to stabilize interactions between the A- and B-loops. Human EGF having the Pro7 + Thr mutation might be expected to have considerably impaired function. However, from both the competition binding and kinase stimulation assays, the Pro7 + Thr mutant was >50% as effective as wild-

12390 Cloning and Site-directed Mutagenesis of Human EGF

type EGF (Table 111). The substantial activity displayed by the Pro7 + Thr mutant suggests an apparent lack of require- ment for this highly conserved and structurally distinctive residue for proper folding and/or native structure of EGF. The study of mutant hEGFs having other amino acid substi- tutions at position 7 may provide further insight into the structural and functional properties of this region of the peptide.

The close proximity of aromatic groups in EGF has been demonstrated by several independent NMR studies (Mayo et al., 1986; Cooke et al., 1987; Montelione et al., 1987). The clustering of aromatic side chains in aqueous solution would be expected to be thermodynamically favored and may be partly responsible for the folding and stability of EGF in its functional tertiary structure. Removal of the aromatic side chain of Tyr2’ might be expected to lead to disruption of the peptide structure and loss of activity. The low activity dis- played by the Tyr” + Gly mutant in both competition binding and kinase stimulation assays (Table 111) may be represent- ative of the expected decrease in structural integrity of EGF resulting from loss of aromatic side chain interactions.

Although a structural requirement for Leu47 has not been predicted from NMR-based computer models (Cooke et al., 1987; Montelione et al., 1987), the drastic loss in the receptor binding affinity of the + His mutant (Table 111) could be due to structural constraints introduced by the aromatic histidine side chain at this position. The importance of Leu47 for growth factor activity has been emphasized by a recent observation in which the analogous leucine residue of trans- forming growth factor a was found to be essential for biolog- ical activity (Lazar et ul., 1988).

Reduction in receptor binding as a result of mutagenesis might be representative of either changes in EGF’s biolog- ically active three-dimensional structure or loss of a functional group directly involved in ligand-receptor interaction. Work is currently underway to develop physical methods by which EGF’s three-dimensional folding might be evaluated.

Production of these genetically altered hEGF mutant pep- tides has provided information not only on the effects that peptide modification has on the ability of the ligand to bind to the extracellular domain of the EGF receptor, but also on the relationship between extracellular ligand-receptor binding and the stimulation of the receptor’s cytoplasmically located tyrosine kinase activity.

Acknowledgments-We thank Margaret L. Yette and Marilyn K. Maupin for their expert technical assistance. Thanks are due to Dr. Fred C. Hartman for guidance in the amino acid analysis and protein sequencing. We are grateful to Drs. Robert S. Foote, Frank W. Larimer, and Richard J. Mural for helpful suggestions during these studies. Thanks are due to Dr. Robert S. Foote for initial guidance in the design and synthesis of oligodeoxynucleotides.

REFERENCES Akiyama, T., Kadooka, T., and Ogawara, H. (1985) Biochem. Biophys. Res.

Commun. 131,442-448 Allen, G., Winther, M. D., Henwood, C. A., Beesley, J., Sharry, L. F., O’Keefe,

J., Bennett, J. W., Chapman, R. E., Hollis, D. E., Panaretto, B. A., Dooren,

J. Biotechnol. 6.93-114 P. V., Edols, R. W., Inglis, A. S., Wynn, P. C., and Moore, G. P. M. (1987)

Atkinson, T., and Smith, M. (1984) in Oligonucleotide Synthesis (Gait, M. J.,

Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7, 1513-1523 Brake, A. J., Merryweather, J. P., Coit, D. S., Heberlein, U. A., Masiarz, F. R.,

Mullenback, G. T., Urdea, M. S., Valenzuela, P., and Barr, P. J. (1984) Proc.

Braun, S., Raymond, W. E., and Racker, E. (1984) J. Biol. Chem. 269,2051- Natl. Acad. Sci. U. S. A. 81,4642-4646

Carpenter, G. (1985) Methods Enzymol. 109,107-108 2054

Carpenter, G. (1987) Annu. Reu. Biochem. 66,881-914 Carpenter, G., and Cohen, S. (1979) Annu. Reu. Biochem. 48,193-216 Cohen, S. (1962) J. Biol. Chem. 237,1555-1562 Cohen, S., and Carpenter, G. (1975) Proc. Natl. Acad. Sci. U. S. A. 72, 1317-

Cooke, R. M., Wilkinson, A. J., Baron, M., Pastore, A,, Tappin, M. J., Campbell,

Derynck, R., Roberts, A. B., Winkler, M. E., Chen, E. Y., and Goeddel, D. V.

Goustin, A. S., Leof, E. B., Shipley, G. D., and Moses, H. L. (1986) Cancer Res.

Gregory, H. (1975) Nature 267,325-327 Gregory, H., and Preston, B. M. (1977) Int. J. Pept. Protein Res. 9, 107-118 Hanahan, D. (1985) in DNA Cloning (Glover, D. M., ed) Vol. 1, pp. 109-135,

Heath, W. F., and Merrifield, R. B. (1986) P m . Natl. Acad. Sci. U. S. A. 83,

Hollenberg, M. D., and Gregory, H. (1977) Clin. Res. 26, 312 (abstr.) Hollenberg, M. D., and Gregory, H. (1980) Mol. Phrmacol. 17,314-320 Hunter, W. M., and Greenwood, F. C. (1962) Nature 194,495-496 Inouye, H., Barnes, W., and Beckwith, J. (1982) J. Bacteriol. 149,434-439 Itakura, K., Hirose, T., Crea, R., Riggs, A. D., Heyneker, H., Bolivar, F., and

Kikuchi, Y., Yoda, K., Yamasaki, M., and Tamura, G. (1981) Nucleic Acids Res.

Koland, J. G., and Cerione, R. E. (1988) J. Biol. Chem. 263,2230-2237 Komoriya, A., Hortsch, M., Meyers, C., Smith, M., Kanety, H., and Schlessin-

Laemmli, U. K. (1970) Nature 227,680-685 Lazar, E., Watanabe, S., Dalton, S., and Sporn, M. B. (1988) MOL Cell. Biol. 8,

Mayo, K. H., Schaudies, P., Savage, C. R., De Marco, A., and Kaptein, R. (1986)

Meinkoth, J., and Wahl, W. (1984) Anal Biochem. 138,267-284 Montelione, G. T., Wuthrich, K., Nice, E. C., Burgess, A. W., and Scheraga, H.

Moore, S., and Stein, W. H. (1963) Methods Enzyml. 6,819-831 Murray, N. E., Brammar, W. J., and Murray, K. (1977) Mol. Gen. Genet. 160,

Neu, H. C., and Heppel, L. A. (1965) J. Bwl. Chem. 240,3685-3692 Nisbet, J. T., and Beilharz, M. W. (1985) Gene Anal. T e c h 2,23-40 Niyogi, S. K., and Mitra, S. (1978) J. Biol. Chem. 263,5562-5567 Ni ogi, S. K., Foote, R. S., Mural, R. J., Larimer, F. W., Mitra, S., Soper, T. 8., Machanoff, R., and Hartman, F. C. (1986) J. Biol. Chem. 261, 10087-

Ni ogi, S. K., So er, T S., Foote, R. S., Larimer, F. W., Mural? R.. J., Mitra, 10092

8., Lee, E. H., hachanoff, R., and Hartman, F. C. (1987) J. Bwscz. 11,203- 214

Norrander, J., Kempe, T., and Messing, J. (1983) Gene (Amst.) 26, 101-106 Oka, T., Sakamoto, S., Miyoshi, K., Fuwa, T., Yoda, K., Yamasaki, M., Tamura,

Penke, B., Ferenczi, R., and Kovacs, K. (1974) Anal. Biochem. 60.45-50 G., and Miyake, T. (1985) Proc. Natl. Acad. Sei. U. S. A. 82,7212-7216

Sanger, F.. Nicklen. S.. and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S.

ed) pp. 35-81, IRL Press, Oxford

1321

I. D., Gregory, H., and Sheard, B. (1987) Nature 327,339-341

(1984) Cell 38,287-297

46, 1015-1029

IRL Press, Oxford

6367-6371

Boyer, H. W. (1977) Science 198,1056-1063

9,5671-5678

ger, J. (1984) Proc. Natl. Acad. Sci. U. S. A. 81,1351-1355

1247-1252

Biochem. J. 239,13-18

A. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,5226-5230

53-61

Simpson, R. J., Smith, J. A., Moritz, R. L., O’Hare, M. J., Rudland, P. S., A-74,5463-5467

Momson, J. R., Lloyd, C. J., Grego, B., Burgess, A. W., and Nice, E. C. (1985) Eur. J. Biochem. 163,629-637

Sinha, N. D., Biernat, J., McManus, J., and Koster, H. (1984) Nucleic Acids

Smith, J., Cook, E. Fotheringham, I., Pheby, S., Derbyshire, R., Eaton, M. W., Res. 12,4539-4557

Doel, M., Lilley,’D. M., Pardon, J. F., Patel, T., Lewis, H., and Bell, L. D. (1982) Nucleic Actds Res. 10,44674482

Spencer, R. L., and Wold, F. (1969) Anal. Biochem. 32,185-190 Stoschek, C. M., and King, L. E., Jr. (1986) J. Cell. Brochem. 31, 135-152 Sumi, S.-I., Hasegawa, A.. Yagi, S., Miyoshi, K.-I., Kanezawa, A., Nakagawa,

Swamy, K. H. S., and Goldberg, A. L. (1981) Nature 292,652-654 Talmadee. K.. and Gilbert. W. (1982) Proc. Natl. Acad. Sci. U. S. A. 79,1830-

S., and Suzuki, M. (1985) J. Biutechnol. 2.59-74

1833 ’ ’

. .

Wells, J. A., Vasser, M., and Powers, D. B. (1985) Gene (Amst.) 34,315-323 Yaniscb-Perron, C., Vieira, J., and Messing, J. (1985) Gene (Amst.) 33, 103-

Zoller, M. J., and Smith, M. (1983) Methods Enzymol. 100,468-500 119