The first PCR cycle: The sequence between the two primers will be amplified

36

TAGS:

description

PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers is amplified. The first PCR cycle: The sequence between the two primers will be amplified. Four cycles of PCR. - PowerPoint PPT Presentation

Transcript of The first PCR cycle: The sequence between the two primers will be amplified

Page 1: The first PCR cycle: The sequence between the two primers will be amplified
Page 2: The first PCR cycle: The sequence between the two primers will be amplified

PCR is another in vitro DNA synthesis reactionThe twist in this case is that the reaction is repeated 25-30 times so that the DNA between

the primers is amplified

Page 3: The first PCR cycle: The sequence between the two primers will be amplified

The first PCR cycle:The sequence between the two primers will be

amplified

Page 4: The first PCR cycle: The sequence between the two primers will be amplified

Four cycles of PCR

Page 5: The first PCR cycle: The sequence between the two primers will be amplified

Copy number of the sequence between the primers increases exponentially

Page 6: The first PCR cycle: The sequence between the two primers will be amplified

SEQUENCIAMENTO DE DNA

Profa. Dra. Maria Aparecida Fernandez

Depto de Biologia Celular e Genética

Universidade Estadual de Maringá

Page 7: The first PCR cycle: The sequence between the two primers will be amplified

Structure of dideoxynucleotide triphosphates

Page 8: The first PCR cycle: The sequence between the two primers will be amplified

Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist

DNAP requires a template and a primer

The [ddNTP] determines the distribution of chain lengths produced.

The primer is labeled so the DNA fragments synthesized can be detected by autoradiography.

Page 9: The first PCR cycle: The sequence between the two primers will be amplified
Page 10: The first PCR cycle: The sequence between the two primers will be amplified

TGGCTCGGCCTCAAGTCGAGGTTATCAGATCTGCAACTCAA

Alto peso molecular

Baixo peso molecular

Filme de raio X

Auto-radiograma

Leitura manual

Page 11: The first PCR cycle: The sequence between the two primers will be amplified

Automated DNA Sequencing

Page 12: The first PCR cycle: The sequence between the two primers will be amplified

Reação de seqüênciamentoReação de seqüênciamento

Page 13: The first PCR cycle: The sequence between the two primers will be amplified

Fragmentos amplificados na reação de seqüênciamentoFragmentos amplificados na reação de seqüênciamento

Page 14: The first PCR cycle: The sequence between the two primers will be amplified

Typical output of an automated sequencer

Page 15: The first PCR cycle: The sequence between the two primers will be amplified

Eletroforese no seqüênciamentoEletroforese no seqüênciamento

Page 16: The first PCR cycle: The sequence between the two primers will be amplified
Page 17: The first PCR cycle: The sequence between the two primers will be amplified

Captura do fluorescente e processamento da informaçãoCaptura do fluorescente e processamento da informação

Page 18: The first PCR cycle: The sequence between the two primers will be amplified
Page 19: The first PCR cycle: The sequence between the two primers will be amplified
Page 20: The first PCR cycle: The sequence between the two primers will be amplified

Seqüenciador automáticoSeqüenciador automático

Page 21: The first PCR cycle: The sequence between the two primers will be amplified
Page 22: The first PCR cycle: The sequence between the two primers will be amplified
Page 23: The first PCR cycle: The sequence between the two primers will be amplified
Page 24: The first PCR cycle: The sequence between the two primers will be amplified
Page 25: The first PCR cycle: The sequence between the two primers will be amplified
Page 26: The first PCR cycle: The sequence between the two primers will be amplified
Page 27: The first PCR cycle: The sequence between the two primers will be amplified
Page 28: The first PCR cycle: The sequence between the two primers will be amplified
Page 29: The first PCR cycle: The sequence between the two primers will be amplified

Conjunto

de

16 capilares

Page 30: The first PCR cycle: The sequence between the two primers will be amplified
Page 31: The first PCR cycle: The sequence between the two primers will be amplified
Page 32: The first PCR cycle: The sequence between the two primers will be amplified
Page 33: The first PCR cycle: The sequence between the two primers will be amplified
Page 34: The first PCR cycle: The sequence between the two primers will be amplified

Panorama no momento da corrida

Page 35: The first PCR cycle: The sequence between the two primers will be amplified

Análise preliminar pós corrida

Page 36: The first PCR cycle: The sequence between the two primers will be amplified

ELETROFEROGRAMAS


Sensitive, specific real-time PCR without · PDF fileSensitive, specific real-time PCR without probes LUX ... analysis. LUX ™ Primers are ... double-stranded PCR product,

Sensitive, specific real-time PCR without · PDF fileSensitive, specific real-time PCR without probes LUX ... analysis. LUX ™ Primers are ... double-stranded PCR product,

sem4-cdna sythesis,pcr,designing primers for pcr, synthesis of genes, shotgun experiment and gene library.

sem4-cdna sythesis,pcr,designing primers for pcr, synthesis of genes, shotgun experiment and gene library.

Supplemental table 1 : List of primers used for Me-DIP coupled Q-PCR.

Supplemental table 1 : List of primers used for Me-DIP coupled Q-PCR.

