The Inner Wave Jan-Feb 10
-
Upload
media-dept-bkwsu-uk -
Category
Documents
-
view
124 -
download
0
Transcript of The Inner Wave Jan-Feb 10
The Inner WaveThe Inner WaveNews, insights and experiences from the Brahma Kumaris World Spiritual University (UK)
Issue 9: Jan /Feb 2010
Welcome to the Inner Wave. Happiness can be as elusive as it is universally coveted. How can we, no matter what our situation may be,
make our lives more constantly happy? We hope to provide some practical answers here.
Editorial Team
© Brahma Kumaris World Spiritual University (UK)The Brahma Kumaris World Spiritual University (UK) teaches Raja Yoga as a way of experiencing peace of mind and a positive approach to life.
For more information about our activities around the UK, please see www.bkwsu.org/uk Registered Charity in England & Wales (269971) and Scotland (SC040512)
SSSSnnnaaapppsssshhhhoooottttssss frrroooommmm ooour ppppaaaarrrrtner oooorrrrggggaaaannnniiissssaaaattttiiiioooons aroundddd tttthhheeee wwwwoooorrrllldddd
What’sInside...
The last ten years have been constant change
for me: finishing school, leaving home and
then the daunting prospect of finding my way
in the ‘real world. Many personal and profes-
sional challenges came my way and I was
looking for a method to deal with them. I
came across the Brahma Kumaris through
their talk show on the Aastha International TV
Channel. What struck me was the practicality
of the discussions, which provided insights
into how to deal effectively with everyday
situations. Inner Space, which has recently
opened on Glasgow’s busy High Street, has
proven a valuable resource.
I’ve had a number of philosophical questions
for a long time, but I’m finding a greater level
of contentment by going deeper into under-
standing who I really am. Meditation helps me
to realise my true nature as a peaceful and
powerful being and it’s having a very positive
impact on my ability to be a good person and
a good doctor. Work can be very challenging
– dealing with difficult situations and making
decisions under pressure. It’s important for
me to approach clinical problems with a clear
mind, remaining calm and getting on well
Tobago: Youth leaders from across the Commonwealth, including Brahma Kumaris youth representatives, discussing Youth Involvement in Decision-making at the 7th Commonwealth Youth Forum, Trinidad & Tobago, in November 2009.
Australia: Thousands of people arriving at The Parliament of theWorld’s Religions in Melbourne wrote messages of support and hope to the world leaders attending COP15 in Copenhagen in a 120 metre long
‘Great Letter’, organised by Brahma Kumaris (Australia) in December 2009.
with everyone. It helps avoid unnecessary
anxiety and stress. It’s something that has
improved greatly through practicing medita-
tion – and it’s changed my outlook on life.
I’m more positive and energetic. I meditate in
the morning and at night, and take pauses
throughout the day. I reflect on how I’m
handling different situations and am learning
to respond better to them. My family and
friends have certainly appreciated the
benefits! For me it’s an ongoing process of
spiritual self-discovery. It sounds like such a
simple thing, but it’s something I’m so glad
I’ve found.
Dr Ashutosh Deshpande is a junior doctor in general medicine in Glasgow and a student of Raja Yoga meditation.
Learn to meditateFor information about free Raja Yoga meditation courses around the UK: www.bkwsu.org/uk/uk/whatwedo/courses
Visit our online TV channel Watch videos of interviews, lectures and other Brahma Kumaris events (mostly in English) around the UK www.BrahmaKumarisUK.blip.tv
Join our mailing listSign up to receive The Inner Wave, Thought for the Day or events in your area by email at
www.bkwsu.org/uk/mailing_lists
In My Life Dr Ashutosh Deshpande
‘How to have a happier, more peaceful life?’ is one of the most frequently-asked questions
of our time. We have material comforts, yet
true peace still eludes us. On this theme, Dadi
Janki recently shared her wisdom in London,
delivered with her inimitable humour and
grace.
Dadi explained that if we have peace and
happiness, we have everything. In her own life
she has found that tolerance and patience
automatically lead to love and happiness,
based on inner peace, acceptance and under-
standing.
She described how possessiveness leads to
unhappiness, because we have expectations
of our partners, children and family, and, if
they don’t do what we expect, we are discon-
tented. So, to have better relationships, we
must first give love in order to receive it.
Dadi further guided us to be content with our
situation and bless it; never say anything to
hurt anyone; show mercy, love and honesty;
and keep ourselves in a state of inner peace.
Her words confirmed my own experience of
finding peaceful happiness inside when I take
time in stillness to reflect. I’ve discovered that
what is within us remains ours forever,
whereas outside things, like money or
possessions, can disappear.
A merciful, honest heart will give peace and
bring blessings to others without any need to
preach – we can then be ‘Virtues and Values
in Action’
Dadi Janki is Administrative Head of the Brahma Kumaris.
Christine Miller is a publisher, author and poet and Founder Editor of ReSource Magazine www.resourcemagazine.co.uk. She recently founded the ReSource Foundation dedicated to human development and beneficial change for people and planet www.resourcefoundation.org.uk.
How to be HappyChristine Miller
Dadi Janki’s visit to the UK in January 2010
included eight public engagements - in Oxford,
Shoreham-by-Sea and various Greater London
locations - as well as meetings with many
groups and individuals. Christine Miller
captured some of Dadi’s thoughts on
happiness for The Inner Wave.
“ I reflect on how I’m handling different situations and am
learning to respond better to them.” “ I’ve discovered that
what is within us remains ours forever, whereas
outside things, like money or possessions,
can disappear.”
Next issue: Dealing with Conflict
“ The fewer desires you have, the happier you
will be.
”
United Arab Emirates: Dadi Janki presents a memento to His Excellency Sheikh Abdul Aziz bin Ali Al-Nuaimi, CEO of Al Ihsaan Charity Centre, at an event organised by the Raja Yoga Center, Dubai, entitled Wisdom and Will Power on 23rd December 2009 at Dubai’s Sheikh Rashid Auditorium.
Denmark: Brahma Kumaris’ European Director Sister Jayanti at a press
conference entitled Spirit and Science in Agreement on the Climate Crisis at COP15, the
UN Climate Change Conference, in December 2009. An interview with Sister Jayanti on
Climate Change TV is at: www.brahmakumaris.dk/webtv
The Science of HappinessDr Prashant Kakoday
Inner Space, Glasgow opens “ I reflect on how
I’m handling different situations and am learning to respond better
to them.
”
In My LifeDr Ashutosh Deshpande
Dr Ashutosh Deshpande
page 2 page 3 page 4
Dadi Janki sharing her thoughts about The Power and Protection of Good Wishes at an intimate gathering of around 140 people, with Sister Manda translating, at
The Ropetackle Arts Centre, Shoreham-by-Sea on 13th January 2010.
Christine Miller
½ cup olive oil
½ cup milk/soya milk
Juice of 1 lemon
Pinch of salt
Mustard and/or asafoetida to taste
(optional)
1. Blend together the olive oil and milk, using a hand blender
2. Add lemon juice in very small amounts to the mixture and continue mixing with the blender. Stop adding lemon juice when the required consistency is achieved
3. Take care that the mayonnaise does not turn runny. If it becomes runny, add a little oil
4. Add salt and mustard and/or asafoetida to taste and serve
From Pure & Simple – Cooking for a Busy Lifestyle, available from www.bkpublications.com
TThThTThThhThThhhhhhThThee e tththhtttt ouououuouuughghhht tt thhhtththt attatttatat e e eeemmmemeeemmmergrgrggrgrgggggesesees i iiinn mmmymmyy aaaaaaa aawawawawawawaaaawwaawawaaawaarereeerereeneneneneneneeeeeeeeeessssssssssssssssss ii ss s ss thththhhhhhhe e e
thththththttthht ououououoouuoughgghhghghhghhghghhhghhghhhhgggghghtttttt t tt ofofofofo j j oyoyyyyyy… thththht eee eeeeeeee wowowooowoowowondnndndndddnndnddererereee ooooooooooooffff lililifeefefef ………………… ………… thttthhhheee e ee e wwowowowooowowowoowowowww ndndnddndnndnndndndnnnnddndn eererereerrr ooooooooooo oooo oofff fff
nanaaanaaatutututuututuututututuututututuuuuuuuuttut rerreree…………… thththhe eee eeeee wwwwwowowoww ndndnderr oooooooooooooooooo ooffff f ffffffffff f f ththhhhhththththththththttttt e eee ee wowowowooooorlrllllddddd ddd aaarraa oouuuouuo ndnddddddndddddddnndddddddddnnd mm mmm mee…ee…ee…e…e… t ttttttttttthehehehhhhhhehh jj jjj jjooooyooyoyoooooyoooyoyyy
ofofoofofofoffofoffffofoooof bbbbbeieieieiinnnggggn a aaaaa c ccccccccccchhiiihihildldld o o offf GoGoddd…………d………d……………… ttttttt ttttttthehehehehehehhhe j j j oyooy oooof f ffff eexexxxxpepeririririennene cicic ngng GGGGodooddod’s’s’s’ss
lolllllooooooolooooooovevveeeee. . .
IInIInnI ttthhhhihhh s s s awawawaaaa ara eeenenenne eeseessssesssssss ssssss ofofofofoffooofofoofooffoo t tt ttthehehee tt ttttt thhhihihiinnnnggngngngnggss ssss ofoofofoffof ee e teternrnititi y y y anana d dd ththe e
ththininnni gggssss ttthahah tt arrrrrareee eee reeeaalalalalaa aaaaaaaannnnnddnndn t ttruururr eeee,eee,e,, t tttthehheehehehehehee fff f fffeeeeeeeeeeeeeeelil ngngngngngggngngs s ssssss ofofofof ssorororroroooooooow ww wwww faffafffalllll
aawawwaya .
MMyM mmiininnnnndd d dd haahaassss sss fffflflfflflffffff ucuuucu tututt attteded bbbbbbetetetetettettttetetttete wwwwwweweewew eneneneneee ss s ssooorororooo rororooorooooowwwwwww w wwwwww anannnnana dddddd dd dd dd dd hhhaahahhhaaahahahh ppppppppppppp iiiiii----------
nenessss a aaaaaaaandnndndddndddn I I cccccccccaaaaanannnaanannn aaaa lllllllllowowowo i iit tt t tttotootttto c cccccc c oooonnonnnno ttitititinunununuue e ttoooottoto fffffluluuuuuuuuuuuuctctc uauaattetteeeette b bbbbuuututututuuu II
chchchoooosesee n nnootototott tt tttttoooooo o ooooo ddodod so.. EvEvEvverererery y y y ttititittit mmmmmmeememem mmmy y yyyy thththhhththouououuoouuuugggghghhhhggg tstststst sssssswwiwiwiwiwiwwwwwinnngnnngnnnnngng t tto o
sosososoorrrrrrrrrr oowwowwoo ,, , tttththhhhe e e iiimmmmmimmmimmmppapapapapp ctctcc o ooooof ffff thisiss o ooooo n nnn nn mmmymymyyymymy ccc coonononnnnnonnnnnnnnnnonnoonoo ssssscccscsscsscioioioiouususnenenessssssss ggrowss
evevevveeee ereerrerr s s sss strtrt ooonno ggegegegerr.rr.r WWWWWWWWWhahahahahhhh t ttt II wwawwawanttnt tttt oo oo o dododoooodd i iss s s errasssasasassse e e e thttththtthe eeee scsccscceeeenenenneseses o oof f
sososoososorrrrrroowowowwwowow aaaaaaaaa aaandndddd kkkkkeeeeeeeeeeeeeepppppppp p aaaalaalivivee thhthee e aawawawawwwwa ararrrarraraaa eeenenenee esesesssssssss ss s offoofooff j j jjoyooyoy..
ThThThThThThT iisis iiss oofofofofof bbbbb bbbbbb beenenenneeneefefeee it not jjussuu t t fofor r mmeeee b b bbuutut fforor thehehehe www wororororldldldld, , , fofoor
eaeeeaeaeaaaeachchchch aa ndnddddd eeeeee vvveeryyyy h ummanan bbbbeieie nngnggg w wwwhhohoho i iss partt oo ooooof fff mymymym w w wororororlddd. .
TThhhhe e ee jojoj y y ooooofofooooo bbbbeeieieinngngn a aa c cc hiihildldd o ooooooff f ff GooooGod dd dd ememerergegegesss s mymy oownnwn
didiignggnngng iititity,y,y aaaa f ffff eeeelil nngnggng o o ooof ff trtrt ememmenenennenne ddoddoousssususs l l lovove:e:ee: nnotototo o nlnly y ammamm II a a
chchchilildd d d oofof GGooodododooooodoooddoddd b bb bbuuutut I IIII ss sseeeee t ttttthhheheee www w whohohoholele o of f hhuuhuhuhuummamaniin tyty a alslslso oo asas
cchilillddrrdrrrdd enene o oof GGGoGoGoGooooGooGooGGooooGGGGooGGooooooooooddd.ddddddd
ThTThThe ddededed pttttth hh ofoffffffffffffff lll ll ovovovovovovvve ee ee ee inininin tttttttthihihihihhihihihiis sssss ss ss exexpeeeririririiieeeenenee cececeee o of ff f thththththee e ee eteteteteree nanal l
cocococonnnnnnnnneececececccctitittitit onononnooo fffilillslsl mmmm y y y y yy hhehheehheheh aararraraaa tt t aanananndd dd d d d d ththththhthththththththtt eeee e ee ppopoop wewewerr ofofofofff jj j j jjjooyoyoo b bece ommeses
sosososo s s sstttrt onononngg gg gg ggg tththhatata II ccccaanaananaann l leaeaavveve b behhhininnnndd dd ootottheheheeheheerrr r fefefefeff ellllininnnngsggs a anddnd
ememmmemmototiooionnnssssssss a a aandn lletett jj j jjoyooyyo r rululee mymyyy wwwwoororrroorldldddldldd ii innnsn idide.e.. MMMMMaiaiaiaintntnn aia niningngngggggg
ththhthisisisi a aaaawaw reeeeeeeennenennnnnn ss, II II cac n nnn shshshsshaararareeee ee hhhahahahahappppppppp iiininess s anandd jjjjooj y yy yy wiiththhhhh a a a a aallll
arararra ououououo ndnnndddd m m meee.e
FrFrF omom InInnnneneneneneneenennn rr Liighghg t, a aa CCDCDCDCDD o oof f f mmemememeediddiiditataatatit onnno ccccccoomomoommooommememememeeeemmeme ttttttttttttntntttntnttntnnn aaaraariiiieieiieees sss bybyby ttt
SSiSistststerererer JJ JJaayayyyyyanana tit , avavava aiaia lalal blble e e frfrfromoomomm
wwwwwwwwww.w.ww bkbkpupuupuuublblicici atatatiiooonsnnns.c.comomm
RECIPE: Egg-free MayonnaiseYour Feedback on The Inner Wave The Inner Wave has been going for over a year now and we've really appreciated receiving your comments about it – what you like, what you don’t, and what you’d like to see more of. In order to keep improving, we’ve designed a very short and simple online survey for our readers to give their feedback at www.surveymonkey.com/s/ZJZ7LJ3
We would be very grateful if you would take five minutes to complete it by 31st March 2010.
If you are not able to give us your comments through the online survey, we welcome them either by email or letter at the address below. Thank you.
Media Dept, BKWSU (UK)Global Co-operation House65-69 Pound LaneLondon NW10 2HH
“ The fewer desires
you have, the happier
you will be.”
The Greek philosopher Aristotle once said:
"Happiness is the meaning and purpose of
life, the whole aim and end of human
existence." Scientists today have also begun
to recognise its importance. So, what can
science tell us about happiness?
Many observations are contrary to commonly
held beliefs. For example, wealth beyond a
certain basic minimum doesn’t lead to happi-
ness. In fact, it’s been found that the happiest
are those who’ve discovered their own
strengths and virtues and use them for the
greater good.
Studies show a significant link between good
works and psychological wellbeing.
Motivated volunteers are happier, regardless
of personal circumstances. The link between
exercise and happiness is also recognised. In
some studies, regular exercise was shown to
be just as effective as anti-depressants.
There are also some insights into the chemis-
try of happiness. Serotonin, a neurotransmit-
ter, plays a major role in our experience of
happiness - high levels of it within the
synapses are associated with a feeling of
wellbeing. Conversely, most people with
depression have low serotonin levels. If we
artificially raise the level of seratonin, the
body responds by lowering its natural
So is there a formula for happiness? May I
suggest:
The fewer desires you have, the happier you
will be. Having the right information (truth)
leads to contentment. Having the right under-
standing of the self, our purpose, our origins
and our true relationships should free us from
the cycles of boom and bust and lead society
to that ultimate happiness.
Dr Prashant Kakoday is a medical doctor,
who has been studying Raja Yoga meditation
for over 20 years. He co-ordinates Brahma
Kumaris activities in Cambridge and lectures
around the world on topics ranging from
science and consciousness to the holistic
principles of life and health.
production. As a result, the ‘resting level’
goes down – when the external boost wears
off.
Things like coffee, chocolates and cigarettes
all artificially raise serotonin but with long
term ‘boom and bust’ results. The same can
happen with TV, Internet, sex, music, alcohol
and violence. A lack of serotonin leads to a
loss of self-control and increases negative
feelings like anger. By rediscovering our inner
source of happiness and freeing ourselves
from even one main dependency, we can
begin to raise our own serotonin levels.
Studies show that for many, one key relation-
ship in life is often the key source of happi-
ness. On the other hand, broken relationships
are the biggest cause of unhappiness. As
with other dependencies, we can use another
person like a drug: our serotonin level
becomes linked to the presence or absence
of that person.
The Science of HappinessDr Prashant Kakoday
HappinessTThThT erererere e e e isissi h h hhh hhhhhhhhhhhaaaapapapappapaappappipipipppppppp nenenenenenenesssssssssssssssssssssss w ww w w wwwwww wwwwwhehehehhhehehehehehhehehennn n n n nnn n eeeaeaeaeaeaeaeaeaeeaeae chchchchchchhchhhchhhhhhh mmm m m mmmm mmmmmmmomomomomommommomomoooomomoommmooommmmmmmmmoo eeeeeeeenneennnt t tt isisi u sed ddd innnnin aaaaaa aaa
wowowoortrtrthwhwhwhhhhhhiiihhhhihiiih lelelelleleee w wwwwwayaayyyyyyyayayyayayayaaayyyyy........... . .. HaHaHaHHHaHaHHHaHHHHaaHaHHHHHaaH ppppppppppppppppppppppppppppppppppppp ininnininninininniniiininneseseseseeseseeeseeseseeeeeeseeee sssssss sss isisisisiiisisiisisss sss sssssssssss ucucucucucccuccuccuchhhhhhh hhhh hhhhhhhhhhhhhhhhhhh nnnononnoononnonooonooonononoonnnnoonoon uururrrrrrrurururuuururururururrurrisisisiii hmh ent thatt
itt c can traaaaaansnsnsnsnssssnsnsnssnsnsnssnssfofofofofofffofffoormrmrmrmmmmm a aa p ppppppppppppererererrerererrerre sssossososossososss nnn nn frfrfrfrrfrf oomomommomomo w wwwwwwwwwweaeaeaeaaaaaeaaaeaaeaaaeaaeeaeaeaak kkkkkkkk k kkk kkkkkkk ininnninnnnntototoooootootoooto pppppp p p p p owwowwowowowwowerereereeereerrffufuffuuffuf l.ll.
It mmmakakkesesessee ddddddddddd ddddd ififfifififiififi fififficcccucc ltt t tttthhihhihihiihihihihinngnggnggsss eaaaaaeeaeasysysyssyysyysy aaaaa aaaaaaandndnddndnndndnn h hhh hh heaeaeaeaaaaaaeaae vyvvyvyvyvyvyyyvyvyy t tttt tthihihihih ngngnggngggssssssssssssss s s lllililliilililighghghghghghghhggggg ttt.t.t.tt.t.t.t
ToToTo rr rememmmmme aiaiaiinnnnn nnn nn hhhhahhappppppp y y aananndd shhararee e hahappppp inineesesesssssssss s wwwiwiwiwiiiiiiiiththththththththhthhth o oooooooooooothththhhhhhhthhthhtthttthththttt erererss s isisis
a aaaaa great aaaacaccccaaacca t ttt offoo c cchahhaaaririrr tyty.. NNoo mmatataa teteer r whhhwhatatat h hhhhhhhhapapappappapapapapapapappppepeppepepeeepensnsnnsnsnsnsnsnsnnsnnn , , , mym
hahhahaahahhah ppppppppininnneseeeseesessesesesseesessssssssssss ss s s sshhshshhssshshhshshshshshhhsshoooououoouoooououuldlddldldldldldll nnnnnnn n ootott bbb bbbbbeeeee ee loolooloolololooststsststsstststst....
FrFrFFrFFFF omomomommoo : :: A AAAAAAA PoPoPPoPoPoPoPP cckckckckckkkkkkkkkketetetetetetetetetteteteteetettteett BBBBBB B BB BB BB B BBooooooooooooooo k k k k ononoononnnn VVViriririrrrtuttutuuututuuueeeeeeeeee,, avavavavavaiaiaia llalalalalablblbleee ee frfrrrfrromomoomommoom
wwwwwww www.ww bkbkkbkkbkkkkkkkpupupupupuupupupupupupppupppppp bbbbbbbbblllllbblbbbbbllbb icaaatatataataatattattaaaaaaa iiioioioiooonsnsnssns.cc..c. omomomomomom
My heart is full and open. Flowing with pure
feelings and good wishes for everyone, I follow my
spontaneous instinct to give and I am truly happy.
From Self Mastery Cards – Self Empowerment and
Self Management in Stressful and Changing Times,
available from www.bkpublications.com
Joy of Being:a Meditation
The A-Z of Spiritual LivingG is for Generosity
Inner Space, Glasgow Glasgow’s new Meditation and Personal Development Centre was officially
opened by Sister Jayanti, European Director of the Brahma Kumaris, on 29th
January 2010. Addressing the 100 people who had packed into Inner Space,
Sister Jayanti said, “This is a beautiful setting to allow people to experience the
journey within. If a space is clean and beautiful, you are happy to spend a few
hours there. We can make our inner world like that. If we learn to create
contentment within, that is expressed in lightness, forgiveness and love.”
Inner Space, Glasgow offers a variety courses and talks free of charge, serving
as an introduction to personal growth and spirituality in daily life.
See also In My Life - page 4
Inner Space, 277 High Street, Glasgow, G4 0QS 0141 552 7446
www.innerspace.org/glasgow
½ cup olive oil
½ cup milk/soya milk
Juice of 1 lemon
Pinch of salt
Mustard and/or asafoetida to taste
(optional)
1. Blend together the olive oil and milk, using a hand blender
2. Add lemon juice in very small amounts to the mixture and continue mixing with the blender. Stop adding lemon juice when the required consistency is achieved
3. Take care that the mayonnaise does not turn runny. If it becomes runny, add a little oil
4. Add salt and mustard and/or asafoetida to taste and serve
From Pure & Simple – Cooking for a Busy Lifestyle, available from www.bkpublications.com
TThThTThThhThThhhhhhThThee e tththhtttt ouououuouuughghhht tt thhhtththt attatttatat e e eeemmmemeeemmmergrgrggrgrgggggesesees i iiinn mmmymmyy aaaaaaa aawawawawawawaaaawwaawawaaawaarereeerereeneneneneneneeeeeeeeeessssssssssssssssss ii ss s ss thththhhhhhhe e e
thththththttthht ououououoouuoughgghhghghhghhghghhhghhghhhhgggghghtttttt t tt ofofofofo j j oyoyyyyyy… thththht eee eeeeeeee wowowooowoowowondnndndndddnndnddererereee ooooooooooooffff lililifeefefef ………………… ………… thttthhhheee e ee e wwowowowooowowowoowowowww ndndnddndnndnndndndnnnnddndn eererereerrr ooooooooooo oooo oofff fff
nanaaanaaatutututuututuututututuututututuuuuuuuuttut rerreree…………… thththhe eee eeeee wwwwwowowoww ndndnderr oooooooooooooooooo ooffff f ffffffffff f f ththhhhhththththththththttttt e eee ee wowowowooooorlrllllddddd ddd aaarraa oouuuouuo ndnddddddndddddddnndddddddddnnd mm mmm mee…ee…ee…e…e… t ttttttttttthehehehhhhhhehh jj jjj jjooooyooyoyoooooyoooyoyyy
ofofoofofofoffofoffffofoooof bbbbbeieieieiinnnggggn a aaaaa c ccccccccccchhiiihihildldld o o offf GoGoddd…………d………d……………… ttttttt ttttttthehehehehehehhhe j j j oyooy oooof f ffff eexexxxxpepeririririennene cicic ngng GGGGodooddod’s’s’s’ss
lolllllooooooolooooooovevveeeee. . .
IInIInnI ttthhhhihhh s s s awawawaaaa ara eeenenenne eeseessssesssssss ssssss ofofofofoffooofofoofooffoo t tt ttthehehee tt ttttt thhhihihiinnnnggngngngnggss ssss ofoofofoffof ee e teternrnititi y y y anana d dd ththe e
ththininnni gggssss ttthahah tt arrrrrareee eee reeeaalalalalaa aaaaaaaannnnnddnndn t ttruururr eeee,eee,e,, t tttthehheehehehehehee fff f fffeeeeeeeeeeeeeeelil ngngngngngggngngs s ssssss ofofofof ssorororroroooooooow ww wwww faffafffalllll
aawawwaya .
MMyM mmiininnnnndd d dd haahaassss sss fffflflfflflffffff ucuuucu tututt attteded bbbbbbetetetetettettttetetttete wwwwwweweewew eneneneneee ss s ssooorororooo rororooorooooowwwwwww w wwwwww anannnnana dddddd dd dd dd dd hhhaahahhhaaahahahh ppppppppppppp iiiiii----------
nenessss a aaaaaaaandnndndddndddn I I cccccccccaaaaanannnaanannn aaaa lllllllllowowowo i iit tt t tttotootttto c cccccc c oooonnonnnno ttitititinunununuue e ttoooottoto fffffluluuuuuuuuuuuuctctc uauaattetteeeette b bbbbuuututututuuu II
chchchoooosesee n nnootototott tt tttttoooooo o ooooo ddodod so.. EvEvEvverererery y y y ttititittit mmmmmmeememem mmmy y yyyy thththhhththouououuoouuuugggghghhhhggg tstststst sssssswwiwiwiwiwiwwwwwinnngnnngnnnnngng t tto o
sosososoorrrrrrrrrr oowwowwoo ,, , tttththhhhe e e iiimmmmmimmmimmmppapapapapp ctctcc o ooooof ffff thisiss o ooooo n nnn nn mmmymymyyymymy ccc coonononnnnnonnnnnnnnnnonnoonoo ssssscccscsscsscioioioiouususnenenessssssss ggrowss
evevevveeee ereerrerr s s sss strtrt ooonno ggegegegerr.rr.r WWWWWWWWWhahahahahhhh t ttt II wwawwawanttnt tttt oo oo o dododoooodd i iss s s errasssasasassse e e e thttththtthe eeee scsccscceeeenenenneseses o oof f
sososoososorrrrrroowowowwwowow aaaaaaaaa aaandndddd kkkkkeeeeeeeeeeeeeepppppppp p aaaalaalivivee thhthee e aawawawawwwwa ararrrarraraaa eeenenenee esesesssssssss ss s offoofooff j j jjoyooyoy..
ThThThThThThT iisis iiss oofofofofof bbbbb bbbbbb beenenenneeneefefeee it not jjussuu t t fofor r mmeeee b b bbuutut fforor thehehehe www wororororldldldld, , , fofoor
eaeeeaeaeaaaeachchchch aa ndnddddd eeeeee vvveeryyyy h ummanan bbbbeieie nngnggg w wwwhhohoho i iss partt oo ooooof fff mymymym w w wororororlddd. .
TThhhhe e ee jojoj y y ooooofofooooo bbbbeeieieinngngn a aa c cc hiihildldd o ooooooff f ff GooooGod dd dd ememerergegegesss s mymy oownnwn
didiignggnngng iititity,y,y aaaa f ffff eeeelil nngnggng o o ooof ff trtrt ememmenenennenne ddoddoousssususs l l lovove:e:ee: nnotototo o nlnly y ammamm II a a
chchchilildd d d oofof GGooodododooooodoooddoddd b bb bbuuutut I IIII ss sseeeee t ttttthhheheee www w whohohoholele o of f hhuuhuhuhuummamaniin tyty a alslslso oo asas
cchilillddrrdrrrdd enene o oof GGGoGoGoGooooGooGooGGooooGGGGooGGooooooooooddd.ddddddd
ThTThThe ddededed pttttth hh ofoffffffffffffff lll ll ovovovovovovvve ee ee ee inininin tttttttthihihihihhihihihiis sssss ss ss exexpeeeririririiieeeenenee cececeee o of ff f thththththee e ee eteteteteree nanal l
cocococonnnnnnnnneececececccctitittitit onononnooo fffilillslsl mmmm y y y y yy hhehheehheheh aararraraaa tt t aanananndd dd d d d d ththththhthththththththtt eeee e ee ppopoop wewewerr ofofofofff jj j j jjjooyoyoo b bece ommeses
sosososo s s sstttrt onononngg gg gg ggg tththhatata II ccccaanaananaann l leaeaavveve b behhhininnnndd dd ootottheheheeheheerrr r fefefefeff ellllininnnngsggs a anddnd
ememmmemmototiooionnnssssssss a a aandn lletett jj j jjoyooyyo r rululee mymyyy wwwwoororrroorldldddldldd ii innnsn idide.e.. MMMMMaiaiaiaintntnn aia niningngngggggg
ththhthisisisi a aaaawaw reeeeeeeennenennnnnn ss, II II cac n nnn shshshsshaararareeee ee hhhahahahahappppppppp iiininess s anandd jjjjooj y yy yy wiiththhhhh a a a a aallll
arararra ououououo ndnnndddd m m meee.e
FrFrF omom InInnnneneneneneneenennn rr Liighghg t, a aa CCDCDCDCDD o oof f f mmemememeediddiiditataatatit onnno ccccccoomomoommooommememememeeeemmeme ttttttttttttntntttntnttntnnn aaaraariiiieieiieees sss bybyby ttt
SSiSistststerererer JJ JJaayayyyyyanana tit , avavava aiaia lalal blble e e frfrfromoomomm
wwwwwwwwww.w.ww bkbkpupuupuuublblicici atatatiiooonsnnns.c.comomm
RECIPE: Egg-free MayonnaiseYour Feedback on The Inner Wave The Inner Wave has been going for over a year now and we've really appreciated receiving your comments about it – what you like, what you don’t, and what you’d like to see more of. In order to keep improving, we’ve designed a very short and simple online survey for our readers to give their feedback at www.surveymonkey.com/s/ZJZ7LJ3
We would be very grateful if you would take five minutes to complete it by 31st March 2010.
If you are not able to give us your comments through the online survey, we welcome them either by email or letter at the address below. Thank you.
Media Dept, BKWSU (UK)Global Co-operation House65-69 Pound LaneLondon NW10 2HH
“ The fewer desires
you have, the happier
you will be.”
The Greek philosopher Aristotle once said:
"Happiness is the meaning and purpose of
life, the whole aim and end of human
existence." Scientists today have also begun
to recognise its importance. So, what can
science tell us about happiness?
Many observations are contrary to commonly
held beliefs. For example, wealth beyond a
certain basic minimum doesn’t lead to happi-
ness. In fact, it’s been found that the happiest
are those who’ve discovered their own
strengths and virtues and use them for the
greater good.
Studies show a significant link between good
works and psychological wellbeing.
Motivated volunteers are happier, regardless
of personal circumstances. The link between
exercise and happiness is also recognised. In
some studies, regular exercise was shown to
be just as effective as anti-depressants.
There are also some insights into the chemis-
try of happiness. Serotonin, a neurotransmit-
ter, plays a major role in our experience of
happiness - high levels of it within the
synapses are associated with a feeling of
wellbeing. Conversely, most people with
depression have low serotonin levels. If we
artificially raise the level of seratonin, the
body responds by lowering its natural
So is there a formula for happiness? May I
suggest:
The fewer desires you have, the happier you
will be. Having the right information (truth)
leads to contentment. Having the right under-
standing of the self, our purpose, our origins
and our true relationships should free us from
the cycles of boom and bust and lead society
to that ultimate happiness.
Dr Prashant Kakoday is a medical doctor,
who has been studying Raja Yoga meditation
for over 20 years. He co-ordinates Brahma
Kumaris activities in Cambridge and lectures
around the world on topics ranging from
science and consciousness to the holistic
principles of life and health.
production. As a result, the ‘resting level’
goes down – when the external boost wears
off.
Things like coffee, chocolates and cigarettes
all artificially raise serotonin but with long
term ‘boom and bust’ results. The same can
happen with TV, Internet, sex, music, alcohol
and violence. A lack of serotonin leads to a
loss of self-control and increases negative
feelings like anger. By rediscovering our inner
source of happiness and freeing ourselves
from even one main dependency, we can
begin to raise our own serotonin levels.
Studies show that for many, one key relation-
ship in life is often the key source of happi-
ness. On the other hand, broken relationships
are the biggest cause of unhappiness. As
with other dependencies, we can use another
person like a drug: our serotonin level
becomes linked to the presence or absence
of that person.
The Science of HappinessDr Prashant Kakoday
HappinessTThThT erererere e e e isissi h h hhh hhhhhhhhhhhaaaapapapappapaappappipipipppppppp nenenenenenenesssssssssssssssssssssss w ww w w wwwwww wwwwwhehehehhhehehehehehhehehennn n n n nnn n eeeaeaeaeaeaeaeaeaeeaeae chchchchchchhchhhchhhhhhh mmm m m mmmm mmmmmmmomomomomommommomomoooomomoommmooommmmmmmmmoo eeeeeeeenneennnt t tt isisi u sed ddd innnnin aaaaaa aaa
wowowoortrtrthwhwhwhhhhhhiiihhhhihiiih lelelelleleee w wwwwwayaayyyyyyyayayyayayayaaayyyyy........... . .. HaHaHaHHHaHaHHHaHHHHaaHaHHHHHaaH ppppppppppppppppppppppppppppppppppppp ininnininninininniniiininneseseseseeseseeeseeseseeeeeeseeee sssssss sss isisisisiiisisiisisss sss sssssssssss ucucucucucccuccuccuchhhhhhh hhhh hhhhhhhhhhhhhhhhhhh nnnononnoononnonooonooonononoonnnnoonoon uururrrrrrrurururuuururururururrurrisisisiii hmh ent thatt
itt c can traaaaaansnsnsnsnssssnsnsnssnsnsnssnssfofofofofofffofffoormrmrmrmmmmm a aa p ppppppppppppererererrerererrerre sssossososossososss nnn nn frfrfrfrrfrf oomomommomomo w wwwwwwwwwweaeaeaeaaaaaeaaaeaaeaaaeaaeeaeaeaak kkkkkkkk k kkk kkkkkkk ininnninnnnntototoooootootoooto pppppp p p p p owwowwowowowwowerereereeereerrffufuffuuffuf l.ll.
It mmmakakkesesessee ddddddddddd ddddd ififfifififiififi fififficcccucc ltt t tttthhihhihihiihihihihinngnggnggsss eaaaaaeeaeasysysyssyysyysy aaaaa aaaaaaandndnddndnndndnn h hhh hh heaeaeaeaaaaaaeaae vyvvyvyvyvyvyyyvyvyy t tttt tthihihihih ngngnggngggssssssssssssss s s lllililliilililighghghghghghghhggggg ttt.t.t.tt.t.t.t
ToToTo rr rememmmmme aiaiaiinnnnn nnn nn hhhhahhappppppp y y aananndd shhararee e hahappppp inineesesesssssssss s wwwiwiwiwiiiiiiiiththththththththhthhth o oooooooooooothththhhhhhhthhthhtthttthththttt erererss s isisis
a aaaaa great aaaacaccccaaacca t ttt offoo c cchahhaaaririrr tyty.. NNoo mmatataa teteer r whhhwhatatat h hhhhhhhhapapappappapapapapapapappppepeppepepeeepensnsnnsnsnsnsnsnsnnsnnn , , , mym
hahhahaahahhah ppppppppininnneseeeseesessesesesseesessssssssssss ss s s sshhshshhssshshhshshshshshhhsshoooououoouoooououuldlddldldldldldll nnnnnnn n ootott bbb bbbbbeeeee ee loolooloolololooststsststsstststst....
FrFrFFrFFFF omomomommoo : :: A AAAAAAA PoPoPPoPoPoPoPP cckckckckckkkkkkkkkketetetetetetetetetteteteteetettteett BBBBBB B BB BB BB B BBooooooooooooooo k k k k ononoononnnn VVViriririrrrtuttutuuututuuueeeeeeeeee,, avavavavavaiaiaia llalalalalablblbleee ee frfrrrfrromomoomommoom
wwwwwww www.ww bkbkkbkkbkkkkkkkpupupupupuupupupupupupppupppppp bbbbbbbbblllllbblbbbbbllbb icaaatatataataatattattaaaaaaa iiioioioiooonsnsnssns.cc..c. omomomomomom
My heart is full and open. Flowing with pure
feelings and good wishes for everyone, I follow my
spontaneous instinct to give and I am truly happy.
From Self Mastery Cards – Self Empowerment and
Self Management in Stressful and Changing Times,
available from www.bkpublications.com
Joy of Being:a Meditation
The A-Z of Spiritual LivingG is for Generosity
Inner Space, Glasgow Glasgow’s new Meditation and Personal Development Centre was officially
opened by Sister Jayanti, European Director of the Brahma Kumaris, on 29th
January 2010. Addressing the 100 people who had packed into Inner Space,
Sister Jayanti said, “This is a beautiful setting to allow people to experience the
journey within. If a space is clean and beautiful, you are happy to spend a few
hours there. We can make our inner world like that. If we learn to create
contentment within, that is expressed in lightness, forgiveness and love.”
Inner Space, Glasgow offers a variety courses and talks free of charge, serving
as an introduction to personal growth and spirituality in daily life.
See also In My Life - page 4
Inner Space, 277 High Street, Glasgow, G4 0QS 0141 552 7446
www.innerspace.org/glasgow
The Inner WaveThe Inner WaveNews, insights and experiences from the Brahma Kumaris World Spiritual University (UK)
Issue 9: Jan /Feb 2010
Welcome to the Inner Wave. Happiness can be as elusive as it is universally coveted. How can we, no matter what our situation may be,
make our lives more constantly happy? We hope to provide some practical answers here.
Editorial Team
© Brahma Kumaris World Spiritual University (UK)The Brahma Kumaris World Spiritual University (UK) teaches Raja Yoga as a way of experiencing peace of mind and a positive approach to life.
For more information about our activities around the UK, please see www.bkwsu.org/uk Registered Charity in England & Wales (269971) and Scotland (SC040512)
SSSSnnnaaapppsssshhhhoooottttssss frrroooommmm ooour ppppaaaarrrrtner oooorrrrggggaaaannnniiissssaaaattttiiiioooons aroundddd tttthhheeee wwwwoooorrrllldddd
What’sInside...
The last ten years have been constant change
for me: finishing school, leaving home and
then the daunting prospect of finding my way
in the ‘real world. Many personal and profes-
sional challenges came my way and I was
looking for a method to deal with them. I
came across the Brahma Kumaris through
their talk show on the Aastha International TV
Channel. What struck me was the practicality
of the discussions, which provided insights
into how to deal effectively with everyday
situations. Inner Space, which has recently
opened on Glasgow’s busy High Street, has
proven a valuable resource.
I’ve had a number of philosophical questions
for a long time, but I’m finding a greater level
of contentment by going deeper into under-
standing who I really am. Meditation helps me
to realise my true nature as a peaceful and
powerful being and it’s having a very positive
impact on my ability to be a good person and
a good doctor. Work can be very challenging
– dealing with difficult situations and making
decisions under pressure. It’s important for
me to approach clinical problems with a clear
mind, remaining calm and getting on well
Tobago: Youth leaders from across the Commonwealth, including Brahma Kumaris youth representatives, discussing Youth Involvement in Decision-making at the 7th Commonwealth Youth Forum, Trinidad & Tobago, in November 2009.
Australia: Thousands of people arriving at The Parliament of theWorld’s Religions in Melbourne wrote messages of support and hope to the world leaders attending COP15 in Copenhagen in a 120 metre long
‘Great Letter’, organised by Brahma Kumaris (Australia) in December 2009.
with everyone. It helps avoid unnecessary
anxiety and stress. It’s something that has
improved greatly through practicing medita-
tion – and it’s changed my outlook on life.
I’m more positive and energetic. I meditate in
the morning and at night, and take pauses
throughout the day. I reflect on how I’m
handling different situations and am learning
to respond better to them. My family and
friends have certainly appreciated the
benefits! For me it’s an ongoing process of
spiritual self-discovery. It sounds like such a
simple thing, but it’s something I’m so glad
I’ve found.
Dr Ashutosh Deshpande is a junior doctor in general medicine in Glasgow and a student of Raja Yoga meditation.
Learn to meditateFor information about free Raja Yoga meditation courses around the UK: www.bkwsu.org/uk/uk/whatwedo/courses
Visit our online TV channel Watch videos of interviews, lectures and other Brahma Kumaris events (mostly in English) around the UK www.BrahmaKumarisUK.blip.tv
Join our mailing listSign up to receive The Inner Wave, Thought for the Day or events in your area by email at
www.bkwsu.org/uk/mailing_lists
In My Life Dr Ashutosh Deshpande
‘How to have a happier, more peaceful life?’ is one of the most frequently-asked questions
of our time. We have material comforts, yet
true peace still eludes us. On this theme, Dadi
Janki recently shared her wisdom in London,
delivered with her inimitable humour and
grace.
Dadi explained that if we have peace and
happiness, we have everything. In her own life
she has found that tolerance and patience
automatically lead to love and happiness,
based on inner peace, acceptance and under-
standing.
She described how possessiveness leads to
unhappiness, because we have expectations
of our partners, children and family, and, if
they don’t do what we expect, we are discon-
tented. So, to have better relationships, we
must first give love in order to receive it.
Dadi further guided us to be content with our
situation and bless it; never say anything to
hurt anyone; show mercy, love and honesty;
and keep ourselves in a state of inner peace.
Her words confirmed my own experience of
finding peaceful happiness inside when I take
time in stillness to reflect. I’ve discovered that
what is within us remains ours forever,
whereas outside things, like money or
possessions, can disappear.
A merciful, honest heart will give peace and
bring blessings to others without any need to
preach – we can then be ‘Virtues and Values
in Action’
Dadi Janki is Administrative Head of the Brahma Kumaris.
Christine Miller is a publisher, author and poet and Founder Editor of ReSource Magazine www.resourcemagazine.co.uk. She recently founded the ReSource Foundation dedicated to human development and beneficial change for people and planet www.resourcefoundation.org.uk.
How to be HappyChristine Miller
Dadi Janki’s visit to the UK in January 2010
included eight public engagements - in Oxford,
Shoreham-by-Sea and various Greater London
locations - as well as meetings with many
groups and individuals. Christine Miller
captured some of Dadi’s thoughts on
happiness for The Inner Wave.
“ I reflect on how I’m handling different situations and am
learning to respond better to them.” “ I’ve discovered that
what is within us remains ours forever, whereas
outside things, like money or possessions,
can disappear.”
Next issue: Dealing with Conflict
“ The fewer desires you have, the happier you
will be.
”
United Arab Emirates: Dadi Janki presents a memento to His Excellency Sheikh Abdul Aziz bin Ali Al-Nuaimi, CEO of Al Ihsaan Charity Centre, at an event organised by the Raja Yoga Center, Dubai, entitled Wisdom and Will Power on 23rd December 2009 at Dubai’s Sheikh Rashid Auditorium.
Denmark: Brahma Kumaris’ European Director Sister Jayanti at a press
conference entitled Spirit and Science in Agreement on the Climate Crisis at COP15, the
UN Climate Change Conference, in December 2009. An interview with Sister Jayanti on
Climate Change TV is at: www.brahmakumaris.dk/webtv
The Science of HappinessDr Prashant Kakoday
Inner Space, Glasgow opens “ I reflect on how
I’m handling different situations and am learning to respond better
to them.
”
In My LifeDr Ashutosh Deshpande
Dr Ashutosh Deshpande
page 2 page 3 page 4
Dadi Janki sharing her thoughts about The Power and Protection of Good Wishes at an intimate gathering of around 140 people, with Sister Manda translating, at
The Ropetackle Arts Centre, Shoreham-by-Sea on 13th January 2010.
Christine Miller