Design and standardization of PCR primers and protocols for …€¦ ·  · 2015-03-10LEADING ARTICLE Design and standardization of PCR primers and protocols for detection of clonal

Design and standardization of PCR primers and protocols for …€¦ ·  · 2015-03-10LEADING ARTICLE Design and standardization of PCR primers and protocols for detection of clonal

Table S2. Sequences of primers used for RT-PCR

Table S2. Sequences of primers used for RT-PCR

Synthetic Biology for - 2015.igem.org2015.igem.org/.../c/cb/IGEM5_OurProject_InversePCR.pdf · 2015-09-19 · Our Primers in Inverse PCR In PCR, the primers are part of the newly

Synthetic Biology for - 2015.igem.org2015.igem.org/.../c/cb/IGEM5_OurProject_InversePCR.pdf · 2015-09-19 · Our Primers in Inverse PCR In PCR, the primers are part of the newly

General-use polymerase chain reaction primers for ...web.stanford.edu/group/Palumbi/manuscripts/General... · species, these primers are an easy starting point for cloning amplified

General-use polymerase chain reaction primers for ...web.stanford.edu/group/Palumbi/manuscripts/General... · species, these primers are an easy starting point for cloning amplified

Specificity, Efficiency, and Fidelity of PCR...PCR generated a number of unspecific bands or if a different set of primers (i.e., internal primers) is to be utilized for the subsequent

Specificity, Efficiency, and Fidelity of PCR...PCR generated a number of unspecific bands or if a different set of primers (i.e., internal primers) is to be utilized for the subsequent

IMP PCR primers detect single nucleotide polymorphisms for

IMP PCR primers detect single nucleotide polymorphisms for

Genetic Polymorphism in Barley Detected by PCR …PCR product with arbitrary primers; this method was developed in [1, 2]. Primers used for RAPD are of relatively small size (8-12

Genetic Polymorphism in Barley Detected by PCR …PCR product with arbitrary primers; this method was developed in [1, 2]. Primers used for RAPD are of relatively small size (8-12

False positive results using PCR detection method …journals.tubitak.gov.tr/veterinary/issues/vet-15-39-3/...of the PCR product using primers PPA1 and PPA2 primers was 257 bp. The

False positive results using PCR detection method …journals.tubitak.gov.tr/veterinary/issues/vet-15-39-3/...of the PCR product using primers PPA1 and PPA2 primers was 257 bp. The

A Simple Efficient Method for Purification of Degraded PCR Primers

A Simple Efficient Method for Purification of Degraded PCR Primers

Analytes and Related PCR Primers Used for GMO Detection ...publications.jrc.ec.europa.eu/repository/bitstream... · Analytes and Related PCR Primers Used for GMO Detection and Quantification

Analytes and Related PCR Primers Used for GMO Detection ...publications.jrc.ec.europa.eu/repository/bitstream... · Analytes and Related PCR Primers Used for GMO Detection and Quantification

What’s lurking in the soil? - GrowNextGen · What is amplified by PCR? Barcodes: regions of DNA that differ between species. Scientists use a set of universal primers in conserved

What’s lurking in the soil? - GrowNextGen · What is amplified by PCR? Barcodes: regions of DNA that differ between species. Scientists use a set of universal primers in conserved

Original article Mutations in JPH2-encoded junctophilin-2 ... · The full-length mouse JPH2 cDNA was amplified by PCR from plasmid pMHMG72,provided byH.Takeshima,usingthe primers

Original article Mutations in JPH2-encoded junctophilin-2 ... · The full-length mouse JPH2 cDNA was amplified by PCR from plasmid pMHMG72,provided byH.Takeshima,usingthe primers

Gene expression in Triboliumcastaneum life stages ...The primary set of primers (Forward: ATAATCAAGCCCGTTTCCAACA, Reverse: AATCACGACTACAAACATTCTTAGG) amplified CPG in 25 ml PCR reactions

Gene expression in Triboliumcastaneum life stages ...The primary set of primers (Forward: ATAATCAAGCCCGTTTCCAACA, Reverse: AATCACGACTACAAACATTCTTAGG) amplified CPG in 25 ml PCR reactions

Supplemental Table 1. Primers used for RT-PCR analysis of ...dm5migu4zj3pb.cloudfront.net/manuscripts/42000/42917/JCI42917sd.pdf · Supplemental Table 1. Primers used for RT-PCR analysis

Supplemental Table 1. Primers used for RT-PCR analysis of ...dm5migu4zj3pb.cloudfront.net/manuscripts/42000/42917/JCI42917sd.pdf · Supplemental Table 1. Primers used for RT-PCR analysis

PCR with arbitrary primers - Gene bankcropgenebank.sgrp.cgiar.org/images/file/learning_space/...(AP-PCR) PCR with arbitrary primers Three main techniques fall within the category of

PCR with arbitrary primers - Gene bankcropgenebank.sgrp.cgiar.org/images/file/learning_space/...(AP-PCR) PCR with arbitrary primers Three main techniques fall within the category of

Supplemental Figures. Figure S1: Primers used for genotyping icp55 insertion lines, full length cDNA amplification and qRT-PCR. Primers for Genotyping:

Supplemental Figures. Figure S1: Primers used for genotyping icp55 insertion lines, full length cDNA amplification and qRT-PCR. Primers for Genotyping:

Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired