THE EVOLUTION AND DIVERSIFICATION OF EPIPHYTIC FERNS

by

Eric Schuettpelz

Department of Biology Duke University

Date:

______________________________

Approved:

______________________________ Kathleen M. Pryer, Supervisor

______________________________

François Lutzoni

______________________________ Paul S. Manos

______________________________

V. Louise Roth

______________________________ Harald Schneider

______________________________

Jeffrey L. Thorne

Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor

of Philosophy in the Department of Biology in the Graduate School

of Duke University

2007

ABSTRACT

THE EVOLUTION AND DIVERSIFICATION OF EPIPHYTIC FERNS

by

Eric Schuettpelz

Department of Biology Duke University

Date:

______________________________

Approved:

______________________________ Kathleen M. Pryer, Supervisor

______________________________

François Lutzoni

______________________________ Paul S. Manos

______________________________

V. Louise Roth

______________________________ Harald Schneider

______________________________

Jeffrey L. Thorne

An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of

Biology in the Graduate School of Duke University

2007

Copyright by Eric Schuettpelz

2007

iv

ABSTRACT

Leptosporangiate ferns, with more than 9000 extant species, are truly exceptional among

the non-flowering lineages of vascular plants. However, this rather remarkable diversity was not

simply a consequence of being able to “hold on” as flowering plants rose to dominance. Instead,

it appears to be the result of an ecological opportunistic response to the establishment of more

complex, angiosperm-dominated ecosystems. The proliferation of flowering plants across the

landscape undoubtedly resulted in the formation of a plethora of new niches into which

leptosporangiate ferns could diversify. Many of these were evidently on shady forest floors, but

many others were actually within the new angiosperm-dominated canopies. Today, almost one

third of leptosporangiate species grow as epiphytes on angiosperm trees. My dissertation aims to

demystify the evolution and diversification of epiphytic ferns in order to more fully understand

the leptosporangiate success story. By assembling and analyzing the most inclusive molecular

dataset for leptosporangiate ferns to date, I provide unprecedented insight into overall fern

relationships and a solid and balanced phylogenetic framework within which the evolution of

epiphytism can be examined. By employing this phylogeny and numerous constraints from the

fern fossil record, I uncover the timing of epiphytic fern diversification and examine the origin of

the modern tropical rain forest biome in which these ferns reside.

v

For Jan

vi

TABLE OF CONTENTS

Abstract ................................................................................................................................................. iv List of tables ........................................................................................................................................ vii List of figures......................................................................................................................................viii Acknowledgments ................................................................................................................................ ix Introduction............................................................................................................................................ 1 Part I: Fern phylogeny inferred from 400 leptosporangiate species and three plastid genes........................................................................................................................................... 5 Part II: Origin of tropical rain forests revealed by epiphytic fern diversification........................... 43 Part III: Further insight into the evolution and diversification of seed-free vascular plants ..................................................................................................................................... 62 References............................................................................................................................................ 65 Biography............................................................................................................................................. 78

vii

LIST OF TABLES

Table 1. Contributions of major vascular plant lineages to total and epiphytic species diversity..................................................................................................................................... 4 Table 2. Taxonomic sampling and voucher information for my study of leptosporangiate fern phylogeny ........................................................................................................ 20 Table 3. Amplification and sequencing primers routinely used in my study of leptosporangiate fern phylogeny ........................................................................................................ 31 Table 4. Statistics for the four datasets analyzed in my study of leptosporangiate fern phylogeny..................................................................................................................................... 32 Table 5. Taxonomic sampling and habit information for my study of epiphytic fern diversification .............................................................................................................................. 48 Table 6. Age constraints utilized in my study of epiphytic fern diversification ............................ 57

viii

LIST OF FIGURES

Figure 1a. Leptosporangiate fern phylogeny.................................................................................... 33 Figure 1b. Continued from Figure 1a................................................................................................ 35 Figure 1c. Continued from Figure 1b................................................................................................ 37 Figure 1d. Continued from Figure 1c................................................................................................ 39 Figure 1e. Continued from Figure 1d................................................................................................ 41 Figure 2. Epiphytic fern diversification ............................................................................................ 60

ix

ACKNOWLEDGMENTS

For support and guidance throughout the completion of this project, I am especially

grateful to my advisor, Kathleen Pryer. The remaining members of my committee—François

Lutzoni, Paul Manos, Louise Roth, Harald Schneider, and Jeff Thorne—also provided valuable

comments and criticism; Gordon Burleigh, Amanda Grusz, Petra Korall, Jordan Metzgar,

Nathalie Nagalingum, Carl Rothfels, Alan Smith, and Michael Windham gave me helpful

feedback. For laboratory and technical assistance, I am indebted to Samantha Hill, Frank Kauff,

Channa Pickett, and Michal Skakuj; Alexandros Stamatakis was kind enough to modify RAxML

at my request, to optimize and save branch lengths for bootstrap trees. For their assistance in

obtaining plant material or DNA that was newly utilized in this study, I thank Kobinah Abdul-

Salim, Tony Avent, David Barrington, Francisco Campos, Maarten Christenhusz, David Conant,

Jean-Yves Dubuisson, Atsushi Ebihara, Sabine Hennequin, Layne Huiet, Thomas Janssen,

Masahiro Kato, Michael Kessler, Susan Klimas, Robbin Moran, Andrew Murdock, David Neill,

Tom Ranker, Petra Schmidt, Homero Vargas, Paul Wolf, and George Yatskievych, as well as the

Alter Botanischer Garten Göttingen, Botanischer Garten Berlin—Dahlem, Botanischer Garten

München—Nymphenburg, Duke University Department of Biology Plant Teaching and Research

Facility, Juniper Level Botanic Gardens, Ministerio del Ambiente—Ecuador, Ministerio del

Ambiente y Energía—Costa Rica, Organization for Tropical Studies, and United States

Department of Agriculture—Forest Service. This research was funded in part by an American

Society of Plant Taxonomists R. McVaugh Graduate Student Research Grant, a Duke University

Department of Biology A. W. Mellon Plant Systematics Program Award, a Duke University

Graduate School International Research Travel Award, a G. H. M. Lawrence Memorial Award, a

National Science Foundation Doctoral Dissertation Improvement Grant (DEB-0408077), and a

Society of Systematic Biologists Graduate Student Research Award.

x

The origin of epiphytes is up in the air…

1

INTRODUCTION

Over the course of some 80 million years during the Cretaceous period (i.e., from 145.5

Ma to 65.5 Ma; Gradstein & al., 2004), the Earth’s vegetation changed dramatically from a

landscape populated by gymnosperms and seed-free vascular plants to one dominated by

angiosperms. As flowering plants rose to dominance, other vascular plant lineages were largely

relegated to the sidelines—if not driven completely to extinction (Crane, 1987; Crane & al., 1995;

Lidgard & Crane, 1990; Lupia & al., 1999; Nagalingum & al., 2002; Niklas & al., 1985). Today,

angiosperms account for about 96% of vascular plant diversity; almost all of the 12 remaining

major vascular plant lineages comprise just a handful or perhaps a few hundred species (Table 1).

The only exception is the leptosporangiate fern clade. Although not nearly as diverse as

flowering plants, this group has realized a substantial diversity of about 9000 extant species—

almost four times the number of extant species in all other non-flowering lineages combined

(Table 1).

Leptosporangiate ferns originated over 300 million years ago well before the evolution of

angiosperms and, based on the fossil record, are thought to have undergone three successive

radiations (Lovis, 1977; Rothwell, 1987). The first radiation occurred in the Carboniferous and

gave rise to several now-extinct families. The second radiation took place in the late Paleozoic

and early Mesozoic, resulting in several families with extant representatives. The third radiation

began in the Cretaceous, and continues today—primarily within the so-called polypod fern clade.

Recently, my colleagues and I were able to confirm the existence of this third radiation through

the integration of fossil and living data (Schneider & al., 2004c). We found that the bulk of

diversification within the polypod clade actually took place in the Late Cretaceous and Cenozoic,

after the rise of angiosperms. In a subsequent study, we found that this relatively recent

diversification was not restricted to polypods, but was also evident in several of the early-

2

diverging leptosporangiate orders (Pryer & al., 2004). These results suggest that the remarkable

diversity of leptosporangiate ferns is not simply the result of being adept at holding on in the face

of angiosperm adversity. Instead, it is because ferns were able to somehow capitalize upon it.

One rather plausible explanation for the success of leptosporangiate ferns involves an

ecological opportunistic response (Schneider & al., 2004c; Smith, 1972). The proliferation of

angiosperms across the landscape, and the ensuing establishment of more complex ecosystems,

undoubtedly resulted in the formation of a plethora of new niches into which leptosporangiate

ferns could diversify. Although many of these novel ecospaces were evidently on shady forest

floors, many others were actually within the angiosperm-dominated canopies. Indeed, almost one

third of leptosporangiate species are epiphytic (i.e., reside on an aboveground plant surface but do

not extract water or nutrients from the host plant or the ground; Moffett, 2000). And, while

leptosporangiate ferns account for just 3% of total vascular plant biodiversity, they compose 10%

of the Earth’s vascular epiphytes (Table 1).

The epiphytic habit has obviously been of paramount importance to the prosperity of

leptosporangiate ferns. Nonetheless, remarkably little is known about the evolutionary history of

these plants (Dubuisson & al., 2003b; Schneider & al., 2004c; Tsutsumi & Kato, 2006). It

remains unclear just how many times epiphytism has arisen within ferns, and it is still not known

with any precision when these lineages diversified. Demystifying the evolution and

diversification of epiphytic ferns is essential to a full understanding of the leptosporangiate

success story. Even more importantly, it can provide critical insight into the origin of the modern

tropical rain forest biome in which these ferns are found.

My dissertation represents an initial attempt to better understand the evolution and

diversification of epiphytic ferns. In Part I, a solid and balanced phylogenetic framework is

established within which the evolution of epiphytism can be examined. In Part II, this phylogeny

is employed to assess the timing of epiphytic fern diversification and date the origin of modern

3

tropical rain forests. Part III summarizes my other contributions and some future prospects related

to the evolution and diversification of seed-free vascular plants.

4

Table 1. Contributions of major vascular plant lineages to total and epiphytic species diversity. Major lineages follow those of Pryer & al. (2004). Total species counts represent a relatively conservative consensus drawn from several sources (Judd & al., 2002; Mabberley, 1997; Palmer & al., 2004; Smith & al., 2006b). Epiphytic species counts are based on percentages from Kress (1986; not shown) multiplied by the total species counts presented here. Percentages in table indicate the contributions of lineages to total and epiphytic species diversity (columns sum to 100%). Vascular plant lineage Total species Epiphytic species Lycopods

Quillworts 150 (< 1%) 0 (0%) Clubmosses 380 (< 1%) 190 (< 1%) Spikemosses 700 (< 1%) 5 (< 1%)

Ferns Whisk ferns 12 (< 1%) 11 (< 1%) Horsetails 15 (< 1%) 0 (0%) Ophioglossoid ferns 80 (< 1%) 11 (< 1%) Marattioid ferns 150 (< 1%) 0 (0%) Leptosporangiate ferns 9,000 (3%) 2,822 (10%)

Seed plants Ginkgo 1 (< 1%) 0 (0%) Gnetales 80 (< 1%) 4 (< 1%) Cycads 130 (< 1%) 1 (< 1%) Conifers 600 (< 1%) 0 (0%) Angiosperms 260,000 (96%) 24,444 (89%)

5

PART I

FERN PHYLOGENY INFERRED FROM

400 LEPTOSPORANGIATE SPECIES AND THREE PLASTID GENES

Summary

In an effort to obtain a solid and balanced approximation of global fern phylogeny to

serve as a tool for addressing large-scale evolutionary questions, I assembled and analyzed the

most inclusive molecular dataset for leptosporangiate ferns to date. Three plastid genes (rbcL,

atpB, and atpA), totaling more than 4000 bp, were sequenced for each of 400 leptosporangiate

fern species (selected using a proportional sampling approach) and five outgroups. Maximum

likelihood analysis of these data yielded an especially robust phylogeny: 80% of the nodes were

supported by a maximum likelihood bootstrap percentage ≥ 70. The scope of my analysis

provides unprecedented insight into overall fern relationships, not only delivering additional

support for the deepest leptosporangiate divergences, but also uncovering the composition of

more recently emerging clades and their relationships to one another.

Introduction

An accurate and robust assessment of phylogeny is fundamental to a full understanding

of evolutionary origins because it provides the overall pattern of historical divergence—a

framework for exploring both evolution and diversification. Although reconstructing phylogeny

remains a challenging endeavor, the use of DNA sequence data has revolutionized our ability to

assess relationships in many groups, including leptosporangiate ferns, a large well-supported

clade of vascular plants (Pryer & al., 2001a, 2004) characterized by sporangia that develop from a

6

single cell and have mature walls just one cell thick.

Molecular phylogenetic analyses including representative placeholder taxa have revealed

the composition of, and the relationships among, the major leptosporangiate lineages (Hasebe &

al., 1993, 1994, 1995; Pryer & al., 1995, 2001a, 2004; Schneider & al., 2004c; Schuettpelz & al.,

2006; Vangerow & al., 1999; Wikström & Pryer, 2005; Wolf, 1996, 1997). Densely sampled

analyses within some of these groups have elucidated more detailed associations and have

provided a phylogenetic framework for more narrowly-focused evolutionary studies (see

references cited under various taxonomic groups in Discussion). However, neither placeholder

sampling from various clades nor dense sampling within a particular clade is well suited to

addressing large-scale evolutionary questions across leptosporangiate ferns. A more

comprehensive approach is necessary.

The most inclusive analysis of leptosporangiate fern relationships conducted to date was

the groundbreaking collaborative study of Hasebe & al. (1995). But although this study helped

answer many long-standing questions in fern systematics (Smith, 1995), it was not without

problems. With about 9000 extant species in 267 genera (Smith & al., 2006b), leptosporangiate

ferns are, after angiosperms, the most diverse lineage of vascular plants. Yet, the Hasebe & al.

(1995) study sampled just 99 species from 92 genera, excluding almost two thirds of

leptosporangiate fern genera and undersampling all but the smallest. Furthermore, it was founded

on a single plastid gene (1206 base pairs of rbcL), resulting in relatively low levels of branch

support across the phylogeny (only about half of the resolved nodes were supported by maximum

parsimony or neighbor joining bootstrap percentages ≥ 70).

To obtain a better-sampled and better-supported estimate of overall fern relationships and

move one step closer to a comprehensive phylogeny of extant ferns, a considerably larger dataset

is assembled and analyzed here. It comprises 400 leptosporangiate species from 187 genera—

well over 4% of the species and more than two-thirds of the genera (Smith & al., 2006b)—

7

sampled in proportion to lineage size, to provide a more accurate and balanced representation of

the fern tree of life. For each species, three plastid protein-coding genes were sequenced—

totaling more than 4000 base pairs—to ensure a well-supported phylogeny. The current analysis

builds upon the foundation of earlier studies to provide an unparalleled framework within which

to examine the evolution and diversification of leptosporangiate ferns, while simultaneously

improving our phylogenetic understanding of this important lineage.

Materials and Methods

Taxonomic sampling. In phylogenetic studies, a strict placeholder approach is often

utilized (i.e., a single species is used to represent each genus in intrafamilial studies, a single

genus is used to represent each family in intraordinal studies, etc.). While such an approach is

appropriate when the goal is to simply infer evolutionary relationships at a given level, it does not

provide a balanced representation of phylogeny. Exhaustive sampling would be the ideal

solution, but this is still not feasible for broad analyses. Therefore, in this study, an alternative

hybrid approach is employed. An attempt is made to sample lineages (i.e., families and genera)

in proportion to the number of species they contain. In total, 400 leptosporangiate fern species

were selected from all families recognized in the most recent phylogeny-based classification for

ferns (Smith & al., 2006b); all large genera and many small genera are included (Table 2). To

root the leptosporangiate phylogeny, five outgroup species were selected from the most closely

related eusporangiate clades, namely horsetail and marattioid ferns (Pryer & al., 2001a, 2004;

Schuettpelz & al., 2006; Wikström & Pryer, 2005).

DNA isolation, amplification, and sequencing. Due to the scale of this study, there was

some variation in the protocol used to obtain new DNA sequences for analysis. However,

deviations from the general protocol described here were minimal and generally insignificant.

8

Genomic DNA was extracted from silica-dried material using the DNeasy Plant Mini Kit

(Qiagen). Dry leaf tissue (≤ 20 mg) was sealed in a microcentrifuge tube with approximately 50

0.7 mm zirconia beads (BioSpec Products) and frozen in liquid nitrogen. After 10 minutes, the

sealed tubes were removed from the liquid nitrogen, placed in a Mini-BeadBeater-8 (BioSpec

Products), and “beaten” for 10 sec at maximum speed. Lysis buffer and RNase were added

directly to the tube (beads were not removed) and the tubes were incubated at 65˚C for 30 min.

Extraction then proceeded following the manufacturer’s protocol, including the recommended 5

min lysate centrifugation and performing two 50 µl elutions into the same microcentrifuge tube.

For each species, three protein-coding plastid genes (rbcL, atpB, atpA) were separately

amplified using the polymerase chain reaction (PCR). Each 25 µl reaction incorporated 1X PCR

buffer IV containing MgCl2 (ABgene), 200 µM each dNTP, 100 µg/ml BSA, 50 U/ml Taq

polymerase, 0.5 µM each primer (see Table 3 for amplification primers used routinely for each

gene), and 1 µl template DNA eluate. For rbcL and atpB amplifications, thermocycling programs

entailed an initial denaturation step (94˚C for 5 min) followed by 35 denaturation, annealing, and

elongation cycles (94˚C for 1 min, 45˚C for 1 min, 72˚C for 2 min) and a final elongation step

(72˚C for 10 min). For atpA amplifications, cycle elongations were increased to 3 min. PCR

products were purified using Montage PCR Centrifugal Filter Devices (Millipore).

Sequencing of the cleaned PCR products employed the BigDye Terminator v3.1 Cycle

Sequencing Kit (Applied Biosystems). Each 10 µl reaction incorporated 0.375X BigDye

Terminator Ready Reaction Mix (Applied Biosystems), 0.625X BigDye Terminator Sequencing

Buffer (Applied Biosystems), 1 µM primer (see Table 3 for sequencing primers used routinely for

each gene), and 2 µl purified PCR product. Thermocycling and purification followed the

manufacturer’s protocol. Sample electrophoresis and analysis were performed using an ABI

Prism 3700 DNA Analyzer (Applied Biosystems). The multiple sequencing reads obtained as

chromatograms from each individual purified PCR product (i.e., the reads obtained from each

9

gene, from each species) were assembled and edited separately using Sequencher 4.5 (Gene

Codes Corporation). All consensus sequences (784 newly obtained) were subsequently deposited

in GenBank (Table 2).

Sequence alignment and phylogenetic analysis. The consensus sequences for each

gene were manually aligned using MacClade 4.08 (Maddison & Maddison, 2005). The extreme

5’ and 3’ ends of the rbcL and atpB alignments containing copious amounts of missing data were

removed, as were the unalignable non-coding regions amplified with the atpA gene (Schuettpelz

& al., 2006) and the terminal 5’ and 3’ ends of the atpA gene itself.

The three single-gene datasets and the combined three-gene dataset were

phylogenetically analyzed using RAxML-VI-HPC 2.2.1 (Randomized Axelerated Maximum

Likelihood for High Performance Computing; Stamatakis, 2006). All analyses utilized the

GTRMIX model of nucleotide substitution and the rapid hill-climbing algorithm; in the combined

analysis, model parameters were estimated and optimized separately for each gene. Each analysis

comprised 1000 alternative runs from distinct randomized maximum parsimony starting trees. To

assess branch support, non-parametric bootstrap analyses (with 1000 replicates) were conducted

using RAxML-VI-HPC.

Results

Single-gene datasets. The portions of the rbcL, atpB, and atpA genes analyzed in this

study comprised 1308, 1278, and 1506 bp respectively (Table 4). All three of these datasets were

essentially complete, but there was some variation in their information content. The atpA dataset

contained a considerably greater number—and a slightly higher percentage—of variable

characters than the rbcL dataset, which in turn offered an improvement over the atpB dataset.

10

Maximum likelihood analyses of the three single-gene datasets resulted in largely

congruent topologies (trees not presented), with conflicting resolutions almost always lacking

good bootstrap support (i.e., ≥ 70%; the seven inconsequential exceptions were only marginally

well-supported). The differences in phylogenetic signal among the datasets were reflected in the

robustness of resolved relationships; the atpA, rbcL, and atpB datasets provided bootstrap support

≥ 70% for 249, 229, and 222 nodes, respectively (Table 4).

Combined three-gene dataset. The combined dataset comprised 4092 characters, of

which 2422 were variable. Analysis of these data resulted in a robust assessment of fern

relationships (Figure 1). Of the 402 nodes resolved in the 405-taxon analysis, 322 nodes (80%)

were supported by a bootstrap percentage ≥ 70 (Table 4).

Discussion

Although the primary objective of my study was to provide a solid and balanced

framework for future analyses of fern evolution and diversification, the resulting phylogeny also

fills an important gap in our understanding of fern relationships. To date, the bulk of

phylogenetic research in ferns has focused on rather recent divergences, examining evolutionary

patterns within specific clades. A few studies have focused on the deepest divergences,

uncovering the associations of the most fundamental lineages. What were missing, for the most

part, were studies aimed at connecting the dots, determining the composition of more recently

emerging clades and their relationships to one another. The scope of my analysis provides such a

link, and in the following paragraphs I provide an overview of relationships at this level. In

general, I avoid discussion of the finest scale relationships—especially in groups where

considerable work has already been conducted. Instead, I direct the reader to the more densely

sampled studies. It should be noted that my results, in large part, have already been incorporated

11

into a modern revision of fern classification (Smith & al., 2006b); therefore, this classification

(followed below) is consistent with my phylogeny, with only a few exceptions.

Early leptosporangiate divergences (Figure 1a). The earliest divergences within the

leptosporangiate ferns (labeled “le” in Figure 1a), as resolved in this study, are in full agreement

with those resolved in previous three-gene analyses (Pryer & al., 2001a, 2004; Schneider & al.,

2004c; Schuettpelz & al., 2006; Wikström & Pryer, 2005; Wolf, 1996). The osmundaceous ferns

(of, Figure 1a) are well-supported as sister to all other leptosporangiates (bootstrap support, BS =

100%). This position is consistent with the fossil record because the oldest leptosporangiate

fossils assignable to an extant lineage are members of this clade (Galtier & al., 2001; Miller,

1971; Phipps & al., 1998; Rößler & Galtier, 2002; Tidwell & Ash, 1994). Osmundaceous ferns

are placed in a single family, Osmundaceae (Osm, Figure 1a; Smith & al., 2006b). The

intrafamilial relationships I resolve—with Osmunda cinnamomea sister to Leptopteris and

Todea—are in agreement with more densely-sampled studies (Yatabe & al., 1999), although the

likely paraphyly of Osmunda is not reflected here because only one species was sampled from

this relatively small genus.

The filmy ferns (ff), composing a single large family (Hymenophyllaceae; Hym) and the

gleichenioid ferns (gl), with three smaller families (Dipteridaceae, Matoniaceae, and

Gleicheniaceae; Dip, Mat, and Gle, respectively) are both clearly monophyletic (BS = 100%,

86%, respectively, Figure 1a). However, the relationships of these lineages to one another and to

the remaining leptosporangiate ferns are not well-supported.

Within filmy ferns, two clades of roughly equal size are resolved, in agreement with

earlier studies (Pryer & al., 2001b; Schuettpelz & Pryer, 2006). The hymenophylloid clade (hy,

Figure 1a) contains a single genus—Hymenophyllum. The trichomanoid clade (tr, Figure 1a)

comprises eight genera—Abrodictyum, Callistopteris (not sampled here), Cephalomanes,

Crepidomanes, Didymoglossum, Polyphlebium, Trichomanes, and Vandenboschia (Ebihara & al.,

12

2006). Each of these two large filmy fern clades has already been the subject of several more

focused phylogenetic studies (Dubuisson & al., 2003a; Ebihara & al., 2002, 2004, 2006;

Hennequin & al., 2003, 2006a, 2006b); however, because most of these analyses relied on a

single gene, relationships were often unsupported. My three-gene analysis still does not find

strong support within the epiphytic genus Hymenophyllum, but I do find good support (BS ≥

70%) for all relationships among the trichomanoid genera (tr, Figure 1a). From my sampling,

two large trichomanoid subclades emerge, one of which is mostly terrestrial (Abrodictyum,

Cephalomanes, and Trichomanes), the other of which is mostly epiphytic (Crepidomanes,

Didymoglossum, Polyphlebium, and Vandenboschia).

Strong support for the monophyly of the gleichenioid ferns (gl, Figure 1a) has only

recently been obtained (Schuettpelz & al., 2006), although earlier morphological (Jarrett, 1980)

and molecular (Hasebe & al., 1995; Pryer & al., 2004) data suggested it. My current analysis

corroborates this hypothesis, and also supports the monophyly of each of the three included

families (BS = 100%, Figure 1a). Dipteridaceae (Dip) is sister to Matoniaceae (Mat); together,

these are sister to the Gleicheniaceae (Gle).

The schizaeoid ferns (sh, Figure 1a) are well supported (BS = 99%) as sister to the so-

called “core leptosporangiates” (co, Figure 1a; Pryer & al., 2004), a large clade composed of

heterosporous (hf), tree (tf), and polypod (po) ferns (Figure 1a). The schizaeoids are clearly

monophyletic (BS = 100%) and compose three morphologically and molecularly distinct families

(Figure 1a): Lygodiaceae (Lyg), Schizaeaceae (Sch), and Anemiaceae (Ane). The relationships

resolved here, both among and within these families, are in agreement with earlier analyses (Skog

& al., 2002; Wikström & al., 2002).

The heterosporous, or water, ferns (hf, Figure 1a) comprise two families. The

Salviniaceae (Sal) consists of two free-floating genera: Azolla and Salvinia. The Marsileaceae

(Mar) consists of three genera, all of which are rooted in the soil: Marsilea, Pilularia, and

13

Regnellidium (not sampled here). These ferns have been the focus of several recent and ongoing

phylogenetic studies that have addressed their relationships in greater detail (Metzgar & al., 2007;

Nagalingum & al., 2007; Pryer, 1999; Reid & al., 2006).

The tree ferns (tf, Figure 1a), are well-supported as monophyletic here (BS = 97%) and in

other molecular analyses (Korall & al., 2006b; Pryer & al., 2001a, 2004; Schuettpelz & al., 2006;

Wikström & Pryer, 2005), but are lacking an obvious morphological synapomorphy. Many

species do indeed have trunk-like stems, but this character is not ubiquitous throughout the clade.

The phylogeny of these ferns was recently examined by Korall & al. (2006b), and the branching

pattern I recover (Figure 1a) is in agreement with their results. The Culcitaceae (Cul),

Loxomataceae (Lox), Plagiogyriaceae (Pla), and Thyrsopteridaceae (Thy) together form a clade,

as do the Cibotiaceae (Cib), Cyatheaceae (Cya), Dicksoniaceae (Dic), and Metaxyaceae (Met).

Within the large scaly tree fern clade (sc, Figure 1a; note that this clade is equivalent to

Cyatheaceae), four primary subclades emerge: Sphaeropteris, Cyathea (with Hymenophyllopsis

embedded within it), and two distinct Alsophila clades (Korall & al., 2007; but see Conant & al.,

1995, 1996).

Although not always thought to form a natural group, the polypod ferns (po, Figure 1a),

have received solid support in all recent analyses (Pryer & al., 2001a, 2004; Schneider & al.,

2004c; Schuettpelz & al., 2006; Wikström & Pryer, 2005), and in my analysis as well (BS =

100%, Figure 1a). This clade is united by an unequivocal morphological synapomophy—

sporangia each with a vertical annulus interrupted by the stalk (see Figure 7c in Pryer & al.,

1995).

Early polypod divergences (Figure 1b). The much smaller of the two clades arising

from the first divergence within the polypods contains the lindsaeoid ferns (li, Figure 1b) and a

few rather enigmatic fern genera; two (Lonchitis and Saccoloma) were traditionally placed in the

Dennstaedtiaceae, and one (Cystodium) was traditionally placed in the Dicksoniaceae, a tree fern

14

family. In my analysis, these ferns together form a well-supported clade (BS = 74%), but one

that has not been recovered, in its entirety, in previous analyses (Hasebe & al., 1995; Korall & al.,

2006a; Pryer & al., 2004; Schneider & al., 2004c; Schuettpelz & al., 2006; Wolf & al., 1994;

Wolf, 1995). In the most recent classification (Smith & al., 2006b), this clade is divided into two

families (Figure 1b), Saccolomataceae (Sac) and Lindsaeaceae (Lin). The former comprises only

the genus Saccoloma; the latter includes eight genera (Ormoloma, Tapeinidium, and Xyropteris

were not sampled here).

The remaining polypods compose three well-supported clades (BS = 100%, Figure 1b):

the small dennstaedtioid clade (de), the large pteroid clade (pt), and the hyperdiverse eupolypod

fern clade (eu). Unfortunately, the relationships among these three lineages are unclear. Within

the dennstaedtioids (de, Figure 1b), two approximately equally diverse subclades emerge. This

result is in agreement with earlier phylogenentic studies of the group (Wolf, 1995; Wolf & al.,

1994). In these studies, and in my analysis, the genus Dennstaedtia is strongly supported (BS =

100%) as paraphyletic.

The pteroids (pt) account for roughly 10% of extant fern diversity. In my analysis I

resolve five primary clades (Figure 1b), which is in agreement with a recent molecular

phylogenetic study focused specifically on pteroid relationships (Schuettpelz & al., 2007):

cryptogrammoids (cr), ceratopteridoids (ce), pteridoids (pd), cheilanthoids (ch), and adiantoids

(ad). The vittarioid ferns (vi) are apparently embedded within the genus Adiantum (BS = 84%).

The finer-scale relationships within most of these groups have already been addressed in earlier

studies (Crane & al., 1995; Gastony & Rollo, 1995, 1998; Nakazato & Gastony, 2003; Sánchez-

Baracaldo, 2004; Zhang & al., 2005).

Initial eupolypod divergence (Figure 1c). Within the eupolypod ferns (eu), two large

clades are resolved, dubbed “eupolypods I” and “eupolypods II” (Schneider & al., 2004c). This

split is well-supported by molecular data (BS = 100%, e1 and e2, Figure 1c), but also by a

15

frequently overlooked morphological character, namely the vasculature of the petiole.

Eupolypods I (e1) have three or more vascular bundles (with the exception of the diminutive

grammitid ferns with one, and the genus Hypodematium with two); whereas eupolypods II (e2)

have only two (with the exception of the well-nested blechnoid ferns with three or more).

Divergences within eupolypods II (Figure 1c). The eupolypods II (e2) consists of

several large well-supported clades with a number of small genera interspersed among them

(Figure 1c). Together, Cystopteris and Gymnocarpium are sister to the rest of eupolypods II;

Hemidictyum is sister to the asplenioid ferns (as); and Woodsia is sister to a large clade of

onocleoid (on), blechnoid (bl), and athyrioid (at) ferns (Figure 1c). Smith & al. (2006b)

tentatively placed all four of these genera in the Woodsiaceae (Woo, Figure 1c). Now, however,

it seems clear that this circumscription is paraphyletic, and the recognition of several additional

families may well be warranted.

The athyrioid ferns (at, Figure 1c), which account for most of the diversity in the

Woodsiaceae, are indeed monophyletic (BS = 96%). The phylogeny of these ferns was the

subject of two recent studies (Sano & al., 2000; Wang & al., 2003), and my results are in general

accord with theirs. My three-gene analysis does, however, find strong support (≥ 70%) for the

fundamental splits within the clade (e.g., Deparia as sister to the remaining athyrioids) that were

not well-supported in earlier single-gene analyses. The large genus Athyrium is not monophyletic

(BS = 87%, Figure 1c), but Diplazium as currently circumscribed may well be (but see Wang &

al., 2003).

The asplenioid ferns (as, Figure 1c) are also strongly supported as monophyletic in my

analyses (BS = 100%), as they have been in earlier studies (Gastony & Johnson, 2001; Murakami

& al., 1999; Murakami & Schaal, 1994; Perrie & Brownsey, 2005; Pinter & al., 2002; Schneider

& al., 2004b, 2005). These earlier studies clearly demonstrated that nearly all genera previously

segregated from Asplenium (e.g., Camptosorus, Diellia, and Loxoscaphe) nest well within this

16

large genus. Thus, in the most recent classification (Smith & al., 2006b) only two genera were

recognized in the Aspleniaceae (Asp)—Hymenasplenium being sister to Asplenium (Figure 1c).

The thelypteroid ferns (th, Figure 1c) compose a well-supported clade within eupolypods

II (BS = 100%) and are recognized as a large family (Thelypteridaceae) with five genera by

Smith & al. (2006b). In my study, the three smaller genera (Macrothelypteris, Phegopteris, and

Pseudophegopteris) form a clade sister to the two larger genera (Cyclosorus and Thelypteris;

note, however, that all species potentially assignable to Cyclosorus are presented here under

Thelypteris to circumvent a variety of nomenclatural issues). The relationships I uncover within

this larger clade are generally in agreement with those found in the only other study to examine

thelypteroid phylogeny (Smith & Cranfill, 2002). In the earlier study, Thelypteris (sensu Smith,

1990) was not resolved as monophyletic; here, it is definitively paraphyletic to the cyclosoroids

(BS = 100%, cs, Figure 1c). Although my results do support the monophyly of several

subgeneric groupings (e.g., Amauropelta and Goniopteris, not shown; Smith, 1990), I find strong

support for the polyphyly of at least one of these groups—subgenus Pronephrium (T. affine, T.

simplex, and T. sp. in Figure 1c). Clearly, the thelypteroid clade is in need of additional

phylogenetic study.

The onocleoid ferns (on, Figure 1c), including Onoclea and three other small genera not

sampled here (Gastony & Ungerer, 1997; Smith & al., 2006b), are sister to a larger blechnoid

clade (bl, Figure 1c) that was the subject of three recent studies (Cranfill, 2001; Cranfill & Kato,

2003; Nakahira, 2000). My results are in general accord with their more densely-sampled

analyses: Blechnum is definitely not monophyletic (BS = 98%) and blechnoid taxonomy requires

further attention.

Divergences within eupolypods I (Figure 1d–e). Three genera not traditionally thought

to be closely related to one another form a small, but poorly supported clade sister to the rest of

eupolypods I (Figure 1d). In earlier classifications (e.g., Kramer & al., 1990), Didymochlaena

17

was considered to be associated with the dryopteroid ferns (dr, Figure 1d); Hypodematium with

the athyrioid ferns (at, Figure 1c); and Leucostegia among the davallioid ferns (da, Figure 1e).

Previous studies found these genera to be rather isolated (Hasebe & al., 1995; Schneider & al.,

2004c; Tsutsumi & Kato, 2006), but all three were never included in the same analysis as they are

here. My finding of good support (BS = 84%) for the monophyly of the remaining eupolypods

I—excluding Didymochlaena, Hypodematium, and Leucostegia—is the first convincing evidence

that these three genera should indeed be segregated from the Dryopteridaceae, where they were

tentatively placed by Smith & al. (2006b), because they render it paraphyletic (Figure 1d).

The dryopteroid ferns (dr) form a very large (about 1700 species total) and well-

supported clade (BS = 100%), with most “former lomariopsid” genera (fl) nested within it (Figure

1d). Notably absent from the dryopteroid clade, however, is the genus Lomariopsis itself, which

is resolved elsewhere in the eupolypods I clade (Figure 1e). This suggests that the distinctive

rhizome anatomy (with an elongated ventral meristele) characteristic of lomariopsid ferns has

apparently evolved at least twice. While some large genera in the dryopteroid clade are the focus

of extensive and ongoing phylogenetic studies (e.g., Polystichum, Dryopteris, and

Elaphoglossum), other genera and the overall phylogeny of the group have received little or no

attention (but see Li & Lu, 2006). My analysis therefore provides considerable insight into the

phylogeny of these ferns (despite relatively poor support for some early divergences).

The well-studied genera Dryopteris (Geiger & Ranker, 2005) and Polystichum (Li & al.,

2004; Little & Barrington, 2003) compose a large well-supported clade together with

Phanerophlebia, Cyrtomium, and Arachnioides (BS = 97%, Figure 1d). The genus

Polystichopsis—which is often synonymized under Arachniodes (e.g., Kramer & al., 1990)—is,

however, not closely related to this clade. Rather, it is sister to a clade of “dimorphic climbers”—

dryopteroid genera with creeping (to climbing) stems and dimorphic leaves (dc, Figure 1d).

Stigmatopteris, as well as Ctenitis, are both rather isolated within the dryopteroid clade, but

18

Megalastrum (a relatively recent segregate of Ctenitis; Holttum, 1986) forms a clade with

Rumohra and the paraphyletic genus Lastreopsis. This clade is in turn sister to the “former

lomariopsid” genera (fl, Figure 1d), within which Bolbitis is resolved as polyphyletic. The

relationships I resolve within the large genus Elaphoglossum are in general agreement with those

from recent studies (Rouhan & al., 2004; Skog & al., 2004).

Within the eupolypods I, Nephrolepis, Cyclopeltis, and Lomariopsis also form a clade

(Figure 1e). Although this assemblage has not been resolved previously in its entirety (see

Tsutsumi & Kato, 2006), and is in fact poorly-supported here, its monophyly is reinforced by a

morphological synapomorphy—specifically the presence of articulate pinnae. This clade is

tentatively recognized as the Lomariopsidaceae in the most recent classification (Smith & al.,

2006b). The oleandroid ferns, on the other hand, were thought to compose a natural group

(Kramer, 1990) but are resolved here as definitively not monophyletic. I find strong support (BS

= 75%) for Arthropteris and Psammiosorus as sister to the tectarioid ferns (te, Figure 1e), and

they are now included in the Tectariaceae (Tec, Figure 1e; Smith & al., 2006b). Oleandra itself

is sister to a large clade of davallioid (da) and polygrammoid (pg) ferns (BS = 96, Figure 1e), and

is now considered to be the sole genus in Oleandraceae (Smith & al., 2006b).

The phylogeny of davallioid and polygrammoid ferns has been extremely well-studied in

recent years (Haufler & al., 2003; Janssen & Schneider, 2005; Kreier & Schneider, 2006a, 2006b;

Ranker & al., 2003, 2004; Schneider & al., 2002, 2004a, 2004d, 2006a, 2006b; Tsutsumi & Kato,

2005, 2006), and the relationships I resolve within these clades are generally consistent with those

resolved in earlier studies. As previously determined, the grammitid ferns (gr, Figure 1e;

Grammitidaceae sensu Parris, 1990) are nested firmly within the Polypodiaceae sensu Hennipman

& al. (1990). Here I find strong support for the newly described genus Serpocaulon (Smith & al.,

2006a) as sister to the grammitid clade (Figure 1e).

19

Conclusions. My three-gene analysis of 400 leptosporangiate species has resulted in by

far the most comprehensive and well-supported assessment of fern phylogeny to date, providing

an unparalleled framework within which to explore large-scale evolutionary patterns. However,

with less than perfect levels of branch support and with more than 25% of fern genera and 95% of

fern species still unaccounted for, it is clear that much work remains to be done. I have identified

here several areas within the leptosporangiate fern phylogeny that are in need of further study.

By continuing to include more taxa and additional data we will be able to move even closer to a

full understanding of fern evolution and diversification.

20

Table 2. Taxonomic sampling and voucher information for my study of leptosporangiate fern phylogeny. Fern DNA Database record numbers (www.biology.duke.edu/pryerlab/ferndb; #NA = not available), voucher (collector, collection number, herbarium, locality) or publication information, and GenBank accession numbers are provided for sequences utilized (rbcL, atpB, and atpA, listed respectively). Species are arranged alphabetically under families recognized in the most recent classification of extant ferns (Smith & al., 2006b; Figure 1).

Anemiaceae: Anemia adiantifolia (L.) Sw., #NA, Wikström & al., 2002, AJ303395, #2502, Horn 507 (DUKE), Florida, U.S.A., EF463320, EF463583; A. phyllitidis (L.) Sw., #NA, Wikström & al., 2002, AJ303391, #3, Pryer & al., 2004, AY612687, Lankester s.n. (UC), Costa Rica, EF463584; A. rotundifolia Schrad., #3567, Schuettpelz 512 (GOET), in cultivation, EF463140, EF463321, EF463585; A. tomentosa (Savigny) Sw., #3568, Schuettpelz 513 (GOET), in cultivation, EF463141, EF463322, EF463586; Aspleniaceae: Asplenium abscissum Willd., #3553, Jimenez 2503 (LPB), Bolivia, EF463142, EF463323, EF463587; A. adiantum-nigrum L., #3125, Schuettpelz 418 (DUKE), Arizona, U.S.A., EF463143, EF463324, EF463588; A. affine Sw., #3554, Janssen 2719 (P), Reunion, EF463144, EF463325, EF463589; A. alatum Humb. & Bonpl. ex Willd., #2425, Schuettpelz 257 (DUKE), Ecuador, EF463145, EF463326, EF463590; A. auritum Sw., #3482, Schneider s.n. (GOET), in cultivation, EF463146, EF463327, EF463591; A. contiguum Kaulf., #3483, Ranker 1876 (COLO), Hawaii, U.S.A., EF463147, EF463328, EF463592; A. feei Kunze ex Fée, #NA, Pinter & al., 2002, AF525267, #3478, Lemieux 2272 (COLO), Costa Rica, EF463329, EF463593; A. foreziense Legrand ex Hérib., #3591, Schuettpelz 536 (GOET), in cultivation, EF463148, EF463330, EF463594; A. formosae H. Christ, #3484, Ranker 2071 (COLO), Taiwan, EF463149, EF463331, EF463595; A. harpeodes Kunze, #3464, Schneider s.n. (GOET), in cultivation, EF463150, EF463332, EF463596; A. juglandifolium Lam., #3465, Schneider s.n. (GOET), in cultivation, EF463151, EF463333, EF463597; A. marinum L., #NA, Pinter & al., 2002, AF240647, #2952, Christenhusz 3724 (TUR), Scotland, U.K., EF463334, EF463598; A. monanthes L., #NA, Schneider & al., 2004b, AY300125, #3552, Lemieux 2324 (COLO), Costa Rica, EF463335, EF463599; A. nidus L., #NA, Pinter & al., 2002, AF525270, #11, Fischer T-9 (UC), Madagascar, EF463336, EF463600; A. normale D. Don, #3466, Ranker 2008 (COLO), Taiwan, EF463152, EF463337, EF463601; A. planicaule Lowe, #3467, Ranker 2085 (COLO), Taiwan, EF463153, EF463338, EF463602; A. platyneuron (L.) Britton, Sterns & Poggenb., #NA, Pinter & al., 2002, AF525272, #3040, Schuettpelz 396 (DUKE), in cultivation, EF463339, EF463603; A. praemorsum Sw., #3578, Schuettpelz 523 (GOET), in cultivation, EF463154, EF463340, EF463604; A. pteropus Kaulf., #3468, Ranker 1843 (COLO), Costa Rica, EF463155, EF463341, EF463605; A. rigidum Sw., #3469, Lemieux 2277 (COLO), Costa Rica, EF463156, EF463342, EF463606; A. ritoense Hayata, #NA, Murakami & al., 1999, AB014692, #3479, Ranker 2063 (COLO), Taiwan, EF463343, EF463607; A. ruta-muraria L., #NA, Pinter & al., 2002, AF525273, #2947, Christenhusz 3869 (TUR), Scotland, U.K., EF463344, EF463608; A. sandersonii Hook., #NA, Pinter & al., 2002, AF525274, #3574, Schuettpelz 519 (GOET), in cultivation, EF463345, EF463609; A. scolopendrium L., #NA, Pinter & al., 2002, AF240645, #2945, Christenhusz 3867 (TUR), Scotland, U.K., EF463346, EF463610; A. tenerum G. Forst., #NA, Schneider & al., 2004b, AY300145, #3480, Ranker 1964 (COLO), Moorea, EF463347, EF463611; A. theciferum (Kunth) Mett., #NA, Gastony & Johnson, 2001, AF336099, #2426, Schuettpelz 258 (DUKE), Ecuador, EF463348, EF463612; A. trichomanes L., #3129, Schuettpelz 422 (DUKE), Arizona, U.S.A., EF463157, EF463349, EF463613; Hymenasplenium cheilosorum (Kunze ex Mett.) Tagawa, #NA, Murakami & al., 1999, AB014704, #3529, Schäfer 55 (GOET), Yunnan, China, EF463350, EF463614; H. unilaterale (Lam.) Hayata, #3470, Schuettpelz & al., 2007, EF452140, EF452020, EF452078; Blechnaceae: Blechnum gracile Kaulf., #2553, Schuettpelz 293 (DUKE), in

21

cultivation, EF463158, EF463351, EF463615; B. occidentale L., #67, Wolf & al., 1994, U05910, Wolf, 1997, U93838, Schuettpelz & al., 2007, EF452080; B. polypodioides Raddi, #2554, Schuettpelz 294 (DUKE), in cultivation, EF463159, EF463352, EF463616; B. schomburgkii (Klotzsch) C. Chr., #2410, Schuettpelz 242 (DUKE), Ecuador, EF463160, EF463353, EF463617; B. spicant (L.) Sm., #NA, Nakahira & Kato, unpublished, AB040571, #3212, Christenhusz 3874 (TUR), Netherlands, EF463354, EF463618; Doodia media R. Br., #70, Wolf & al., 1994, U05922, #2555, Schuettpelz 295 (DUKE), in cultivation, EF463355, EF463619; Sadleria cyatheoides Kaulf., #3432, Schuettpelz 507 (DUKE), in cultivation, EF463161, EF463356, EF463620; Salpichlaena volubilis (Kaulf.) J. Sm., #3256, Christenhusz 3949 (TUR), Guadeloupe, EF463162, EF463357, EF463621; Stenochlaena tenuifolia (Desv.) Moore, #3429, Schuettpelz 504 (DUKE), in cultivation, EF463163, EF463358, EF463622; Woodwardia virginica (L.) Sm., #NA, Cranfill & Kato, unpublished, AY137660, #2632, Christenhusz 3810 (DUKE), North Carolina, U.S.A., EF463359, EF463623; Cibotiaceae: Cibotium schiedei Schltdl. & Cham., #2481, Korall & al., 2006b, AM177331, AM176593, Morter 4 (E), in cultivation, EF463624; Culcitaceae: Culcita coniifolia (Hook.) Maxon, #2363, Korall & al., 2006b, AM177333, AM176595, Conant 4405 (LSC), Costa Rica, EF463625; Cyatheaceae: Alsophila bryophila R. Tryon, #2304, Korall & al., 2006b, AM177320, AM176581, Conant 4322 (LSC), Puerto Rico, EF463626; A. capensis (L. f.) J. Sm., #2326, Korall & al., 2006b, AM177321, AM176582, Shirley 14 (LSC), Africa, EF463627; A. colensoi Hook. f., #2329, Korall & al., 2006b, AM177322, AM176583, Shirley 1 (LSC), New Caledonia, EF463628; A. cuspidata (Kunze) D. S.Conant, #2334, Korall & al., 2006b, AM177323, AM176584, Conant 4427 (LSC), Costa Rica, EF463629; A. dregei (Kunze) R. M. Tryon, #2325, Korall & al., 2007, AM410194, Shirley 13 (LSC), Africa, EF463360, EF463630; A. foersteri (Rosenst.) R. M. Tryon, #2337, Korall & al., 2006b, AM177324, AM176585, Conant 4646 (LSC), Papua New Guinea, EF463631; A. hooglandii (Holtt.) R. M. Tryon, #2315, Korall & al., 2006b, AM177325, AM176586, Conant 4650 (LSC), Papua New Guinea, EF463632; A. ramispina Hook., #2335, Korall & al., 2006b, AM177326, AM176587, Conant 4706 (LSC), Borneo, EF463633; A. salvinii Hook., #2306, Korall & al., 2007, AM410184, Conant 4365 (LSC), Honduras, EF463361, EF463634; A. stelligera (Holtt.) R. M. Tryon, #2338, Korall & al., 2007, AM410198, Pintaud 411 (LSC), New Caledonia, EF463362, EF463635; Cyathea alata (E. Fourn.) Copel., #2328, Pintaud 414 (LSC), New Caledonia, EF463164, EF463363, EF463636; C. horrida (L.) Sm., #2331, Korall & al., 2007, AM410196, Conant 4343 (LSC), Puerto Rico, EF463364, EF463637; C. multiflora Sm., #2333, Korall & al., 2007, AM410197, Conant 4425 (LSC), Costa Rica, EF463365, EF463638; C. parvula (Jenm.) Proctor, #2330, Korall & al., 2006b, AM177338, AM176600, Conant 4332 (LSC), Puerto Rico, EF463639; C. poeppigii (Hook.) Domin, #80, Pryer & al., 2001a, AF313585, AF313553, #2367, Conant 4410 (LSC), Costa Rica, EF463640; Hymenophyllopsis dejecta (Baker) Goebel, #397, Wolf & al., 1999, AF101301, Pryer & al., 2004, AY612698, Milleron s.n. (UC), Venezuela, EF463641; Sphaeropteris capitata (Copel.) R. M. Tryon, #2321, Korall & al., 2007, AM410192, Conant 4710 (LSC), Borneo, EF463366, EF463642; S. celebica (Blume) R. M. Tryon, #2327, Korall & al., 2007, AM410195, Shirley 02 (LSC), Australia, EF463367, EF463643; S. horrida (Liebm.) R. M. Tryon, #2340, Korall & al., 2007, AM410200, Conant 4363 (LSC), Honduras, EF463368, EF463644; S. medullaris (Forst. f.) Bernh., #2323, Korall & al., 2006b, AM177350, AM176617, Shirley 07 (LSC), New Zealand, EF463645; S. megalosora (Copel.) R. M. Tryon, #2319, Korall & al., 2007, AM410190, Conant 4702 (LSC), Borneo, EF463369, EF463646; S. robusta (Watts) R. M. Tryon, #2316, Korall & al., 2007, AM410187, Conant 4663 (LSC), Lord Howe Island, Australia, EF463370, EF463647; Davalliaceae: Araiostegia hymenophylloides (Blume) Copel., #NA, Tsutsumi & Kato, 2005, AB212689, AB212689, #3739, Huiet s.n. (UC), in cultivation, EF463648; Davallia griffithiana Hook., #3431, Schuettpelz 506 (DUKE), in cultivation, EF463165, EF463371, EF463649; D. solida (G. Forst.) Sw., #NA, Tsutsumi & Kato, 2005, AB212712, #2560, Schuettpelz & al., 2007,

22

EF452029, EF452089; Davallodes borneense (Hook.) Copel., #NA, Tsutsumi & Kato, 2005, AB212694, AB212694, #3615, Schuettpelz 560 (GOET), in cultivation, EF463650; Dennstaedtiaceae: Blotiella pubescens (Willd. ex Kaulf.) R. M. Tryon, #88, Wolf & al., 1994, U05911, Strasberg s.n. (UTC), Reunion, EF463372, EF463651; Dennstaedtia dissecta (Sw.) T. Moore, #2465, Schuettpelz 9 (DUKE), Costa Rica, EF463166, EF463373, EF463652; D. punctilobula (Michx.) T. Moore, #99, Wolf & al., 1994, U05918, Wolf, 1997, U93836, Schuettpelz & al., 2007, EF452090; Histiopteris incisa (Thunb.) J. Sm., #102, Wolf & al., 1994, U05926, Smith s.n. (UC), in cultivation, EF463374, EF463653; Hypolepis tenuifolia (G. Forst.) Bernh., #2547, Schuettpelz 286 (DUKE), in cultivation, EF463167, EF463375, EF463654; Leptolepia novae-zelandiae (Col.) Mett. ex Diels, #3061, Parris 12400 (DUKE), New Zealand, EF463168, EF463376, EF463655; Microlepia platyphylla (D. Don) J. Sm., #114, Wolf, 1995, U18642, Wolf, 1997, U93832, Schuettpelz & al., 2007, EF452101; M. speluncae (L.) T. Moore, #2550, Schuettpelz 289 (DUKE), in cultivation, EF463169, EF463377, EF463656; Monachosorum henryi H. Christ, #478, Wolf & al., 1994, U05932, Pryer & al., 2004, AY612706, Korall & al., 2006b, AM176469; Paesia scaberula (A. Rich) Kuhn, #119, Wolf & al., 1994, U05937, Wolf 387 (UTC), in cultivation, EF463378, EF463657; Pteridium esculentum (G. Forst.) Nakai, #125, Wolf & al., 1994, U05940, #NA, Wolf, 1997, U93834, #125, Schuettpelz & al., 2007, EF452115; Dicksoniaceae: Calochlaena villosa (C. Chr.) M. D. Turner & R. A. White, #2254, Korall & al., 2006b, AM177327, AM176588, Woodhaus s.n. (AAU), in cultivation, EF463658; Dicksonia antarctica Labill., #134, Wolf & al., 1994, U05919, Wolf, 1997, U93829, Wolf 276 (UTC), in cultivation, EF463659; Lophosoria quadripinnata (J. F. Gmel.) C. Chr., #424, Wolf & al., 1999, AF101303, Pryer & al., 2004, AY612701, Grantham 006-92 (UC), Chile, EF463660; Dipteridaceae: Cheiropleuria integrifolia (D. C. Eaton ex Hook.) M. Kato, Y. Yatabe, Sahashi & N. Murak., #NA, Kato & al., 2001, AB042569, #75, Pryer & al., 2004, AY612692, Yokoyama 27619 (TI), Japan, EF463661; Dipteris conjugata Reinw., #141, Hasebe & al., 1994, U05620, #140, Pryer & al., 2004, AY612696, Game 98/106 (UC), Fiji, EF463662; Dryopteridaceae: Arachniodes aristata (G. Forst.) Tindale, #NA, Geiger & Ranker, 2005, AY268851, #3613, Schuettpelz 558 (GOET), in cultivation, EF463379, EF463663; A. denticulata (Sw.) Ching, #NA, Little & Barrington, 2003, AF537223, #3502, Barrington 2130 (VT), Costa Rica, EF463380, EF463664; Bolbitis auriculata (Lam.) Alston, #3504, Rakotondrainibe 6611 (P), Comoros, EF463170, EF463381, EF463665; B. nicotianifolia (Sw.) Alston, #3327, Christenhusz 4062 (TUR), Guadeloupe, EF463171, EF463382, EF463666; Ctenitis sloanei (Poepp. ex Spreng.) C. V. Morton, #3607, Schuettpelz 552 (GOET), in cultivation, EF463172, EF463383, EF463667; C. sp., #3577, Schuettpelz 522 (GOET), in cultivation, EF463174, EF463385, EF463669; C. submarginalis (Langsd. & Fisch.) Ching, #2464, Schuettpelz 1 (DUKE), Costa Rica, EF463173, EF463384, EF463668; Cyclodium trianae (Mett.) A. R. Sm., #3770, Moran 7466 (NY), Ecuador, EF463175, EF463386, EF463670; Cyrtomium falcatum (L. f.) C. Presl, #2937, Little 342 (VT), in cultivation, EF463176, EF463387, EF463671; Didymochlaena truncatula (Sw.) J. Sm., #NA, Smith & Cranfill, 2002, AF425105, #2435, Schuettpelz & al., 2007, EF452030, EF452091; Dryopteris aemula (Aiton) Kuntze, #NA, Geiger & Ranker, 2005, AY268881, #2944, Schuettpelz & al., 2007, EF452033, EF452094; D. crassirhizoma Nakai, #3036, Schuettpelz 392 (DUKE), in cultivation, EF463177, EF463388, EF463672; D. erythrosora (D.C. Eaton) Kuntze, #3593, Schuettpelz 538 (GOET), in cultivation, EF463178, EF463389, EF463673; D. expansa (C. Presl) Fraser-Jenk. & Jermy, #3496, Christenhusz 4263 (TUR), Finland, EF463179, EF463390, EF463674; D. filix-mas (L.) Schott, #3121, Schuettpelz 414 (DUKE), Arizona, U.S.A., EF463180, EF463391, EF463675; D. goldiana (Hook. ex Goldie) A. Gray, #NA, Little & Barrington, 2003, AF537228, #2938, Barrington 2123 (VT), Vermont, U.S.A., EF463392, EF463676; D. marginalis (L.) A. Gray, #2979, Schuettpelz 334 (DUKE), in cultivation, EF463181, EF463393, EF463677; D. squamiseta (Hook.) Kuntze, #3557, Janssen 2714 (P), Reunion, EF463182, EF463394, EF463678; D.

23

uniformis (Makino) Makino, #3592, Schuettpelz 537 (GOET), in cultivation, EF463183, EF463395, EF463679; Elaphoglossum amygdalifolium (Mett. ex Kuhn) H. Christ, #2673, Moran 6952 (NY), Ecuador, EF463184, EF463396, EF463680; E. andicola (Fée) T. Moore, #2674, Bach 1697 (GOET), Bolivia, EF463185, EF463397, EF463681; E. aubertii (Desv.) T. Moore, #2689, Hemp 8 (E), Tanzania, EF463186, EF463398, EF463682; E. backhousianum T. Moore, #2690, Moran s.n. (NY), in cultivation, EF463187, EF463399, EF463683; E. burchellii (Backer) C. Chr., #NA, Skog & al., 2004, AY818683, #3461, Moran s.n. (NY), in cultivation, EF463400, EF463684; E. crassifolium (Gaudich.) W. R. Anderson & Crosby, #2676, Mickel 9703 (NY), Hawaii, U.S.A., EF463188, EF463401, EF463685; E. crinitum (L.) H. Christ, #2685, Trusty 70 (CR), Costa Rica, EF463189, EF463402, EF463686; E. deltoideum (Sodiro) H. Christ, #2694, Moran 6867 (NY), Ecuador, EF463190, EF463403, EF463687; E. erinaceum (Fée) T. Moore, #2686, Blanco 2231 (USJ), Costa Rica, EF463191, EF463404, EF463688; E. flaccidum (Fée) T. Moore, #2374, Schuettpelz 206 (DUKE), Ecuador, EF463192, EF463405, EF463689; E. herminieri (Bory ex Fée) T. Moore, #2677, Moran s.n. (NY), in cultivation, EF463193, EF463406, EF463690; E. heterolepis (Fée) T. Moore, #2683, Ranker 1414 (COLO), Reunion, EF463194, EF463407, EF463691; E. huacsaro (Ruiz) H. Christ, #2680, Nee 52309 (NY), Dominican Republic, EF463195, EF463408, EF463692; E. hybridum (Bory) Brack., #2687, Motley 2912 (NY), Reunion, EF463196, EF463409, EF463693; E. lechlerianum (Mett.) T. Moore, #2678, Bach 1399 (GOET), Bolivia, EF463197, EF463410, EF463694; E. lingua (C. Presl) Brack., #NA, Skog & al., 2004, AY818697, #3459, Moran 6380 (CR), Costa Rica, EF463411, EF463695; E. lonchophyllum (Fée) T. Moore, #3456, Skog & al., 2004, AY818698, Hammer 9 (NY), Veracruz, Mexico, EF463412, EF463696; E. minutum (Pohl ex Fée) T. Moore, #NA, Skog & al., 2004, AY818699, #3457, Moran 6334 (NY), Costa Rica, EF463413, EF463697; E. moorei (E. Britton) H. Christ, #2696, Bach 1584 (GOET), Bolivia, EF463198, EF463414, EF463698; E. paleaceum (Hook. & Grev.) Sledge, #2681, Moran s.n. (NY), in cultivation, EF463199, EF463415, EF463699; E. papillosum (Baker) H. Christ, #3462, Smith 2873 (NY), unknown, EF463200, EF463416, EF463700; E. peltatum (Sw.) Urb., #2697, Moran s.n. (NY), in cultivation, EF463201, EF463417, EF463701; E. piloselloides (C. Presl) T. Moore, #2691, Labiak 2827 (NY), Bolivia, EF463202, EF463418, EF463702; E. samoense Brack., #2692, Ranker 1907 (COLO), Tahiti, French Polynesia, EF463203, EF463419, EF463703; E. tripartitum (Hook ex Grev.) Mickel, #2698, Moran 6783 (NY), Ecuador, EF463204, EF463420, EF463704; Hypodematium crenatum (Forssk.) Kuhn, #3511, Schneider s.n. (GOET), in cultivation, EF463205, EF463421, EF463705; Lastreopsis effusa (Sw.) Tindale, #2939, Little & Barrington, 2003, AF537230, Howlett s.n. (VT), Costa Rica, EF463422, EF463706; L. glabella (A.Cunn. in Hook.) Tindale, #3635, Schuettpelz 580 (GOET), in cultivation, EF463206, EF463423, EF463707; L. hispida (Sw.) Tindale, #3512, Schneider s.n. (GOET), in cultivation, EF463207, EF463424, EF463708; Leucostegia pallida (Mett.) Copel., #NA, Tsutsumi & Kato, 2006, AB232389, #3652, Schuettpelz 605 (B), in cultivation, EF463425, EF463709; Lomagramma guianensis (Aubl.) Ching, #3416, Christenhusz 4228 (TUR), Puerto Rico, EF463208, EF463426, EF463710; Maxonia apiifolia (Sw.) C. Chr., #3059, Christenhusz 3390 (IJ), Jamaica, EF463209, EF463427, EF463711; Megalastrum biseriale (Baker) A. R. Sm. & R. C. Moran, #3758, Moran 7545 (NY), Ecuador, EF463210, EF463428, EF463712; M. macrotheca (Fée) A. R. Smith & R. C. Moran, #3391, Christenhusz 4181 (TUR), Guadeloupe, EF463211, EF463429, EF463713; M. subincisum (Willd.) A. R. Sm. & R. C. Moran, #3757, Moran 7608 (NY), Ecuador, EF463212, EF463430, EF463714; Olfersia cervina (L.) Kunze, #3342, Christenhusz 4082 (TUR), Guadeloupe, EF463213, EF463431, EF463715; Phanerophlebia nobilis (Schltdl. & Cham.) C. Presl, #2940, Yatskievych 85-211 (IND), Mexico, Mexico, EF463214, EF463432, EF463716; Polybotrya alfredii Brade, #3762, Moran 7612 (NY), Ecuador, EF463215, EF463433, EF463717; Polystichopsis chaerophylloides (Poir.) C. V. Morton, #3413, Christenhusz 4223 (TUR), Puerto Rico, EF463216, EF463434, EF463718; Polystichum eximium

24

(Mett. ex Kuhn) C. Chr., #NA, Li & al., 2004, AY545493, #2928, Barrington 2085 (VT), Yunnan, China, EF463435, EF463719; P. hillebrandii Carruth., #2929, Driscoll 310 (VT), Hawaii, U.S.A., EF463217, EF463436, EF463720; P. lemmonii Underw., #2931, Zika 10741 (VT), Washington, U.S.A., EF463218, EF463437, EF463721; P. munitum (Kaulf.) C. Presl, #NA, Little & Barrington, 2003, AF537261, #2930, Zika 18930 (VT), Washington, U.S.A., EF463438, EF463722; P. setiferum (Forssk.) Moore ex Woyn., #NA, Little & Barrington, 2003, AF537254, #2932, Mickel s.n. (VT), in cultivation, EF463439, EF463723; P. transkeiense N. Jacobsen, #NA, Little & Barrington, 2003, AF537257, #2934, Roux 2493 (VT), Africa, EF463440, EF463724; P. tripteron (Kunze) C. Presl, #2935, Kato s.n. (VT), in cultivation, EF463219, EF463441, EF463725; P. yunnanense H. Christ, #2936, Barrington 2087 (VT), Yunnan, China, EF463220, EF463442, EF463726; Rumohra adiantiformis (G. Forst.) Ching, #157, Wolf & al., 1994, U05942, #2559, Schuettpelz 299 (DUKE), in cultivation, EF463443, EF463727; Stigmatopteris lechleri (Mett.) C. Chr., #3755, Moran 3026 (CR), Costa Rica, EF463221, EF463444, EF463728; S. longicaudata (Liebm.) C. Chr., #2941, Barrington 2099A (VT), Costa Rica, EF463222, EF463445, EF463729; Teratophyllum wilkesianum (Brack.) Holttum, #3723, Murdock 131 (UC), Moorea, French Polynesia, EF463223, EF463446, EF463730; Equisetaceae: Equisetum telmateia Ehrh., #768, Pryer & al., 2001a, AF313580, AF313542, Smith 2575 (UC), California, U.S.A., EF463731; E. x ferrissii Clute, #760, Pryer & al., 2001a, AF313579, AF313541, Hammond s.n. (UC), California, U.S.A., EF463732; Gleicheniaceae: Dicranopteris linearis (Burm. f.) Underw., #167, Wolf, 1995, U18626, #958, Pryer & al., 2004, AY612694, #171, Lorence 7764 (PTBG), Hawaii, U.S.A., EF463733; Diplopterygium bancroftii (Hook.) A. R. Sm., #172, Smith 2569 (UC), Veracruz, Mexico, EF463224, Pryer & al., 2004, AY612695, Smith 2569 (UC), Veracruz, Mexico, EF463734; Gleichenella pectinata (Willd.) Ching, #3425, Christenhusz 4240 (TUR), Puerto Rico, EF463225, #174, Pryer & al., 2004, AY612697, #3425, Christenhusz 4240 (TUR), Puerto Rico, EF463735; Gleichenia dicarpa R. Br., #883, Pryer & al., 2001a, AF313584, AF313550, Cranfill 227 (UC), New Zealand, EF463736; Sticherus bifidus (Willd.) Ching, #176, Smith 2565 (UC), Veracruz, Mexico, EF463226, EF463447, EF463737; S. palmatus (W. Schaffn. ex E. Fourn.) Copel., #177, Pryer & al., 2004, AY612684, AY612711, Smith 2568 (UC), Veracruz, Mexico, EF463738; Stromatopteris moniliformis Mett., #915, Pryer & al., 2004, AY612685, van der Werff 16076 (UC), New Caledonia, EF463448, EF463739; Hymenophyllaceae: Abrodictyum elongatum (A. Cunn.) Ebihara & K. Iwats., #936, Dubuisson & al., 2003a, AY175802, Smith 2604 (UC), New Zealand, EF463449, EF463740; Cephalomanes javanicum (Blume) C. Presl, #900, Dubuisson, 1997, Y09195, Edwards s.n. (MPU), Brunei, EF463450, EF463741; Crepidomanes bipunctatum (Poir.) Copel., #2646, Hennequin 2002-9 (P), Reunion, EF463227, EF463451, EF463742; C. minutum (Blume) K. Iwats., #374, Hasebe & al., 1994, U05625, #2741, Ebihara 001015-03 (TI), Japan, EF463452, EF463743; C. thysanostomum (Makino) Ebihara & K. Iwats., #389, Hasebe & al., 1994, U05608, Hasebe 26549 (TI), Japan, EF463453, EF463744; Didymoglossum ekmanii (Wess. Boer) Ebihara & Dubuisson, #898, Dubuisson, 1997, Y09192, Halle s.n. (MPU), Colombia, EF463454, EF463745; D. krausii (Hook. & Grev.) C. Presl, #2388, Schuettpelz 220 (DUKE), Ecuador, EF463228, EF463455, EF463746; D. membranaceum (L.) Vareschi, #901, Dubuisson, 1997, Y09197, #2652, Dubuisson HG 2004-41 (P), Guadeloupe, EF463456, EF463747; Hymenophyllum apiculatum Mett. ex Kuhn, #864, Pryer & al., 2001b, AF275642, Dubuisson HV1997-23 (F), Venezuela, EF463457, EF463748; H. armstrongii (Baker) Kirk, #939, Hennequin & al., 2003, AY095109, Smith 2610 (UC), New Zealand, EF463458, EF463749; H. baileyanum Domin, #851, Pryer & al., 2001b, AF275643, Streimann s.n. (UC), Queensland, Australia, EF463459, EF463750; H. cruentum Cav., #NA, Hennequin & al., 2003, AY095107, #1049, Kelch 00.123B (UC), Chile, EF463460, EF463751; H. digitatum (Sw.) Fosberg, #820, Pryer & al., 2001b, AF275651, Game 86/08 (UC), Cook Islands, EF463461, EF463752; H. dilatatum (G. Forst.) Sw., #993, Hennequin & al., 2003, AY095111,

25

Brownsey (DUKE), New Zealand, EF463462, EF463753; H. fucoides (Sw.) Sw., #346, Hasebe & al., 1995, U20933, #345, Dubuisson HV1997-9 (F), Venezuela, EF463463, EF463754; H. hirsutum (L.) Sw., #853, Pryer & al., 2001b, AF275645, Pryer & al., 2001a, AF313538, Kessler 9756 (UC), Bolivia, EF463755; H. hygrometricum (Poir.) Desv., #966, Hennequin & al., 2003, AY095113, Dubuisson HR 1999-13 (DUKE), Reunion, EF463464, EF463756; H. inaequale (Poir.) Desv., #967, Hennequin & al., 2003, AY095112, #2953, Hennequin 2002-12 (P), Reunion, EF463465, EF463757; H. nephrophyllum (G. Forst.) Ebihara & K. Iwats., #335, Hasebe & al., 1995, U30833, #935, Smith 2606 (UC), New Zealand, EF463466, EF463758; H. polyanthos (Sw.) Sw., #854, Pryer & al., 2001b, AF275647, Kessler 9866 (UC), Bolivia, EF463467, EF463759; H. sibthorpioides Mett., #968, Hennequin & al., 2003, AY095117, Dubuisson HR 1999-1 (F), Reunion, EF463468, EF463760; H. tunbrigense (L.) Sm., #869, Dubuisson, 1997, Y09203, #2903, Katzer 3 (P), Scotland, U.K., EF463469, EF463761; Polyphlebium borbonicum (Bosch) Ebihara & Dubuisson, #2071, Dubuisson & al., 2003a, AY175782, Dubuisson HR 1999-25 (P), Reunion, EF463470, EF463762; P. endlicherianum (C. Presl) Ebihara & K. Iwats., #948, Smith 2600 (UC), New Zealand, EF463229, EF463471, EF463763; Trichomanes ankersii C. Parker ex Hook & Grev., #859, Dubuisson & al., 2003a, AY175800, Hallé s.n. (MPU), Colombia, EF463472, EF463764; T. crispum L., #862, Dubuisson & al., 2003a, AY175789, Dubuisson HV1997-22 (DUKE), Venezuela, EF463473, EF463765; T. pinnatum Hedw., #904, Dubuisson, 1997, Y09200, #1293, Kessler 10872 (UC), Bolivia, EF463474, EF463766; Vandenboschia radicans (Sw.) Copel., #856, Pryer & al., 2001b, AF275650, #385, Horich s.n. (UC), Costa Rica, EF463475, EF463767; Lindsaeaceae: Cystodium sorbifolium (Sm.) J. Sm., #2498, Korall & al., 2006a, AM184111, AM184112, Christensen 1529 (S), Sarawak, Malaysia, EF463768; Lindsaea blotiana K. U. Kramer, #3508, Rakotondrainibe 6350 (P), Madagascar, EF463230, EF463476, EF463769; L. madagascariensis Baker, #3507, Rakotondrainibe 6349 (P), Madagascar, EF463231, EF463477, EF463770; L. quadrangularis Raddi, #3304, Christenhusz 4018 (TUR), Guadeloupe, EF463232, EF463478, EF463771; Lonchitis hirsuta L., #112, Wolf & al., 1994, U05929, #414, Pryer & al., 2004, AY612700, Axelrod 9601 (UTC), Puerto Rico, EF463772; Odontosoria aculeata (L.) J. Sm., #3427, Christenhusz 4242 (TUR), Puerto Rico, EF463233, EF463479, EF463773; Sphenomeris chinensis (L.) Maxon, #411, Wolf & al., 1994, U05934, #408, Pryer & al., 2004, AY612710, #416, Moore 20263 (DUKE), Taiwan, EF463774; Lomariopsidaceae: Cyclopeltis semicordata (Sw.) J. Sm., #3501, Barrington 2129 (VT), Costa Rica, EF463234, EF463480, EF463775; Lomariopsis pollicina (Willemet) Mett. ex Kuhn, #3505, Rakotondrainibe 6707 (P), Grande Comore, EF463235, EF463481, EF463776; L. sorbifolia (L.) Fée, #3333, Christenhusz 4070 (TUR), Guadeloupe, EF463236, EF463482, EF463777; Nephrolepis cordifolia (L.) C. Presl, #479, Wolf & al., 1994, U05933, Schuettpelz & al., 2007, EF452041, EF452103; N. hirsutula (G. Forst.) C. Presl, #3071, Christenhusz 3580 (TUR), Puerto Rico, EF463237, EF463483, EF463778; Loxomataceae: Loxoma cunninghamii R. Br., #835, Pryer & al., 2004, AY612679, AY612702, Cranfill s.n. (UC), New Zealand, EF463779; Loxsomopsis pearcei (Baker) Maxon, #729, Pryer & al., 2004, AY612680, AY612703, Sánchez Baracaldo 322 (UC), Ecuador, EF463780; Lygodiaceae: Lygodium japonicum (Thunb.) Sw., #440, Manhart, 1994, L13479, #441, Pryer & al., 2001a, AF313549, #2545, Metzgar s.n. (DUKE), in cultivation, EF463781; L. reticulatum Schkuhr, #3430, Schuettpelz 505 (DUKE), in cultivation, EF463238, EF463484, EF463782; Marattiaceae: Angiopteris evecta (G. Forst.) Hoffm., #2569, Christenhusz 2992 (IJ), Jamaica, EF463239, EF463485, EF463783; Danaea elliptica Sm., #451, Pryer & al., 2001a, AF313578, AF313540, Sharpe s.n. (UC), Puerto Rico, EF463784; Marattia alata Sw., #2570, Christenhusz 3266 (IJ), Jamaica, EF463240, EF463486, EF463785; Marsileaceae: Marsilea drummondii A. Braun, #463, Hoshizaki 577 (UC), in cultivation, EF463241, Pryer & al., 2001a, AF313551, #2041, Pryer s.n. (no voucher), in cultivation, EF463786; M. mutica Mett., #2046, Korall & al., 2006b, AM177357, AM176623, Nagalingum 25 (DUKE), in cultivation, EF463787;

26

Pilularia globulifera L., #472, Pryer & al., 2004, AY612681, AY612707, #2048, Schneider s.n. (GOET), Germany, EF463788; Matoniaceae: Matonia pectinata R. Br., #NA, Kato & Setoguchi, 1998, AF012267, #475, Pryer & al., 2004, AY612704, Hasebe 27620 (TI), Malaysia, EF463789; Phanerosorus sarmentosus (Baker) Copel., #866, Pryer & al., 2001a, AF313583, AF313548, Kato s.n. (TI), Sarawak, Malaysia, EF463790; Metaxyaceae: Metaxya rostrata (Kunth.) C. Presl, #476, Smith & al., 2001, AF317699, Pryer & al., 2004, AY612705, #2305, Conant 4355 (LSC), Honduras, EF463791; Oleandraceae: Oleandra articulata (Sw.) C. Presl, #3281, Christenhusz 3980 (TUR), Guadeloupe, EF463242, EF463487, EF463792; Onocleaceae: Onoclea sensibilis L., #NA, Gastony & Ungerer, 1997, U62034, #2998, Schuettpelz 353 (DUKE), in cultivation, EF463488, EF463793; Osmundaceae: Leptopteris wilkesiana (Brack.) H. Christ, #492, Pryer & al., 2004, AY612678, AY612699, #912, van der Werff 16025 (UC), New Caledonia, EF463794; Osmunda cinnamomea L., #NA, Yatabe & al., 1999, AB024949, #496, Pryer & al., 2001a, AF313539, #2596, Christenhusz 3380 (IJ), Jamaica, EF463795; Todea barbara (L.) Moore, #NA, Yatabe & al., 1999, AB024959, #499, Pryer & al., 2004, AY612714, Smith 2895 (UC), in cultivation, EF463796; Plagiogyriaceae: Plagiogyria japonica Nakai, #501, Hasebe & al., 1994, U05643, Pryer & al., 2001a, AF313547, Hasebe 27614 (TI), Japan, EF463797; Polypodiaceae: Adenophorus pinnatifidus Gaudich., #187, Ranker & al., 2003, AF468201, AF469777, Ranker 1559 (COLO), Hawaii, U.S.A., EF463798; Arthromeris wallichiana (Spreng.) Ching, #3541, Schneider s.n. (E), in cultivation, EF463243, EF463489, EF463799; Belvisia spicata (L. f.) Mirb., #3537, Ranker 1915 (COLO), Tahiti, French Polynesia, EF463244, EF463490, EF463800; Calymmodon gracilis (Fée) Copel., #190, Ranker & al., 2004, AY362341, AY459451, Chiou 97-09-12-01 (TAIF), Taiwan, EF463801; Campyloneurum latum T. Moore, #3257, Christenhusz 3950 (TUR), Guadeloupe, EF463245, EF463491, EF463802; Ceradenia kalbreyeri (Baker) L. E. Bishop, #2662, Ranker & al., 2004, AY460621, AY459455, Rojas 3323 (no voucher), Costa Rica, EF463803; C. pilipes (Hook.) L. E. Bishop, #197, Ranker & al., 2004, AY460622, AY459456, Rojas 3233 (INB), Costa Rica, EF463804; Chrysogrammitis musgraviana (Baker) Parris, #2663, Ranker & al., 2004, AY460624, AY459458, Kessler 12570 (UC), Sabah, Malaysia, EF463805; Cochlidium seminudum (Willd.) Maxon, #205, Ranker & al., 2004, AY460627, AY459460, Hill 29102A (no voucher), Dominican Republic, EF463806; Ctenopteris lasiostipes (Mett.) Brownlie, #213, Ranker & al., 2004, AY460630, AY459463, Hodel 1448 (UC), New Caledonia, EF463807; C. nutans J. Sm., #2664, Ranker & al., 2004, AY460631, AY459464, Ranker 1765 (COLO), Papua New Guinea, EF463808; C. repandula Kuntze, #2665, Ranker & al., 2004, AY460633, AY459466, Ranker 1767 (COLO), Papua New Guinea, EF463809; Dictymia mckeei Tindale, #3540, Schneider s.n. (E), in cultivation, EF463246, EF463492, EF463810; Drynaria rigidula (Sw.) Bedd., #3531, Schneider 297 (Z), Malaysia, EF463247, EF463493, EF463811; Enterosora parietina (Klotzsch) L. E. Bishop, #2398, Schuettpelz 230 (DUKE), Ecuador, EF463248, EF463494, EF463812; Goniophlebium formosanum (Baker) Rödl-Linder, #3547, Ranker 1998 (COLO), Taiwan, EF463249, EF463495, EF463813; Grammitis ciliata Col., #932, Ranker & al., 2004, AY460638, AY459470, Smith 2615 (UC), New Zealand, EF463814; G. conjunctisora (Baker) C. Morton, #2667, Ranker & al., 2004, AY460680, AY459514, Ranker 1758 (COLO), Papua New Guinea, EF463815; G. deplanchei (Baker) Copel., #226, Ranker & al., 2004, AY460639, AY459471, Hodel 1450 (UC), New Caledonia, EF463816; G. hookeri (Brack.) Copel., #230, Ranker & al., 2004, AY460642, AY459473, Ranker 1116 (COLO), Hawaii, U.S.A., EF463817; G. parva (Brause) Copel., #2668, Ranker & al., 2004, AY460644, AY459476, Ranker 1763a (COLO), Papua New Guinea, EF463818; G. poeppigiana (Mett.) Pic. Serm., #2077, Ranker & al., 2004, AY460647, AY459479, Taylor 6072 (UC), Chile, EF463819; G. tenella Kaulf., #241, Ranker & al., 2003, AF468198, AF469773, Ranker 1352 (COLO), Hawaii, U.S.A., EF463820; Lellingeria apiculata (Kunze ex Klotzsch) A. R. Sm. & R. C. Moran, #242, Ranker & al., 2004, AY362343, AY459480, Salino 3009 (UC), Brazil, EF463821; L. hirsuta A. R. Sm. & R. C. Moran, #244,

27

Ranker & al., 2004, AY460649, AY459482, Rojas 3145 (CR), Costa Rica, EF463822; L. schenckii (Hieron.) A. R. Sm. & R. C. Moran, #2666, Ranker & al., 2004, AY460651, AY459483, Salino 4538 (UC), Brazil, EF463823; Lemmaphyllum microphyllum C. Presl, #3534, Ranker 2010 (COLO), Taiwan, EF463250, EF463496, EF463824; Lepisorus longifolius (Blume) Holttum, #3514, Schneider s.n. (GOET), in cultivation, EF463251, EF463497, EF463825; Loxogramme abyssinica (Baker) M. G. Price, #3471, Rakotondrainibe 6711 (P), Grande Comore, EF463252, EF463498, EF463826; Melpomene moniliformis (Lag. ex Sw.) A. R. Sm. & R. C. Moran, #267, Ranker & al., 2004, AY460654, AY459486, Moraga 446 (INB), Costa Rica, EF463827; Microgramma bifrons (Hook.) Lellinger, #927, Schneider & al., 2004d, AY362582, #3477, van der Werff 18062 (UC), Peru, EF463499, EF463828; Micropolypodium hyalinum (Maxon) A. R. Sm., #284, Ranker & al., 2004, AY362344, AY459490, Rojas 3210 (UC), Costa Rica, EF463829; M. taenifolium (Jenman) A. R. Sm., #288, Ranker & al., 2004, AY460658, AY459491, Rojas 3007 (UC), Costa Rica, EF463830; Microsorum grossum (Langsd. & Fisch.) S. B. Andrews, #3481, Ranker 1941 (COLO), Moorea, EF463253, EF463500, EF463831; M. varians (Mett.) Hennipman & Hett., #NA, Schneider & al., 2004d, AY362566, #3475, Schneider s.n. (GOET), in cultivation, EF463501, EF463832; Neocheiropteris palmatopedata (Baker) H. Christ, #NA, Schneider & al., 2004d, AY362567, #3560, Schneider s.n. (GOET), in cultivation, EF463502, EF463833; Niphidium crassifolium (L.) Lellinger, #2377, Schuettpelz 209 (DUKE), Ecuador, EF463254, EF463503, EF463834; Pecluma eurybasis (C. Chr.) M. G. Price, #3472, Danton s.n. (GOET), Juan Fernandez Islands, EF463255, EF463504, EF463835; Phlebodium decumanum (Willd.) J. Sm., #2384, Schuettpelz 216 (DUKE), Ecuador, EF463256, EF463505, EF463836; Platycerium stemaria (P. Beauv.) Desv., #3544, Kreier s.n. (GOET), in cultivation, EF463257, EF463506, EF463837; Pleopeltis macrocarpa (Bory ex Willd.) Kaulf., #565, Hasebe & al., 1995, U21152, #3476, Danton s.n. (UC), Juan Fernandez Islands, EF463507, EF463838; P. polypodioides (L.) E. G. Andrews & Windham, #827, Schneider & al., 2004d, AY362592, #2670, Christenhusz 3813 (DUKE), North Carolina, U.S.A., EF463508, EF463839; P. sanctae-rosei (Maxon) ined., #3580, Schuettpelz 525 (GOET), in cultivation, EF463258, EF463509, EF463840; Polypodium vulgare L., #NA, Hirohara & al., 2000, AB044899, #3474, Schneider s.n. (GOET), Germany, EF463510, EF463841; Prosaptia contigua (G. Forst.) C. Presl, #293, Ranker & al., 2004, AY362345, AY459494, Chiou 97-09-12-05 (TAIF), Taiwan, EF463842; P. obliquata (Blume) Mett., #296, Ranker & al., 2004, AY460661, AY459495, Chiou 97-09-12-04 (TAIF), Taiwan, EF463843; Pyrrosia polydactylis (Hance) Ching, #3546, Ranker 2080 (COLO), Taiwan, EF463259, EF463511, EF463844; P. serpens (G. Forst.) Ching, #3532, Ranker 1933 (COLO), Moorea, French Polynesia, EF463260, EF463512, EF463845; Scleroglossum sulcatum (Kuhn) Alderw., #1008, Ranker & al., 2004, AY460664, AY459497, Flynn 6287 (UC), Pohnpei, Caroline Islands, EF463846; Selliguea lanceolata Fée, #3536, Munzinger 1253 (P), New Caledonia, EF463261, EF463513, EF463847; S. plantaginea Brack., #3535, Ranker 1897 (COLO), Tahiti, French Polynesia, EF463262, EF463514, EF463848; Serpocaulon fraxinifolium (Jacq.) A. R. Sm., #587, Schneider & al., 2002, AY096207, #2432, Schuettpelz 264 (DUKE), Ecuador, EF463515, EF463849; S. triseriale (Sw.) A. R. Sm., #3543, Jimenez 1994 (UC), Bolivia, EF463263, EF463516, EF463850; Synammia intermedia (Colla) G. Kunkel, #3473, Danton s.n. (UC), Juan Fernandez Islands, EF463264, EF463517, EF463851; Terpsichore anfractuosa (Kunze ex Klotzsch) B. León & A. R. Sm., #254, Ranker & al., 2004, AY460668, AY459501, Rojas 3321 (INB), Costa Rica, EF463852; T. eggersii (Baker ex Hook.) A. R. Sm., #309, Ranker & al., 2003, AF468209, AF469785, Hill 29109 (UC), Dominican Republic, EF463853; T. semihirsuta (Klotzsch) A. R. Sm., #328, Ranker & al., 2004, AY460676, AY459509, León 3655 (USM), Peru, EF463854; T. senilis (Fée) A. R. Sm., #323, Schneider & al., 2002, AY096208, Ranker & al., 2004, AY459510, Rojas 3196 (INB), Costa Rica, EF463855; Thylacopteris papillosa (Blume) J. Sm., #3530, Schneider & al., 2004a, AY459175, Gravendeel 559 (L), Java, Indonesia, EF463518, EF463856; Pteridaceae: Acrostichum danaeifolium Langsd.

28

& Fisch., #3663, Schuettpelz & al., 2007, EF452129, EF452008, EF452065; Actiniopteris dimorpha Pic. Serm., #3515, Schuettpelz & al., 2007, EF452130, EF452009, EF452066; Adiantopsis radiata (L.) Fée, #3313, Schuettpelz & al., 2007, EF452131, EF452010, EF452067; Adiantum capillus-veneris L., #NA, Wolf & al., 2003, AY178864, AY178864, AY178864; A. malesianum J. Ghatak, #2506, Schuettpelz & al., 2007, EF452132, EF452011, EF452068; A. pedatum L., #636, Hasebe & al., 1994, U05602, #2499, Schuettpelz & al., 2007, EF452012, EF452069; A. peruvianum Klotzsch, #2507, Schuettpelz & al., 2007, EF452133, EF452013, EF452070; A. raddianum C. Presl, #637, Wolf & al., 1994, U05906, #638, Wolf, 1997, U93840, Schuettpelz & al., 2007, EF452071; A. tenerum Sw., #2504, Schuettpelz & al., 2007, EF452134, EF452014, EF452072; A. tetraphyllum Humb. & Bonpl. ex Willd., #2505, Schuettpelz & al., 2007, EF452135, EF452015, EF452073; Aleuritopteris argentea (S. G. Gmel.) Fée, #3734, Schuettpelz & al., 2007, EF452137, EF452016, EF452074; Anetium citrifolium (L.) Splitg., #697, Crane & al., 1995, U21284, #3339, Schuettpelz & al., 2007, EF452017, EF452075; Antrophyum latifolium Blume, #3078, Schuettpelz & al., 2007, EF452138, EF452018, EF452076; Argyrochosma limitanea (Maxon) Windham, #3179, Schuettpelz & al., 2007, EF452139, EF452019, EF452077; Astrolepis sinuata (Lag. ex Sw.) D. M. Benham & Windham, #2955, Schuettpelz & al., 2007, EF452141, EF452021, EF452079; Bommeria hispida (Mett. ex Kuhn) Underw., #3174, Schuettpelz & al., 2007, EF452142, EF452022, EF452081; Ceratopteris richardii Brongn., #NA, Masuyama & al., 2002, AB059585, #1027, Pryer & al., 2004, AY612691, Schuettpelz & al., 2007, EF452082; Cheilanthes alabamensis (Buckley) Kunze, #2964, Schuettpelz & al., 2007, EF452143, EF452023, EF452083; C. eatonii Baker, #2968, Schuettpelz & al., 2007, EF452144, EF452024, EF452084; Coniogramme fraxinea (D. Don) Fée ex Diels, #653, Korall & al., 2006b, AM177359, Pryer & al., 2004, AY612693, Korall & al., 2006b, AM176470; Cryptogramma crispa (L.) R. Br. ex Hook., #2949, Schuettpelz & al., 2007, EF452148, EF452027, EF452087; Doryopteris ludens (Wall. ex Hook.) J. Sm., #3510, Schuettpelz & al., 2007, EF452150, EF452031, EF452092; Eriosorus cheilanthoides (Sw.) A. F. Tryon, #3767, Schuettpelz & al., 2007, EF452152, EF452034, EF452095; Haplopteris elongata (Sw.) E. H. Crane, #2546, Schuettpelz & al., 2007, EF452153, EF452035, EF452096; Hecistopteris pumila (Spreng.) J. Sm., #703, Crane & al., 1995, U21286, #3278, Schuettpelz & al., 2007, EF452036, EF452097; Hemionitis palmata L., #NA, Geiger & Ranker, unpublished, AY357708, #2557, Schuettpelz & al., 2007, EF452037, EF452098; Jamesonia verticalis Kunze, #3768, Schuettpelz & al., 2007, EF452155, EF452038, EF452099; Llavea cordifolia Lag., #660, Gastony & Rollo, 1995, U27726, #3021, Schuettpelz & al., 2007, EF452039, EF452100; Mildella henryi (H. Christ) C. C. Hall & Lellinger, #3513, Schuettpelz & al., 2007, EF452146, EF452025, EF452085; Monogramma graminea (Poir.) Schkuhr, #3548, Schuettpelz & al., 2007, EF452157, EF452040, EF452102; Neurocallis praestantissima Bory ex Fée, #3294, Schuettpelz & al., 2007, EF452158, EF452042, EF452104; Notholaena aschenborniana Klotzsch, #3183, Schuettpelz & al., 2007, EF452159, EF452043, EF452105; Ochropteris pallens (Sw.) J. Sm., #3558, Schuettpelz & al., 2007, EF452160, EF452044, EF452106; Onychium japonicum Blume, #663, Hasebe & al., 1994, U05641, #3463, Schuettpelz & al., 2007, EF452045, EF452107; Paraceterach marantae (L.) R. M. Tryon, #3736, Schuettpelz & al., 2007, EF452161, EF452046, EF452108; Pellaea truncata Goodd., #3137, Schuettpelz & al., 2007, EF452164, EF452048, EF452110; P. viridis (Forssk.) Prantl, #3555, Schuettpelz & al., 2007, EF452147, EF452026, EF452086; Pentagramma triangularis (Kaulf.) Yatsk., Windham & E. Wollenw., #3152, Schuettpelz & al., 2007, EF452165, EF452049, EF452111; Pityrogramma austroamericana Domin, #2561, Schuettpelz & al., 2007, EF452166, EF452050, EF452112; P. jamesonii (Baker) Domin, #3769, Schuettpelz & al., 2007, EF452167, Moran 7592 (NY), Ecuador, EF463519, EF463857; Platyzoma microphyllum R. Br., #NA, Nakazato & Gastony, 2003, AY168721, #669, Schuettpelz & al., 2007, EF452051, EF452113; Polytaenium cajenense (Desv.) Benedict, #704, Crane & al., 1995, U20934, #2379, Schuettpelz & al., 2007, EF452052, EF452114; Pteris

29

arborea L., #3321, Schuettpelz & al., 2007, EF452168, EF452053, EF452116; P. argyraea T. Moore, #3597, Schuettpelz & al., 2007, EF452169, EF452054, EF452117; P. cretica L., #3644, Schuettpelz & al., 2007, EF452170, EF452055, EF452118; P. multifida Poir., #3640, Schuettpelz & al., 2007, EF452171, EF452056, EF452119; P. propinqua J. Agardh, #2436, Schuettpelz & al., 2007, EF452172, EF452057, EF452120; P. quadriaurita Retz., #3601, Schuettpelz & al., 2007, EF452173, EF452058, EF452121; P. tremula R. Br., #3667, Schuettpelz & al., 2007, EF452174, EF452059, EF452122; P. vittata L., #671, Wolf & al., 1994, U05941, #3400, Schuettpelz & al., 2007, EF452060, EF452123; Pterozonium brevifrons (A. C. Sm.) Lellinger, #2453, Schuettpelz & al., 2007, EF452175, EF452061, EF452124; Radiovittaria gardneriana (Fée) E. H. Crane, #707, Crane & al., 1995, U21294, #2417, Schuettpelz & al., 2007, EF452062, EF452125; Vittaria graminifolia Kaulf., #715, Crane & al., 1995, U21295, #2395, Schuettpelz & al., 2007, EF452064, EF452128; Saccolomataceae: Saccoloma inaequale (Kunze) Mett., #3419, Christenhusz 4233 (TUR), Puerto Rico, EF463265, EF463520, EF463858; Salviniaceae: Azolla pinnata R. Br., #2113, Korall & al., 2006b, AM177355, #2023, Korall & al., 2006b, AM176622, Schneider s.n. (GOET), in cultivation, EF463859; Salvinia cucullata Roxb., #674, Hasebe & al., 1994, U05649, #2028, Schneider s.n. (GOET), in cultivation, EF463521, EF463860; Schizaeaceae: Schizaea dichotoma (L.) J. Sm., #NA, Wikström & al., 2002, AJ303408, #679, Pryer & al., 2004, AY612709, Game 98/07 (UC), Cook Islands, EF463861; Tectariaceae: Arthropteris parallela C. Chr., #3579, Schuettpelz 524 (GOET), in cultivation, EF463266, EF463522, EF463862; Heterogonium pinnatum (Copel.) Holttum, #3610, Schuettpelz 555 (GOET), in cultivation, EF463267, EF463523, EF463863; Psammiosorus paucivenius C. Chr., #3539, Rakotondrainibe 6585 (P), Madagascar, EF463268, EF463524, EF463864; Tectaria antioquoiana (Baker) C. Chr., #2368, Schuettpelz 200 (DUKE), Ecuador, EF463269, EF463525, EF463865; T. apiifolia (Schkuhr) Copel., #3056, Christenhusz 3201 (IJ), Jamaica, EF463270, EF463526, EF463866; T. fimbriata (Willd.) Proctor & Lourteig, #3527, Christenhusz 3537 (TUR), Puerto Rico, EF463271, EF463527, EF463867; T. incisa Cav., #3057, Christenhusz 3209 (IJ), Jamaica, EF463272, EF463528, EF463868; T. prolifera (Hook.) R. M. Tryon & A. F. Tryon, #3058, Christenhusz 3368 (IJ), Jamaica, EF463273, EF463529, EF463869; T. trifoliata (L.) Cav., #3302, Christenhusz 4013 (TUR), Guadeloupe, EF463274, EF463530, EF463870; T. zeylanica (Houtt.) Sledge, #3569, Schuettpelz 514 (GOET), in cultivation, EF463275, EF463531, EF463871; Triplophyllum funestum (Kunze) Holttum, #3359, Christenhusz 4107 (TUR), Guadeloupe, EF463276, EF463532, EF463872; Thelypteridaceae: Macrothelypteris torresiana (Gaud.) Ching, #2980, Schuettpelz 335 (DUKE), in cultivation, EF463277, EF463533, EF463873; Phegopteris hexagonoptera (Michx.) Fée, #2731, Christenhusz 3844 (DUKE), South Carolina, U.S.A., EF463278, EF463534, EF463874; Pseudophegopteris cruciata (Willd.) Holttum, #3559, Janssen 2724 (P), Reunion, EF463279, EF463535, EF463875; Thelypteris abrupta (Desv.) Proctor, #3286, Christenhusz 3985 (TUR), Guadeloupe, EF463280, EF463536, EF463876; T. affine (Blume) ined., #3626, Schuettpelz 572 (GOET), in cultivation, EF463281, EF463537, EF463877; T. clypeolutata (Desv.) Proctor, #3303, Christenhusz 4017 (TUR), Guadeloupe, EF463282, EF463538, EF463878; T. consanguinea (Fée) Proctor, #3325, Christenhusz 4060 (TUR), Guadeloupe, EF463283, EF463539, EF463879; T. dentata (Forssk.) E. P. St. John, #3654, Schuettpelz 607 (B), in cultivation, EF463284, EF463540, EF463880; T. gemmulifera (Hieron.) A. R. Sm., #3747, Huiet s.n. (UC), in cultivation, EF463285, EF463541, EF463881; T. glandulosa (Desv.) Proctor, #3343, Christenhusz 4083 (TUR), Guadeloupe, EF463286, EF463542, EF463882; T. globulifera (Brack.) C. F. Reed, #3773, Game s.n. (UC), Hawaii, U.S.A., EF463287, EF463543, EF463883; T. gracilis (Heward) Proctor, #3392, Christenhusz 4182 (TUR), Guadeloupe, EF463288, EF463544, EF463884; T. limbosperma (All.) H.P. Fuchs, #3565, Christenhusz 3719 (TUR), Scotland, U.K., EF463289, EF463545, EF463885; T. linkiana (C. Presl) R.M. Tryon, #3393, Christenhusz 4185 (TUR), Guadeloupe, EF463290, EF463546, EF463886; T. longissima (Brack.) C. F. Reed, #3775, Game 99/270 (UC), Fiji,

30

EF463291, EF463547, EF463887; T. meniscioides (Liebm.) C. F. Reed, #3743, Huiet s.n. (UC), in cultivation, EF463292, EF463548, EF463888; T. noveboracensis (L.) Nieuwland, #2725, Christenhusz 3831 (DUKE), Georgia, U.S.A., EF463293, EF463549, EF463889; T. oligocarpa (Humb. & Bonpl. ex Willd.) Ching, #693, Chisaki 1000 (UC), Costa Rica, EF463294, EF463550, EF463890; T. opulenta (Kaulf.) Fosberg, #3612, Schuettpelz 557 (GOET), in cultivation, EF463295, EF463551, EF463891; T. ovata R. P. St. John, #2972, Schuettpelz 327 (DUKE), in cultivation, EF463296, EF463552, EF463892; T. palustris (Salisb.) Schott, #694, Wolf & al., 1994, U05947, Pryer & al., 2004, AY612713, Schuettpelz & al., 2007, EF452127; T. poiteana (Bory) Proctor, #1235, Mickel 5799 (NY), Oaxaca, Mexico, EF463297, EF463553, EF463893; T. reticulata (L.) Proctor, #3362, Christenhusz 4112 (TUR), Guadeloupe, EF463298, EF463554, EF463894; T. rustica (Fée) Proctor, #3390, Christenhusz 4180 (TUR), Guadeloupe, EF463299, EF463555, EF463895; T. seemannii (Holttum) ined., #3774, Game 95/147 (UC), Fiji, EF463300, EF463556, EF463896; T. simplex (Hook.) K. Iwats., #1075, Bartholomew 573 (UC), Hong Kong, EF463301, EF463557, EF463897; T. sp., #3549, Janssen 2679 (P), Reunion, EF463303, EF463559, EF463899; T. tylodes (Kunze) Ching, #3698, Olsen s.n. (no voucher), in cultivation, EF463302, EF463558, EF463898; Thyrsopteridaceae: Thyrsopteris elegans Kunze, #2477, Korall & al., 2006b, AM177353, AM176620, Morter 18 (E), in cultivation, EF463900; Woodsiaceae: Athyrium distentifolium Tausch ex Opiz, #3581, Schuettpelz 526 (GOET), in cultivation, EF463304, EF463560, EF463901; A. filix-femina (L.) Roth, #26, Wolf & al., 1994, U05908, #2669, Christenhusz 3814 (DUKE), North Carolina, U.S.A., EF463561, EF463902; A. niponicum (Mett.) Hance, #27, Sano & al., 2000, D43891, #2852, Kato s.n. (no voucher), Japan, EF463562, EF463903; A. otophorum (Miq.) Koidz., #3744, Smith s.n. (UC), in cultivation, EF463305, EF463563, EF463904; A. yokoscense (Franch. & Sav.) H. Christ, #30, Sano & al., 2000, D43893, #2853, Kato s.n. (no voucher), in cultivation, EF463564, EF463905; Cornopteris decurrenti-alata (Hook.) Nakai, #31, Sano & al., 2000, D43897, #2854, Kato s.n. (no voucher), in cultivation, EF463565, EF463906; Cystopteris reevesiana Lellinger, #3126, Schuettpelz & al., 2007, EF452149, EF452028, EF452088; Deparia bonincola (Nakai) M. Kato, #NA, Sano & al., 2000, D43899, #2860, Kato s.n. (no voucher), in cultivation, EF463566, EF463907; D. lancea (Thunb.) Fraser-Jenk., #2558, Schuettpelz 298 (DUKE), in cultivation, EF463306, EF463567, EF463908; D. petersenii (Kunze) M. Kato, #NA, Shinohara & al., 2003, AB095978, #2864, Kato s.n. (no voucher), in cultivation, EF463568, EF463909; D. unifurcata (Baker) M. Kato, #2865, Kato s.n. (no voucher), in cultivation, EF463307, EF463569, EF463910; Diplazium bombonasae Rosenst., #3764, Moran 7493 (NY), Ecuador, EF463308, EF463570, EF463911; D. centripetale (Baker) Maxon, #3421, Christenhusz 4236 (UPR), Puerto Rico, EF463309, EF463571, EF463912; D. cristatum (Desr.) Alston, #3310, Christenhusz 4029 (TUR), Guadeloupe, EF463310, EF463572, EF463913; D. dilatatum Blume, #3638, Schuettpelz 588 (GOET), in cultivation, EF463311, EF463573, EF463914; D. hachijoense Nakai, #2868, Kato s.n. (no voucher), in cultivation, EF463312, EF463574, EF463915; D. legalloi Proctor, #3328, Christenhusz 4063 (TUR), Guadeloupe, EF463313, EF463575, EF463916; D. plantaginifolium (L.) Urb., #3305, Christenhusz 4019 (TUR), Guadeloupe, EF463314, EF463576, EF463917; D. proliferum (Lam.) Thouars, #3639, Schuettpelz 590 (GOET), in cultivation, EF463315, EF463577, EF463918; D. virescens Kunze, #2873, Kato s.n. (no voucher), in cultivation, EF463316, EF463578, EF463919; D. wichurae (Mett.) Diels, #NA, Yatabe & al., unpublished, AB042744, #2874, Kato s.n. (no voucher), in cultivation, EF463579, EF463920; Gymnocarpium dryopteris (L.) Newman, #3066, Yatskievych 02-31 (DUKE), Yunnan, China, EF463317, EF463580, EF463921; Hemidictyum marginatum (L.) C. Presl, #3054, Christenhusz 2476 (CAY), French Guiana, EF463318, EF463581, EF463922; Woodsia obtusa (Spreng.) Torr., #2973, Schuettpelz 328 (DUKE), in cultivation, EF463319, EF463582, EF463923.

31

Table 3. Amplification and sequencing primers routinely used in my study of leptosporangiate fern phylogeny. Primer Use1 Sequence (5' to 3') Reference rbcL

AF FA ATGTCACCACAAACAGAGACTAAAGC Hasebe & al., 1994 ESRBCL1F FA* ATGTCACCACAAACGGAGACTAAAGC This study ESRBCL628F FS* CCATTYATGCGTTGGAGAGATCG This study ESRBCL645F FS AGAYCGTTTCYTATTYGTAGCAGAAGC This study ESRBCL654R RS* GAARCGATCTCTCCAACGCAT This study ESRBCL663R RS TACRAATARGAAACGRTCTCTCCAACG This study ESRBCL1361R RA* TCAGGACTCCACTTACTAGCTTCACG This study 1379R RA TCACAAGCAGCAGCTAGTTCAGGACTC Pryer & al., 2001b

atpB ESATPB172F FA* AATGTTACTTGTGAAGTWCAACAAT This study ESATPB221F FA GCCGTRGCTATGAGTGCCACAGA This study ATPB672F FA TTGATACGGGAGCYCCTCTWAGTGT Wolf, 1997 ATPB493F FS GGATCTTTTGGCYCCGTATCGTCG Pryer & al., 2004 ATPB609R RS TCRTTDCCTTCRCGTGTACGTTC Pryer & al., 2004 ESATPB701F FS TATGGTCAGATGAATGAACC This study ATPB1163F FS* ATGGCAGAATRTTTCCGAGATRTYA Wolf, 1997 ESATPB912R RS ATTTCTGTACCAAGRGTCGGTTG This study ATPB910R RS* TTCCTGYARAGANCCCATTTCTGT Pryer & al., 2004 ATPB1419F FS CRACATTTGCACATYTRGATGCTAC Wolf, 1997 ATPB1592R RS TGTAACGYTGYAAAGTTTGCTTAA Wolf, 1997 ESATPE45R RA* ATTCCAAACWATTCGATTWGGAG This study ESATPE47R RA GAATTCCAAACWATTCGATTAGGAG This study ATPE384R RA GAATTCCAAACTATTCGATTAGG Pryer & al., 2004

atpA ESATPF412F FA* GARCARGTTCGACAGCAAGT Schuettpelz & al., 2006 ESATPF415F FA CARGTTCGACAGCAAGTYTCTCG Schuettpelz & al., 2006 ESATPA283F FS GGYAAGATTGCTCAAATACCAG Schuettpelz & al., 2006 ESATPA535F FS* ACAGCAGTAGCTACAGATAC Schuettpelz & al., 2006 ESATPA557R RS* ATTGTATCTGTAGCTACTGC Schuettpelz & al., 2006 ESATPA787F FS TACGACGATCTYTCTAAACAAGC Schuettpelz & al., 2006 ESATPA823R RS GTCGATAAGCYTGAGCTTGTTTAG Schuettpelz & al., 2006 ESATPA856F FS* CGAGAAGCATATCCGGGAGATG Schuettpelz & al., 2006 ESATPA877R RS* CATCTCCCGGATATGCTTCTCG Schuettpelz & al., 2006 ESTRNR46F RA* GTATAGGTTCRARTCCTATTGGACG Schuettpelz & al., 2006

1F = forward; R = reverse; A = amplification and sequencing; S = sequencing only; * = most commonly used.

32

Table 4. Statistics for the four datasets analyzed in my study of leptosporangiate fern phylogeny. Dataset Characters (bp) Variable characters Missing data Well-supported1 nodes rbcL 1308 784 1.1% 229 atpB 1278 705 3.2% 222 atpA 1506 933 0.7% 249 Combined 4092 2422 1.6% 322 1Maximum likelihood bootstrap support ≥ 70%

33

Figure 1a. Leptosporangiate fern phylogeny. Tree results from maximum likelihood analysis of plastid rbcL, atpB, and atpA data; presented both as a phylogram (left) to reveal branch lengths and a cladogram (right) to clarify relationships and allow for the presentation of maximum likelihood bootstrap percentages (only percentages ≥ 50 are given; if ≥ 70%, branches are bolded; * = 100%). Note that the five eusporangiate fern outgroups have been pruned. Major clades discussed in text are indicated in circles on trees: co = core leptosporangiates; ff = filmy ferns; gl = gleichenioids; hf = heterosporous ferns; hy = hymenophylloids; le = leptosporangiates; of = osmundaceous ferns; po = polypods; sc = scaly tree ferns; sh = schizaeoids; tf = tree ferns; tr = trichomanoids. Families recognized in the most recent classification of extant ferns (Smith & al., 2006b) are indicated in boxes between trees: Ane = Anemiaceae; Cib = Cibotiaceae; Cul = Culcitaceae; Cya = Cyatheaceae; Dic = Dicksoniaceae; Dip = Dipteridaceae; Gle = Gleicheniaceae; Hym = Hymenophyllaceae; Lox = Loxomataceae; Lyg = Lygodiaceae; Mar = Marsileaceae; Mat = Matoniaceae; Met = Metaxyaceae; Osm = Osmundaceae; Pla = Plagiogyriaceae; Sal = Salviniaceae; Sch = Schizaeaceae; Thy = Thyrsopteridaceae. Phylogeny continues in Figure 1b.

Osmunda cinnamomeaLeptopteris wilkesiana

Todea barbaraAbrodictyum elongatum

Cephalomanes javanicumTrichomanes ankersii

Trichomanes crispumTrichomanes pinnatum

Polyphlebium borbonicumPolyphlebium endlicherianum

Didymoglossum ekmaniiDidymoglossum krausii

Didymoglossum membranaceumVandenboschia radicans

Crepidomanes thysanostomumCrepidomanes bipunctatum

Crepidomanes minutumHymenophyllum cruentum

Hymenophyllum dilatatumHymenophyllum nephrophyllum

Hymenophyllum digitatumHymenophyllum hirsutum

Hymenophyllum hygrometricumHymenophyllum inaequaleHymenophyllum apiculatumHymenophyllum polyanthosHymenophyllum armstrongiiHymenophyllum sibthorpioidesHymenophyllum tunbrigenseHymenophyllum baileyanumHymenophyllum fucoides

Cheiropleuria integrifoliaDipteris conjugataMatonia pectinata

Phanerosorus sarmentosusDiplopterygium bancroftii

Dicranopteris linearisGleichenella pectinata

Gleichenia dicarpaStromatopteris moniliformisSticherus bifidusSticherus palmatus

Lygodium japonicumLygodium reticulatum

Schizaea dichotomaAnemia adiantifolia

Anemia tomentosaAnemia phyllitidisAnemia rotundifolia

Azolla pinnataSalvinia cucullata

Pilularia globuliferaMarsilea drummondii

Marsilea muticaThyrsopteris elegans

Culcita coniifoliaPlagiogyria japonicaLoxoma cunninghamii

Loxsomopsis pearceiMetaxya rostrata

Calochlaena villosaDicksonia antarctica

Lophosoria quadripinnataCibotium schiedei

Sphaeropteris celebicaSphaeropteris capitataSphaeropteris megalosoraSphaeropteris horridaSphaeropteris medullarisSphaeropteris robusta

Alsophila capensisAlsophila ramispinaAlsophila salviniiCyathea parvulaCyathea alataCyathea poeppigii

Hymenophyllopsis dejectaCyathea horridaCyathea multifloraAlsophila dregeiAlsophila bryophilaAlsophila cuspidataAlsophila colensoiAlsophila foersteri

Alsophila hooglandiiAlsophila stelligera

Polypods (Figure 1b)

0.05 substitutions/site

96

87

92

81

7898

90

6594

92

86

98

73

99

83

89

66

97

99

75

67

96

58

98

53

63

82

54

56

76

96

67

**

**

**

* *

* *

*

*

**

**

**

*

** *

* *

*

*

***

**

*

*

*

*

*

*

*

Cya

Cib

Met

Lox

Cul

Dic

Pla

Thy

Mar

Sal

Ane

Lyg

Sch

Dip

Mat

Gle

Osm

Hym

Leptosporangiates

tr

of

ff

hy

le

sh

hf

sc

co

tf

po

gl

le

tr

of

ff

hy

sh

hf

sc

co

tf

po

gl

Phylogram (with branch lengths) Cladogram (with branch support)Fam

**

**

*

*

*

34

35

Figure 1b. Continued from Figure 1a. Major clades discussed in text are indicated in circles on trees: ad = adiantoids; ce = ceratopteridoids; ch = cheilanthoids; cr = cryptogrammoids; de = dennstaedtioids; eu = eupolypods; li = lindsaeoids; pd = pteridoids; po = polypods; pt = pteroids; vi = vittarioids. Families recognized in the most recent classification of extant ferns (Smith & al., 2006b) are indicated in boxes between trees: Den = Dennstaedtiaceae; Lin = Lindsaeaceae; Pte = Pteridaceae; Sac = Saccolomataceae. Phylogeny continues in Figure 1c.

Saccoloma inaequaleCystodium sorbifolium

Lonchitis hirsutaOdontosoria aculeataSphenomeris chinensis

Lindsaea quadrangularisLindsaea blotianaLindsaea madagascariensis

Dennstaedtia dissectaLeptolepia novae-zelandiae

Dennstaedtia punctilobulaMicrolepia platyphyllaMicrolepia speluncae

Monachosorum henryiPteridium esculentum

Hypolepis tenuifoliaPaesia scaberula

Blotiella pubescensHistiopteris incisa

Llavea cordifoliaConiogramme fraxinea

Cryptogramma crispaAcrostichum danaeifolium

Ceratopteris richardiiActiniopteris dimorphaOnychium japonicum

Pityrogramma austroamericanaPityrogramma jamesoniiPterozonium brevifronsEriosorus cheilanthoides

Jamesonia verticalisPlatyzoma microphyllum

Pteris vittataPteris tremula

Neurocallis praestantissimaPteris argyraeaPteris quadriaurita

Ochropteris pallensPteris arborea

Pteris propinquaPteris cretica

Pteris multifidaDoryopteris ludens

Bommeria hispidaCheilanthes alabamensis

Cheilanthes eatoniiArgyrochosma limitanea

Pellaea truncataAstrolepis sinuata

Paraceterach marantaeNotholaena aschenborniana

Pentagramma triangularisAleuritopteris argentea

Mildella henryiHemionitis palmata

Adiantopsis radiataPellaea viridis

Adiantum pedatumAdiantum capillus-veneris

Adiantum malesianumAdiantum tenerum

Adiantum peruvianumAdiantum tetraphyllum

Adiantum raddianumAntrophyum latifolium

Vittaria graminifoliaAnetium citrifolium

Polytaenium cajenenseHaplopteris elongataMonogramma graminea

Hecistopteris pumilaRadiovittaria gardneriana

Eupolypods (Figure 1c)

0.05 substitutions/site

99 81

7480

97

7553

71

69

69

67

99

8690

55

74

90

96

97 86

92

83

99

76

84

58

**

*

*

**

**

*

*

**

*

*

*

*

**

*

***

**

**

*

*

* *

*

*

*

*

*

*

* *

*

Polypods

Sac

Lin

Den

Pte

*

po

li

pt

cr

pd

ce

eu

vi

ad

de

ch

po

li

pt

cr

pd

ce

eu

vi

ad

de

ch

Phylogram (with branch lengths) Cladogram (with branch support)Fam

99

36

37

Figure 1c. Continued from Figure 1b. Major clades discussed in text are indicated in circles on trees: as = asplenioids; at = athyrioids; bl = blechnoids; cs = cyclosoroids; e1 = eupolypods I; e2 = eupolypods II; eu = eupolypods; on = onocleoids; th = thelypteroids. Families recognized in the most recent classification of extant ferns (Smith & al., 2006b) are indicated in boxes between trees: Asp = Aspleniaceae; Ble = Blechnaceae; Ono = Onocleaceae; The = Thelypteridaceae; Woo = Woodsiaceae. Phylogeny continues in Figure 1d.

Cystopteris reevesianaGymnocarpium dryopteris

Hemidictyum marginatumHymenasplenium cheilosorum

Hymenasplenium unilateraleAsplenium juglandifolium

Asplenium auritumAsplenium rigidum

Asplenium ritoenseAsplenium affine

Asplenium planicauleAsplenium contiguumAsplenium praemorsumAsplenium theciferum

Asplenium feeiAsplenium sandersonii

Asplenium nidusAsplenium formosae

Asplenium tenerumAsplenium scolopendrium

Asplenium adiantum-nigrumAsplenium ruta-muraria

Asplenium marinumAsplenium abscissum

Asplenium harpeodesAsplenium alatumAsplenium pteropus

Asplenium forezienseAsplenium platyneuron

Asplenium normaleAsplenium monanthes

Asplenium trichomanesMacrothelypteris torresiana

Phegopteris hexagonopteraPseudophegopteris cruciataThelypteris palustris

Thelypteris seemanniiThelypteris noveboracensisThelypteris consanguineaThelypteris globulifera

Thelypteris gracilisThelypteris oligocarpaThelypteris linkiana

Thelypteris rusticaThelypteris limbosperma

Thelypteris clypeolutataThelypteris glandulosaThelypteris abruptaThelypteris gemmuliferaThelypteris meniscioidesThelypteris poiteanaThelypteris reticulata

Thelypteris ovataThelypteris longissima

Thelypteris simplexThelypteris dentata

Thelypteris sp.Thelypteris affine

Thelypteris opulentaThelypteris tylodes

Woodsia obtusaOnoclea sensibilis

Salpichlaena volubilisStenochlaena tenuifolia

Woodwardia virginicaSadleria cyatheoides

Blechnum spicantBlechnum schomburgkiiDoodia media

Blechnum polypodioidesBlechnum gracileBlechnum occidentale

Deparia unifurcataDeparia peterseniiDeparia bonincolaDeparia lanceaAthyrium niponicum

Cornopteris decurrenti-alataAthyrium distentifoliumAthyrium filix-femina

Athyrium otophorumAthyrium yokoscense

Diplazium wichuraeDiplazium plantaginifoliumDiplazium bombonasaeDiplazium cristatumDiplazium proliferumDiplazium centripetaleDiplazium legalloi

Diplazium virescensDiplazium dilatatum

Diplazium hachijoense

Eupolypods I (Figure 1d)

0.05 substitutions/site

*

*

*

**

*

*

*76

94

93

90

84

85

7097

9898

*

*

**

*

*

*

97

69

9699

89

67

62

83

70

97

75

**

**

**

*

*

*

*

*

** **

96

*97

*

72

*

75

*

98

*

56

*

68

*99

*

*

*

*

*

98

83

87

94

92

93

5899

99

*

Woo

Asp

The

Woo

Ono

Ble

Woo

Eupolypods

*

as

e2

th

eu

on

bl

at

cs

e1

cs

at

e1

on

bl

as

e2

th

eu

Phylogram (with branch lengths) Cladogram (with branch support)Fam

*

*

98

55

38

39

Figure 1d. Continued from Figure 1c. Major clades discussed in text are indicated in circles on trees: dc = dimorphic climbers; dr = dryopteroids; e1 = eupolypods I; fl = former lomariopsids. Family recognized in the most recent classification of extant ferns (Smith & al., 2006b) is indicated in box between trees: Dry = Dryopteridaceae. Phylogeny continues in Figure 1e.

Didymochlaena truncatulaHypodematium crenatum

Leucostegia pallidaCtenitis sloaneiCtenitis sp.Ctenitis submarginalisPhanerophlebia nobilisCyrtomium falcatum

Polystichum tripteronPolystichum lemmonii

Polystichum hillebrandiiPolystichum munitumPolystichum transkeiense

Polystichum eximiumPolystichum setiferumPolystichum yunnanenseArachniodes aristata

Arachniodes denticulataDryopteris erythrosora

Dryopteris aemulaDryopteris squamisetaDryopteris goldianaDryopteris expansaDryopteris crassirhizomaDryopteris uniformisDryopteris filix-masDryopteris marginalis

Polystichopsis chaerophylloidesCyclodium trianaePolybotrya alfrediiMaxonia apiifolia

Olfersia cervinaStigmatopteris lechleri

Stigmatopteris longicaudataLastreopsis effusaLastreopsis glabellaLastreopsis hispida

Rumohra adiantiformisMegalastrum biserialeMegalastrum macrothecaMegalastrum subincisum

Bolbitis auriculataTeratophyllum wilkesianum

Bolbitis nicotianifoliaLomagramma guianensis

Elaphoglossum amygdalifoliumElaphoglossum crassifoliumElaphoglossum lingua

Elaphoglossum minutumElaphoglossum herminieriElaphoglossum lechlerianum

Elaphoglossum andicolaElaphoglossum flaccidum

Elaphoglossum heterolepisElaphoglossum paleaceumElaphoglossum burchelliiElaphoglossum huacsaroElaphoglossum deltoideum

Elaphoglossum tripartitumElaphoglossum moorei

Elaphoglossum peltatumElaphoglossum piloselloidesElaphoglossum aubertii

Elaphoglossum papillosumElaphoglossum samoense

Elaphoglossum lonchophyllumElaphoglossum crinitumElaphoglossum backhousianumElaphoglossum erinaceumElaphoglossum hybridum

Eupolypods I, part 2 (Figure 1e)

0.05 substitutions/site

*

97

*54

*

59*60

98

84

*

*

97

80

*

87

9794

*

52

59

*

96

*61

*

81

99

*69

97

*92

*97

* 88

*

97

92

97

*

99

84

58

98

61

97

98

79

98

*

69

*71

*

96

Eupolypods I

Dry

e1

dr

fl

dc

e1

dr

fl

dc

Phylogram (with branch lengths) Cladogram (with branch support)Fam

52

*

*

*

40

41

Figure 1e. Continued from Figure 1d. Major clades discussed in text are indicated in circles on trees: da = davallioids; gr = grammitids; pg = polygrammoids; te = tectarioids. Families recognized in the most recent classification of extant ferns (Smith & al., 2006b) are indicated in boxes between trees: Dav = Davalliaceae; Lom = Lomariopsidaceae; Ole = Oleandraceae; Pol = Polypodiaceae; Tec = Tectariaceae.

Nephrolepis cordifoliaNephrolepis hirsutula

Cyclopeltis semicordataLomariopsis pollicina

Lomariopsis sorbifoliaArthropteris parallela

Psammiosorus pauciveniusTriplophyllum funestum

Heterogonium pinnatumTectaria zeylanica

Tectaria apiifoliaTectaria fimbriataTectaria prolifera

Tectaria trifoliataTectaria antioquoianaTectaria incisa

Oleandra articulataAraiostegia hymenophylloidesDavallodes borneense

Davallia griffithianaDavallia solidaDictymia mckeei

Loxogramme abyssinicaDrynaria rigidulaArthromeris wallichiana

Selliguea lanceolataSelliguea plantagineaSynammia intermedia

Platycerium stemariaPyrrosia polydactylis

Pyrrosia serpensThylacopteris papillosa

Goniophlebium formosanumMicrosorum varians

Microsorum grossumLepisorus longifoliusBelvisia spicata

Lemmaphyllum microphyllumNeocheiropteris palmatopedata

Polypodium vulgarePecluma eurybasis

Phlebodium decumanumPleopeltis sanctae-roseiPleopeltis macrocarpaPleopeltis polypodioides

Niphidium crassifoliumCampyloneurum latumMicrogramma bifronsSerpocaulon fraxinifolium

Serpocaulon triserialeTerpsichore eggersii

Adenophorus pinnatifidusGrammitis tenella

Cochlidium seminudumEnterosora parietina

Lellingeria schenckiiTerpsichore senilis

Ceradenia kalbreyeriCeradenia pilipes

Terpsichore anfractuosaTerpsichore semihirsutaMelpomene moniliformisLellingeria apiculataLellingeria hirsutaChrysogrammitis musgraviana

Micropolypodium hyalinumMicropolypodium taenifoliumCalymmodon gracilis

Ctenopteris repandulaScleroglossum sulcatum

Ctenopteris lasiostipesGrammitis deplancheiGrammitis ciliataGrammitis poeppigianaCtenopteris nutans

Prosaptia contiguaProsaptia obliquata

Grammitis conjunctisoraGrammitis hookeri

Grammitis parva

0.05 substitutions/site

*

92

*

*

99

*

97

*

93

*

*

99

**

75

*

96

*

*

**

61*

*70

*

94 *71

84 *81

*

94

*

94

*

95

74*

55

*

82

*

55

*94

*57

99

*

92

*

97

*

98

79

*95

93

72

90

*99

93

*99

70

98

Lom

Tec

Ole

Dav

Pol

Eupolypods I, part 2

te

pg

gr

da

te

da

pg

gr

Phylogram (with branch lengths) Cladogram (with branch support)Fam

99

*

55

**

42

43

PART II

ORIGIN OF TROPICAL RAIN FORESTS

REVEALED BY EPIPHYTIC FERN DIVERSIFICATION

Summary

Recent molecular divergence time estimates for angiosperms suggest that modern tropical

rain forests originated in the mid-Cretaceous, directly contradicting a wealth of evidence from the

fossil record that places their origin after the Cretaceous/Tertiary (K/T) boundary. To better

understand the evolution of this important biome, I estimated divergence times for epiphytic

ferns, which grow almost exclusively in rain forest canopies. Ancestral-state reconstructions

across my evolutionary timescale for ferns reveal diversification in multiple epiphytic clades after

the K/T boundary. This provides an unambiguous signature of Cenozoic tropical rain forest

establishment, consistent with the fossil record.

Introduction

Modern tropical rain forests—with closed, multistratal, angiosperm-dominated

canopies—are among the Earth’s most diverse ecosystems, harboring more than half of all

terrestrial species (Morley, 2000; Richards, 1996; Whitmore, 1998). Understanding the evolution

of this biome is therefore essential to interpreting the history of global biodiversity.

Although the first evidence for flowering plants appears in the Early Cretaceous

(Brenner, 1996; Trevisan, 1988), large angiosperm stems and seeds (hallmarks of a closed

canopy), as well as angiosperm leaves typical of everwet climates, are not abundant in the fossil

record until after the Cretaceous/Tertiary (K/T) boundary (65.5 Ma; Burnham & Johnson, 2004;

44

Jacobs, 2004; Johnson & Ellis, 2002; Morley, 2000; Tiffney, 1984; Upchurch & Wolfe, 1987,

1993; Wheeler & Baas, 1991; Wing & Boucher, 1998; Wing & Tiffney, 1987; Wolfe &

Upchurch, 1987). This preponderance of fossil evidence has led to the prevailing view that the

origin of modern tropical rain forests was a Cenozoic phenomenon. However, the recent

integration of fossils with molecular data has indicated that a large clade of rain forest trees

(Malpighiales) underwent an explosive radiation in the mid-Cretaceous (114 Ma; Davis & al.,

2005). This new evidence advanced an alternative scenario—that the rain forest biome originated

in the Mesozoic, well before the K/T boundary.

In an effort to better understand the timing of modern tropical rain forest establishment

and discriminate between the two competing hypotheses (Cenozoic vs. Mesozoic origin), I

approached the controversy from well outside of flowering plants. Instead of estimating

divergence times for the angiosperm trees that shape these forests, I examined the diversification

of the epiphytic ferns that inhabit them. Epiphytes account for almost one third of extant fern

diversity (Kress, 1986) but are virtually restricted to tropical rain forests where they grow almost

exclusively on angiosperm canopy trees (Benzing, 1990; Gentry & Dodson, 1987; Nieder & al.,

1999; Richards, 1996; Whitmore, 1998). Because of the intimate association between these

otherwise distantly related entities, the diversification of epiphytic ferns should provide both a

clear and independent signature for the timing of tropical rain forest establishment.

Here I integrate a molecular data set of 400 fern species (see Part I; Table 5) with 24 age

constraints from the fern fossil record (Table 6) to yield an evolutionary timescale within which

the diversification of epiphytic ferns can be examined. To gain a realistic approximation of the

fern tree of life, I sampled species proportionally according to habit (about two thirds of the

sampled species are terrestrial, one third epiphytic) and clade size (more species were sampled

from larger clades, fewer from smaller clades). To obtain a robust phylogeny, I sequenced three

plastid protein-coding genes totaling more than 4000 base pairs. I analyzed these data using

45

maximum likelihood—assessing support and accounting for phylogenetic uncertainty with 100

bootstrap replicates. I estimated divergence times for all nodes in these 101 trees with penalized

likelihood and reconstructed ancestral states (epiphytic vs. non-epiphytic) across the resulting 101

phylogenetic chronograms.

Results and Discussion

Phylogenetic analysis of the assembled data set provided a well-resolved and well-

supported evolutionary framework, with 80% of the nodes receiving maximum likelihood

bootstrap support ≥ 70% (see Part I; Table 4). Divergence time estimates for all trees revealed a

marked diversification within ferns in the Cretaceous and Cenozoic (Figure 2), concordant with

both the fossil record (Lovis, 1977; Rothwell, 1987) and previous molecular estimates (Pryer &

al., 2004; Schneider & al., 2004c). In the Permian, Triassic, or even Jurassic, there were very few

divergences and thus very little accumulation of extant fern diversity. This is in sharp contrast to

the steady accumulation of lineages beginning in the Early Cretaceous (Figure 2). My ancestral-

state reconstructions of epiphytism demonstrate that this trait arose independently many times

within ferns, with several subsequent losses. But more importantly, the reconstructions reveal that

essentially all epiphytic fern diversification occurred after the K/T boundary (Figure 2). These

results from ferns champion the Cenozoic hypothesis of modern tropical rain forest

establishment, in agreement with the broad consensus from the angiosperm fossil record

(Burnham & Johnson, 2004; Jacobs, 2004; Johnson & Ellis, 2002; Morley, 2000; Tiffney, 1984;

Upchurch & Wolfe, 1987, 1993; Wheeler & Baas, 1991; Wing & Boucher, 1998; Wing &

Tiffney, 1987; Wolfe & Upchurch, 1987), rather than the mid-Cretaceous origin inferred from

divergence-time estimates for a clade of rain forest trees (Davis & al., 2005).

46

Diversification in nearly all epiphytic fern clades was restricted to the Cenozoic. The

hymenophylloids (taxa 18–31), vittarioids (taxa 151–158), asplenioids (taxa 162–190),

elaphoglossoids (taxa 296–320), and polygrammoids (taxa 342–400) all experienced explosive

radiations during this era (Figure 2). The only exception is the trichomanoid clade (taxa 4–17).

However, given their earliest divergence (at the Jurassic/Cretaceous boundary) well before any

suggestion of modern tropical rain forest establishment (Davis & al., 2005), epiphytic

trichomanoids undoubtedly began to diversify in a different biome, perhaps a precursor to modern

tropical rain forests. Tree ferns, which are shown here to have begun their diversification in the

Jurassic (Figure 2), may have played a prominent role in Cretaceous forests. Although very few

studies have documented host preferences for epiphytic ferns (Moran & al., 2003), trichomanoids

are notable for growing on trunks of tree ferns, more so than any other epiphytic fern lineage.

The precursor to the modern rain forest biome may well have been both warm and

everwet, and even conducive to epiphyte growth. However, based on my data (Figure 2),

Cretaceous forests were not the driving force behind the radiation of epiphytic ferns and therefore

must have lacked the closed, multistratal, angiosperm-dominated canopies characteristic of

Cenozoic rain forests. Such a precursor ecosystem could have allowed for the early

diversification of trichomanoids and even some angiosperm trees (Davis & al., 2005), but was not

the cradle of biodiversity that the tropical rain forest biome is today (Morley, 2000; Richards,

1996; Whitmore, 1998).

Materials and Methods

The data set and most likely phylogeny utilized in this study of leptosporangiate fern

diversification are those from Part I. Detailed protocols for taxonomic sampling, DNA isolation,

amplification, sequencing, alignment, and phylogenetic analysis are provided therein; a list of

47

sampled taxa is presented in Table 5. To obtain 100 bootstrap trees (with branch lengths) for the

current study, a separate non-parametric bootstrap analysis was conducted using RAxML-VI-

HPC 2.2.1 (Stamatakis, 2006). The analysis utilized the GTRMIX model of nucleotide

substitution and the rapid hill-climbing algorithm; model parameters were estimated and

optimized separately for each gene.

Divergence times were estimated for all nodes in the most likely tree, as well as the 100

bootstrap trees, using penalized likelihood in r8s 1.71 (Sanderson, 2002, 2003), incorporating 24

fossil age constraints assigned to nodes using an apomorphy-based approach (Schneider & al.,

2004c; Table 6). The three eusporangiate outgroups were pruned, and the appropriate smoothing

value was independently identified for each of the 101 trees using cross validation (smoothing

values from 1 to 10,000 were considered; for most trees, including the most likely tree, a value of

100 was found to be the most appropriate). Searches for solutions that optimized the penalized

likelihood function were conducted using the truncated Newton algorithm with 10 random starts,

each with 10 random perturbations.

Epiphytism (scoring provided in Table 5) was reconstructed across the 101 dated

phylogenies under maximum likelihood in Mesquite 1.12 (Maddison & Maddison, 2006a). An

asymmetrical 2-parameter Markov k-state model was used (Maddison & Maddison, 2006b), with

rates of change estimated. Ancestral state decisions were made using a threshold of 2 log-

likelihood units.

48

Table 5. Taxonomic sampling and habit information for my study of epiphytic fern diversification. Numbers for sampled taxa correspond to those in Figure 2. For each species, habit (as identified in regional floras) is indicated as either non-epiphytic (N) or epiphytic (E). Voucher information and GenBank accession numbers are provided in Table 2.

# Taxon Habit 400 Grammitis parva (Brause) Copel. E 399 Grammitis hookeri (Brack.) Copel. E 398 Grammitis conjunctisora (Baker) C. Morton E 397 Prosaptia obliquata (Blume) Mett. E 396 Prosaptia contigua (G. Forst.) C. Presl E 395 Ctenopteris nutans J. Sm. E 394 Grammitis poeppigiana (Mett.) Pic. Serm. N 393 Grammitis ciliata Col. E 392 Grammitis deplanchei (Baker) Copel. E 391 Ctenopteris lasiostipes (Mett.) Brownlie E 390 Scleroglossum sulcatum (Kuhn) Alderw. E 389 Ctenopteris repandula Kuntze E 388 Calymmodon gracilis (Fée) Copel. E 387 Micropolypodium taenifolium (Jenman) A. R. Sm. E 386 Micropolypodium hyalinum (Maxon) A. R. Sm. E 385 Chrysogrammitis musgraviana (Baker) Parris E 384 Lellingeria hirsuta A. R. Sm. & R. C. Moran E 383 Lellingeria apiculata (Kunze ex Klotzsch) A. R. Sm. & R. C. Moran E 382 Melpomene moniliformis (Lag. ex Sw.) A. R. Sm. & R. C. Moran N 381 Terpsichore semihirsuta (Klotzsch) A. R. Sm. E 380 Terpsichore anfractuosa (Kunze ex Klotzsch) B. León & A. R. Sm. E 379 Ceradenia pilipes (Hook.) L. E. Bishop E 378 Ceradenia kalbreyeri (Baker) L. E. Bishop E 377 Terpsichore senilis (Fée) A. R. Sm. E 376 Lellingeria schenckii (Hieron.) A. R. Sm. & R. C. Moran E 375 Enterosora parietina (Klotzsch) L. E. Bishop E 374 Cochlidium seminudum (Willd.) Maxon E 373 Grammitis tenella Kaulf. E 372 Adenophorus pinnatifidus Gaudich. E 371 Terpsichore eggersii (Baker ex Hook.) A. R. Sm. E 370 Serpocaulon triseriale (Sw.) A. R. Sm. E 369 Serpocaulon fraxinifolium (Jacq.) A. R. Sm. E 368 Microgramma bifrons (Hook.) Lellinger E 367 Campyloneurum latum T. Moore E 366 Niphidium crassifolium (L.) Lellinger E 365 Pleopeltis polypodioides (L.) E. G. Andrews & Windham E 364 Pleopeltis macrocarpa (Bory ex Willd.) Kaulf. E 363 Pleopeltis sanctae-rosei (Maxon) ined. E 362 Phlebodium decumanum (Willd.) J. Sm. E 361 Pecluma eurybasis (C. Chr.) M. G. Price E 360 Polypodium vulgare L. E 359 Neocheiropteris palmatopedata (Baker) H. Christ E 358 Lemmaphyllum microphyllum C. Presl E

49

357 Belvisia spicata (L. f.) Mirb. E 356 Lepisorus longifolius (Blume) Holttum E 355 Microsorum grossum (Langsd. & Fisch.) S. B. Andrews N 354 Microsorum varians (Mett.) Hennipman & Hett. E 353 Goniophlebium formosanum (Baker) Rödl-Linder E 352 Thylacopteris papillosa (Blume) J. Sm. E 351 Pyrrosia serpens (G. Forst.) Ching E 350 Pyrrosia polydactylis (Hance) Ching E 349 Platycerium stemaria (P. Beauv.) Desv. E 348 Synammia intermedia (Colla) G. Kunkel E 347 Selliguea plantaginea Brack. E 346 Selliguea lanceolata Fée E 345 Arthromeris wallichiana (Spreng.) Ching E 344 Drynaria rigidula (Sw.) Bedd. E 343 Loxogramme abyssinica (Baker) M. G. Price E 342 Dictymia mckeei Tindale E 341 Davallia solida (G. Forst.) Sw. E 340 Davallia griffithiana Hook. E 339 Davallodes borneense (Hook.) Copel. E 338 Araiostegia hymenophylloides (Blume) Copel. E 337 Oleandra articulata (Sw.) C. Presl E 336 Tectaria incisa Cav. N 335 Tectaria antioquoiana (Baker) C. Chr. N 334 Tectaria trifoliata (L.) Cav. N 333 Tectaria prolifera (Hook.) R. M. Tryon & A. F. Tryon N 332 Tectaria fimbriata (Willd.) Proctor & Lourteig N 331 Tectaria apiifolia (Schkuhr) Copel. N 330 Tectaria zeylanica (Houtt.) Sledge N 329 Heterogonium pinnatum (Copel.) Holttum N 328 Triplophyllum funestum (Kunze) Holttum N 327 Psammiosorus paucivenius C. Chr. E 326 Arthropteris parallela C. Chr. N 325 Lomariopsis sorbifolia (L.) Fée N 324 Lomariopsis pollicina (Willemet) Mett. ex Kuhn N 323 Cyclopeltis semicordata (Sw.) J. Sm. N 322 Nephrolepis hirsutula (G. Forst.) C. Presl E 321 Nephrolepis cordifolia (L.) C. Presl E 320 Elaphoglossum hybridum (Bory) Brack. N 319 Elaphoglossum erinaceum (Fée) T. Moore E 318 Elaphoglossum backhousianum T. Moore E 317 Elaphoglossum crinitum (L.) H. Christ E 316 Elaphoglossum lonchophyllum (Fée) T. Moore E 315 Elaphoglossum samoense Brack. E 314 Elaphoglossum papillosum (Baker) H. Christ E 313 Elaphoglossum aubertii (Desv.) T. Moore E 312 Elaphoglossum piloselloides (C. Presl) T. Moore E 311 Elaphoglossum peltatum (Sw.) Urb. E 310 Elaphoglossum moorei (E. Britton) H. Christ E 309 Elaphoglossum tripartitum (Hook ex Grev.) Mickel E 308 Elaphoglossum deltoideum (Sodiro) H. Christ E

50

307 Elaphoglossum huacsaro (Ruiz) H. Christ E 306 Elaphoglossum burchellii (Backer) C. Chr. E 305 Elaphoglossum paleaceum (Hook. & Grev.) Sledge E 304 Elaphoglossum heterolepis (Fée) T. Moore E 303 Elaphoglossum flaccidum (Fée) T. Moore E 302 Elaphoglossum andicola (Fée) T. Moore E 301 Elaphoglossum lechlerianum (Mett.) T. Moore E 300 Elaphoglossum herminieri (Bory ex Fée) T. Moore E 299 Elaphoglossum minutum (Pohl ex Fée) T. Moore N 298 Elaphoglossum lingua (C. Presl) Brack. E 297 Elaphoglossum crassifolium (Gaudich.) W. R. Anderson & Crosby E 296 Elaphoglossum amygdalifolium (Mett. ex Kuhn) H. Christ E 295 Lomagramma guianensis (Aubl.) Ching N 294 Bolbitis nicotianifolia (Sw.) Alston N 293 Teratophyllum wilkesianum (Brack.) Holttum N 292 Bolbitis auriculata (Lam.) Alston N 291 Megalastrum subincisum (Willd.) A. R. Sm. & R. C. Moran N 290 Megalastrum macrotheca (Fée) A. R. Smith & R. C. Moran N 289 Megalastrum biseriale (Baker) A. R. Sm. & R. C. Moran N 288 Rumohra adiantiformis (G. Forst.) Ching E 287 Lastreopsis hispida (Sw.) Tindale N 286 Lastreopsis glabella (A.Cunn. in Hook.) Tindale N 285 Lastreopsis effusa (Sw.) Tindale N 284 Stigmatopteris longicaudata (Liebm.) C. Chr. N 283 Stigmatopteris lechleri (Mett.) C. Chr. N 282 Olfersia cervina (L.) Kunze N 281 Maxonia apiifolia (Sw.) C. Chr. N 280 Polybotrya alfredii Brade N 279 Cyclodium trianae (Mett.) A. R. Sm. N 278 Polystichopsis chaerophylloides (Poir.) C. V. Morton N 277 Dryopteris marginalis (L.) A. Gray N 276 Dryopteris filix-mas (L.) Schott N 275 Dryopteris uniformis (Makino) Makino N 274 Dryopteris crassirhizoma Nakai N 273 Dryopteris expansa (C. Presl) Fraser-Jenk. & Jermy N 272 Dryopteris goldiana (Hook. ex Goldie) A. Gray N 271 Dryopteris squamiseta (Hook.) Kuntze N 270 Dryopteris aemula (Aiton) Kuntze N 269 Dryopteris erythrosora (D. C. Eaton) Kuntze N 268 Arachniodes denticulata (Sw.) Ching N 267 Arachniodes aristata (G. Forst.) Tindale N 266 Polystichum yunnanense H. Christ N 265 Polystichum setiferum (Forssk.) Moore ex Woyn. N 264 Polystichum eximium (Mett. ex Kuhn) C. Chr. N 263 Polystichum transkeiense N. Jacobsen N 262 Polystichum munitum (Kaulf.) C. Presl N 261 Polystichum hillebrandii Carruth. N 260 Polystichum lemmonii Underw. N 259 Polystichum tripteron (Kunze) C. Presl N 258 Cyrtomium falcatum (L. f.) C. Presl N

51

257 Phanerophlebia nobilis (Schltdl. & Cham.) C. Presl N 256 Ctenitis submarginalis (Langsd. & Fisch.) Ching N 255 Ctenitis sp. N 254 Ctenitis sloanei (Poepp. ex Spreng.) C. V. Morton N 253 Leucostegia pallida (Mett.) Copel. E 252 Hypodematium crenatum (Forssk.) Kuhn N 251 Didymochlaena truncatula (Sw.) J. Sm. N 250 Diplazium hachijoense Nakai N 249 Diplazium dilatatum Blume N 248 Diplazium virescens Kunze N 247 Diplazium legalloi Proctor N 246 Diplazium centripetale (Baker) Maxon N 245 Diplazium proliferum (Lam.) Thouars N 244 Diplazium cristatum (Desr.) Alston N 243 Diplazium bombonasae Rosenst. N 242 Diplazium plantaginifolium (L.) Urb. N 241 Diplazium wichurae (Mett.) Diels N 240 Athyrium yokoscense (Franch. & Sav.) H. Christ N 239 Athyrium otophorum (Miq.) Koidz. N 238 Athyrium filix-femina (L.) Roth N 237 Athyrium distentifolium Tausch ex Opiz N 236 Cornopteris decurrenti-alata (Hook.) Nakai N 235 Athyrium niponicum (Mett.) Hance N 234 Deparia lancea (Thunb.) Fraser-Jenk. N 233 Deparia bonincola (Nakai) M. Kato N 232 Deparia petersenii (Kunze) M. Kato N 231 Deparia unifurcata (Baker) M. Kato N 230 Blechnum occidentale L. N 229 Blechnum gracile Kaulf. N 228 Blechnum polypodioides Raddi E 227 Doodia media R. Br. N 226 Blechnum schomburgkii (Klotzsch) C. Chr. N 225 Blechnum spicant (L.) Sm. N 224 Sadleria cyatheoides Kaulf. N 223 Woodwardia virginica (L.) Sm. N 222 Stenochlaena tenuifolia (Desv.) Moore N 221 Salpichlaena volubilis (Kaulf.) J. Sm. N 220 Onoclea sensibilis L. N 219 Woodsia obtusa (Spreng.) Torr. N 218 Thelypteris tylodes (Kunze) Ching N 217 Thelypteris opulenta (Kaulf.) Fosberg N 216 Thelypteris affine (Blume) ined. N 215 Thelypteris sp. N 214 Thelypteris dentata (Forssk.) E. P. St. John N 213 Thelypteris simplex (Hook.) K. Iwats. N 212 Thelypteris longissima (Brack.) C. F. Reed N 211 Thelypteris ovata R. P. St. John N 210 Thelypteris reticulata (L.) Proctor N 209 Thelypteris poiteana (Bory) Proctor N 208 Thelypteris meniscioides (Liebm.) C. F. Reed N

52

207 Thelypteris gemmulifera (Hieron.) A. R. Sm. N 206 Thelypteris abrupta (Desv.) Proctor N 205 Thelypteris glandulosa (Desv.) Proctor N 204 Thelypteris clypeolutata (Desv.) Proctor N 203 Thelypteris limbosperma (All.) H. P. Fuchs N 202 Thelypteris rustica (Fée) Proctor N 201 Thelypteris linkiana (C. Presl) R. M. Tryon N 200 Thelypteris oligocarpa (Humb. & Bonpl. ex Willd.) Ching N 199 Thelypteris gracilis (Heward) Proctor N 198 Thelypteris globulifera (Brack.) C. F. Reed N 197 Thelypteris consanguinea (Fée) Proctor N 196 Thelypteris noveboracensis (L.) Nieuwland N 195 Thelypteris seemannii (Holttum) ined. N 194 Thelypteris palustris (Salisb.) Schott N 193 Pseudophegopteris cruciata (Willd.) Holttum N 192 Phegopteris hexagonoptera (Michx.) Fée N 191 Macrothelypteris torresiana (Gaud.) Ching N 190 Asplenium trichomanes L. N 189 Asplenium monanthes L. E 188 Asplenium normale D. Don N 187 Asplenium platyneuron (L.) Britton, Sterns & Poggenb. N 186 Asplenium foreziense Legrand ex Hérib. N 185 Asplenium pteropus Kaulf. E 184 Asplenium alatum Humb. & Bonpl. ex Willd. E 183 Asplenium harpeodes Kunze E 182 Asplenium abscissum Willd. E 181 Asplenium marinum L. N 180 Asplenium ruta-muraria L. N 179 Asplenium adiantum-nigrum L. N 178 Asplenium scolopendrium L. N 177 Asplenium tenerum G. Forst. E 176 Asplenium formosae H. Christ N 175 Asplenium nidus L. E 174 Asplenium sandersonii Hook. N 173 Asplenium feei Kunze ex Fée E 172 Asplenium theciferum (Kunth) Mett. E 171 Asplenium praemorsum Sw. E 170 Asplenium contiguum Kaulf. E 169 Asplenium planicaule Lowe E 168 Asplenium affine Sw. E 167 Asplenium ritoense Hayata N 166 Asplenium rigidum Sw. E 165 Asplenium auritum Sw. E 164 Asplenium juglandifolium Lam. E 163 Hymenasplenium unilaterale (Lam.) Hayata N 162 Hymenasplenium cheilosorum (Kunze ex Mett.) Tagawa N 161 Hemidictyum marginatum (L.) C. Presl N 160 Gymnocarpium dryopteris (L.) Newman N 159 Cystopteris reevesiana Lellinger N 158 Radiovittaria gardneriana (Fée) E. H. Crane E

53

157 Hecistopteris pumila (Spreng.) J. Sm. E 156 Monogramma graminea (Poir.) Schkuhr E 155 Haplopteris elongata (Sw.) E. H. Crane E 154 Polytaenium cajenense (Desv.) Benedict E 153 Anetium citrifolium (L.) Splitg. E 152 Vittaria graminifolia Kaulf. E 151 Antrophyum latifolium Blume E 150 Adiantum raddianum C. Presl N 149 Adiantum tetraphyllum Humb. & Bonpl. ex Willd. N 148 Adiantum peruvianum Klotzsch N 147 Adiantum tenerum Sw. N 146 Adiantum malesianum J. Ghatak N 145 Adiantum capillus-veneris L. N 144 Adiantum pedatum L. N 143 Pellaea viridis (Forssk.) Prantl N 142 Adiantopsis radiata (L.) Fée N 141 Hemionitis palmata L. N 140 Mildella henryi (H. Christ) C. C. Hall & Lellinger N 139 Aleuritopteris argentea (S. G. Gmel.) Fée N 138 Pentagramma triangularis (Kaulf.) Yatsk., Windham & E. Wollenw. N 137 Notholaena aschenborniana Klotzsch N 136 Paraceterach marantae (L.) R. M. Tryon N 135 Astrolepis sinuata (Lag. ex Sw.) D. M. Benham & Windham N 134 Pellaea truncata Goodd. N 133 Argyrochosma limitanea (Maxon) Windham N 132 Cheilanthes eatonii Baker N 131 Cheilanthes alabamensis (Buckley) Kunze N 130 Bommeria hispida (Mett. ex Kuhn) Underw. N 129 Doryopteris ludens (Wall. ex Hook.) J. Sm. N 128 Pteris multifida Poir. N 127 Pteris cretica L. N 126 Pteris propinqua J. Agardh N 125 Pteris arborea L. N 124 Ochropteris pallens (Sw.) J. Sm. N 123 Pteris quadriaurita Retz. N 122 Pteris argyraea T. Moore N 121 Neurocallis praestantissima Bory ex Fée N 120 Pteris tremula R. Br. N 119 Pteris vittata L. N 118 Platyzoma microphyllum R. Br. N 117 Jamesonia verticalis Kunze N 116 Eriosorus cheilanthoides (Sw.) A. F. Tryon N 115 Pterozonium brevifrons (A. C. Sm.) Lellinger N 114 Pityrogramma jamesonii (Baker) Domin N 113 Pityrogramma austroamericana Domin N 112 Onychium japonicum Blume N 111 Actiniopteris dimorpha Pic. Serm. N 110 Ceratopteris richardii Brongn. N 109 Acrostichum danaeifolium Langsd. & Fisch. N 108 Cryptogramma crispa (L.) R. Br. ex Hook. N

54

107 Coniogramme fraxinea (D. Don) Fée ex Diels N 106 Llavea cordifolia Lag. N 105 Histiopteris incisa (Thunb.) J. Sm. N 104 Blotiella pubescens (Willd. ex Kaulf.) R. M. Tryon N 103 Paesia scaberula (A. Rich) Kuhn N 102 Hypolepis tenuifolia (G. Forst.) Bernh. N 101 Pteridium esculentum (G. Forst.) Nakai N 100 Monachosorum henryi H. Christ N 99 Microlepia speluncae (L.) T. Moore N 98 Microlepia platyphylla (D. Don) J. Sm. N 97 Dennstaedtia punctilobula (Michx.) T. Moore N 96 Leptolepia novae-zelandiae (Col.) Mett. ex Diels N 95 Dennstaedtia dissecta (Sw.) T. Moore N 94 Lindsaea madagascariensis Baker N 93 Lindsaea blotiana K. U. Kramer N 92 Lindsaea quadrangularis Raddi N 91 Sphenomeris chinensis (L.) Maxon N 90 Odontosoria aculeata (L.) J. Sm. N 89 Lonchitis hirsuta L. N 88 Cystodium sorbifolium (Sm.) J. Sm. N 87 Saccoloma inaequale (Kunze) Mett. N 86 Alsophila stelligera (Holtt.) R. M. Tryon N 85 Alsophila hooglandii (Holtt.) R. M. Tryon N 84 Alsophila foersteri (Rosenst.) R. M. Tryon N 83 Alsophila colensoi Hook. f. N 82 Alsophila cuspidata (Kunze) D. S. Conant N 81 Alsophila bryophila R. Tryon N 80 Alsophila dregei (Kunze) R. M. Tryon N 79 Cyathea multiflora Sm. N 78 Cyathea horrida (L.) Sm. N 77 Hymenophyllopsis dejecta (Baker) Goebel N 76 Cyathea poeppigii (Hook.) Domin N 75 Cyathea alata (E. Fourn.) Copel. N 74 Cyathea parvula (Jenm.) Proctor N 73 Alsophila salvinii Hook. N 72 Alsophila ramispina Hook. N 71 Alsophila capensis (L. f.) J. Sm. N 70 Sphaeropteris robusta (Watts) R. M. Tryon N 69 Sphaeropteris medullaris (Forst. f.) Bernh. N 68 Sphaeropteris horrida (Liebm.) R. M. Tryon N 67 Sphaeropteris megalosora (Copel.) R. M. Tryon N 66 Sphaeropteris capitata (Copel.) R. M. Tryon N 65 Sphaeropteris celebica (Blume) R. M. Tryon N 64 Cibotium schiedei Schltdl. & Cham. N 63 Lophosoria quadripinnata (J. F. Gmel.) C. Chr. N 62 Dicksonia antarctica Labill. N 61 Calochlaena villosa (C. Chr.) M. D. Turner & R. A. White N 60 Metaxya rostrata (Kunth.) C. Presl N 59 Loxsomopsis pearcei (Baker) Maxon N 58 Loxoma cunninghamii R. Br. N

55

57 Plagiogyria japonica Nakai N 56 Culcita coniifolia (Hook.) Maxon N 55 Thyrsopteris elegans Kunze N 54 Marsilea mutica Mett. N 53 Marsilea drummondii A. Braun N 52 Pilularia globulifera L. N 51 Salvinia cucullata Roxb. N 50 Azolla pinnata R. Br. N 49 Anemia rotundifolia Schrad. N 48 Anemia phyllitidis (L.) Sw. N 47 Anemia tomentosa (Savigny) Sw. N 46 Anemia adiantifolia (L.) Sw. N 45 Schizaea dichotoma (L.) J. Sm. N 44 Lygodium reticulatum Schkuhr N 43 Lygodium japonicum (Thunb.) Sw. N 42 Sticherus palmatus (W. Schaffn. ex E. Fourn.) Copel. N 41 Sticherus bifidus (Willd.) Ching N 40 Stromatopteris moniliformis Mett. N 39 Gleichenia dicarpa R. Br. N 38 Gleichenella pectinata (Willd.) Ching N 37 Dicranopteris linearis (Burm. f.) Underw. N 36 Diplopterygium bancroftii (Hook.) A. R. Sm. N 35 Phanerosorus sarmentosus (Baker) Copel. N 34 Matonia pectinata R. Br. N 33 Dipteris conjugata Reinw. N 32 Cheiropleuria integrifolia (D. C. Eaton ex Hook.) M. Kato, Y. Yatabe, Sahashi &

N. Murak. N

31 Hymenophyllum fucoides (Sw.) Sw. E 30 Hymenophyllum baileyanum Domin E 29 Hymenophyllum tunbrigense (L.) Sm. E 28 Hymenophyllum sibthorpioides Mett. E 27 Hymenophyllum armstrongii (Baker) Kirk E 26 Hymenophyllum polyanthos (Sw.) Sw. E 25 Hymenophyllum apiculatum Mett. ex Kuhn E 24 Hymenophyllum inaequale (Poir.) Desv. E 23 Hymenophyllum hygrometricum (Poir.) Desv. E 22 Hymenophyllum hirsutum (L.) Sw. E 21 Hymenophyllum digitatum (Sw.) Fosberg E 20 Hymenophyllum nephrophyllum (G. Forst.) Ebihara & K. Iwats. E 19 Hymenophyllum dilatatum (G. Forst.) Sw. E 18 Hymenophyllum cruentum Cav. E 17 Crepidomanes minutum (Blume) K. Iwats. E 16 Crepidomanes bipunctatum (Poir.) Copel. E 15 Crepidomanes thysanostomum (Makino) Ebihara & K. Iwats. N 14 Vandenboschia radicans (Sw.) Copel. E 13 Didymoglossum membranaceum (L.) Vareschi E 12 Didymoglossum krausii (Hook. & Grev.) C. Presl E 11 Didymoglossum ekmanii (Wess. Boer) Ebihara & Dubuisson E 10 Polyphlebium endlicherianum (C. Presl) Ebihara & K. Iwats. E 9 Polyphlebium borbonicum (Bosch) Ebihara & Dubuisson E

56

8 Trichomanes pinnatum Hedw. E 7 Trichomanes crispum L. E 6 Trichomanes ankersii C. Parker ex Hook & Grev. N 5 Cephalomanes javanicum (Blume) C. Presl N 4 Abrodictyum elongatum (A. Cunn.) Ebihara & K. Iwats. N 3 Todea barbara (L.) Moore N 2 Leptopteris wilkesiana (Brack.) H. Christ N 1 Osmunda cinnamomea L. N

57

Table 6. Age constraints utilized in my study of epiphytic fern diversification. The 24 constraints employed here were drawn primarily from two recent studies (Pryer & al., 2004; Schneider & al., 2004c), but have been improved and augmented based on further evaluation. The current study and these earlier studies all relied heavily on reviews of the fern fossil record (e.g., Collinson, 1996, 2001; Skog, 2001; Tidwell & Ash, 1994; Van Konijnenburg-van Cittert, 2002). Fossils were generally used to apply minimum age constraints (corresponding to the upper boundary ages of the stages from which the fossils were recovered; following Gradstein & al., 2004) to nodes subtending their phylogenetic positions (as identified using an apomorphy-based approach; Schneider & al., 2004c). However, the root of the phylogeny was fixed (at the lower boundary of the stage from which applicable fossils were recovered). Note that many fern fossils were not utilized as age constraints in this study either because of uncertainty in their phylogenetic position or redundancy in their application (e.g., if an older constraint was already applied to a more derived node).

# Constraint 1 Permian fossils assignable to the stem of osmundaceous ferns (taxa 1–3, Figure 2,

Table 5); fixed age constraint applied to subtending node (= 299.0 Ma). Grammatopteris, Rastropteris, and other osmundaceous ferns are common from the early Permian onward (Galtier & al., 2001; Miller, 1971; Phipps & al., 1998; Rößler & Galtier, 2002; Tidwell & Ash, 1994), and representatives belonging to the sister group of the osmundaceous ferns (i.e., the clade containing all other extant leptosporangiate ferns) also have first appearances in the Permian (e.g., Szea; Yao & Taylor, 1988). Leptosporangiate ferns from the Carboniferous cannot be readily assigned to either osmundaceous ferns or their sister group, but are instead representatives of an early radiation that yielded several now-extinct lineages (Lovis, 1977; Rothwell, 1987; Stewart & Rothwell, 1993). Based on the sum of this evidence, it seems quite certain that the earliest divergence within the extant leptosporangiate fern lineage occurred near the Carboniferous-Permian boundary.

2 Upper Triassic fossils assignable to the stem of Osmunda (taxon 1, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 199.6 Ma). Osmunda fossils have been described from the Upper Triassic (Phipps & al., 1998), marking its divergence from the other osmundaceous fern genera.

3 Middle Triassic fossils assignable to the stem of Matoniaceae (taxa 34–35, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 228.0 Ma). Tomaniopteris fossils assignable to the Matoniaceae are described from the Middle Triassic (Klavins & al., 2004), marking the divergence between the Matoniaceae and Dipteridaceae.

4 Albian (Lower Cretaceous) fossils assignable to the stem of a Gleicheniaceae subclade (taxa 39–42, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 99.6 Ma). A fossil Gleichenia (Herendeen & Skog, 1998) is definitively assignable to the clade consisting of Gleichenia, Sticherus, and Stromatopteris (today the genus Gleichenia is more narrowly defined).

5 Turonian (Upper Cretaceous) fossils assignable to the stem of Stromatopteris (taxon 40, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 89.3 Ma). Two analyses of morphological data (Gandolfo & al., 1997; Herendeen & Skog, 1998) found the fossil genus Boodlepteris to be sister to the extant genus Stromatopteris.

6 Bajocian (Middle Jurassic) fossils assignable to the stem of Lygodium (taxa 43–44, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 167.7 Ma). A sister group relationship has been demonstrated between the fossil Stachypteris (Van Konijnenburg-van Cittert, 1981) and the extant genus Lygodium (Wikström & al.,

58

2002). 7 Valanginian (Lower Cretaceous) fossils assignable to the stem of an Anemia subclade

(taxa 47–49, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 136.4 Ma). There is considerable evidence for the inclusion of the fossils Pelletixia and Ruffordia within the Anemia crown group (Dettmann & Clifford, 1992; Skog, 1992; Wikström & al., 2002), as sister to one of the two primary clades. Thus, these Lower Cretaceous fossils provide a minimum age for diversification within Anemia.

8 Berriasian (Lower Cretaceous) fossils assignable to the stem of Marsileaceae (taxa 52–54, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 140.2 Ma). The fossil Regnellites (most conservatively from Berriasian strata; Yamada & Kato, 2002) is allied to Marsileaceae, and is therefore used to constrain the divergence of this family from the Salviniaceae.

9 Santonian (Upper Cretaceous) fossils assignable to the stem of Azolla (taxon 50, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 83.5 Ma). Based on the presence of megaspore floats, the fossil Glomerisporites is assigned to the Azolla lineage, and marks the divergence between Azolla and Salvinia (Batten & al., 1998).

10 Santonian (Upper Cretaceous) fossils assignable to the stem of Pilularia (taxon 52, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 83.5 Ma). The fossil Regnellidium upatoensis (Lupia & al., 2000) is assignable to the extant genus Regnellidium (not sampled here, but sister to Pilularia; Pryer, 1999). It is used here to constrain the divergence between Pilularia and Marsilea.

11 Aptian (Lower Cretaceous) fossils assignable to the stem of Loxomataceae (taxa 58–59, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 112.0 Ma). The fossil Loxsomopteris is considered to be a stem group member of the Loxomataceae (Skog, 1976).

12 Aptian (Lower Cretaceous) fossils assignable to the stem of Lophosoria (taxon 63, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 112.0 Ma). The fossils Lophosoria cupulatus (Cantrill, 1998) and Conantiopteris (Lantz & al., 1999) are allied to extant Lophosoria.

13 Upper Jurassic fossils assignable to the stem of scaly tree ferns (taxa 65–86, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 145.5 Ma). Species of Cyathocaulis (including Upper Jurassic C. naktongensis and C. yabei; Tidwell & Nishida, 1993) are stem members of the scaly tree fern clade (Lantz & al., 1999), a position that is supported by the presence of a medullated dictyostele.

14 Cenomanian (Upper Cretaceous) fossils assignable to the stem of the Cyathea/Alsophila clade (taxa 71–86, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 93.5 Ma). Spores like those of the fossil Kuylisporites are found only in some species of Cyathea and Alsophila (Gastony & Tryon, 1976; Mohr & Lazarus, 1994), marking the divergence between these and the other scaly tree fern genus, Sphaeropteris.

15 Albian (Lower Cretaceous) fossils assignable to the stem of lindsaeoids (taxa 90–94, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 99.6 Ma). Based on root anatomy, an unnamed fossil is assignable to the lindsaeoids (Schneider & Kenrick, 2001).

16 Cenomanian (Upper Cretaceous) fossils assignable to the stem of Pteridaceae (taxa 106–158, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 93.5 Ma). A fossil Pteris (Krassilov & Bacchia, 2000) is assignable to the Pteridaceae stem (not necessarily the extant genus Pteris).

17 Maastrichtian (Upper Cretaceous) fossils assignable to the stem of the

59

Ceratopteris/Acrostichum clade (taxa 109–110, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 65.5 Ma). A fossil Acrostichum (Bonde & Kumaran, 2002) is assignable to the Ceratopteris/Acrostichum clade (not necessarily the extant genus Acrostichum).

18 Bartonian (Eocene) fossils assignable to the stem of Ceratopteris (taxon 110, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 37.2 Ma). The fossil spore genus Magnastriatites, with a first occurrence in the middle Eocene, is allied to Ceratopteris (Dettmann & Clifford, 1992).

19 Campanian (Upper Cretaceous) fossils assignable to the stem of the Dennstaedtia/Leptolepia/Microlepia clade (taxa 95–99, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 70.6 Ma). The fossil genus Microlepiopsis (Serbet & Rothwell, 2003) is allied to this dennstaedtioid clade.

20 Paleocene fossils assignable to the stem of Onoclea (taxon 220, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 55.8 Ma). Nearly complete fossils assignable to Onoclea sensibilis (an extant species) have been recovered from the Paleocene (Rothwell & Stockey, 1991).

21 Paleocene fossils assignable to the stem of Woodwardia (taxon 223, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 55.8 Ma). Fossils assignable to Woodwardia are known from throughout the Tertiary, beginning in the Paleocene (Collinson, 2001).

22 Eocene fossils assignable to the stem of the cyclosoroid clade (taxa 204–218, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 33.9 Ma). Cyclosorus fossils from the Eocene are assignable to this large clade within the Thelypteridaceae (Barthel, 1976; Collinson, 2001).

23 Bartonian (Eocene) fossils assignable to the stem of the athyrioid clade (taxa 231–250, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 37.2 Ma). Based on anatomical features, the fossil genus Makopteris is assignable to the athyrioid clade (Stockey & al., 1999).

24 Eocene fossils assignable to the stem of Polypodiaceae (taxa 342–400, Figure 2, Table 5); minimum age constraint applied to subtending node (≥ 33.9 Ma). The oldest fossil definitively assignable to the Polypodiaceae is Protodrynaria (Van Uffelen, 1991), marking the divergence of this family from the Davalliaceae.

60

Figure 2. Epiphytic fern diversification. Phylogenetic chronogram results from maximum likelihood analysis of three plastid genes sequenced for each of 400 taxa (Table 5) followed by penalized likelihood analysis incorporating 24 fossil constraints (Table 6); maximum likelihood reconstructions of epiphytism across this tree are shown. Major epiphytic clades are indicated with thumbnail silhouettes (resulting from modification, with permission, of illustrations by B. Manara in Berry & al., 1995). Plots of divergences through time summarize the results of penalized likelihood analyses of, and maximum likelihood reconstructions across, 100 bootstrap trees; for each 10 Ma interval, the interquartile range (dark colors) and the complete span (light colors) of observed divergences are indicated. Black vertical line (i.e., K/T boundary) and black portion of time scale (i.e., Cenozoic) indicate origin and incidence (respectively) of modern tropical rain forests as suggested by fossil data (Burnham & Johnson, 2004; Jacobs, 2004; Johnson & Ellis, 2002; Morley, 2000; Tiffney, 1984; Upchurch & Wolfe, 1987, 1993; Wheeler & Baas, 1991; Wing & Boucher, 1998; Wing & Tiffney, 1987; Wolfe & Upchurch, 1987); gray vertical line and gray portion of time scale indicate earlier origin and incidence of modern tropical rain forests as inferred from divergence-time estimates for a clade of rain forest trees (Davis & al., 2005).

Triassic

Paleozoic Mesozoic

Permian Jurassic Cretaceous

Cenozoic

Paleogene Neogene

0 Ma100 Ma200 Ma300 Ma

K/T boundary

0

100

200

400

300

Sam

pled

taxa

Polygrammoids

Elaphoglossoids

AsplenioidsVittarioids

Hymenophylloids

Trichomanoids

Polypods

Eupolypods

Tree ferns

Pteroids

Filmy ferns

Triassic

Paleoz. Mesozoic

Perm. Jurassic Cretaceous

Cenozoic

P. N.

0 Ma100 Ma200 Ma300 Ma

0

10

20

30

40

50

0

10

20

30

40

0

10

60

K/T boundary

Div

erge

nces

per

boo

tstr

ap tr

ee (

by h

abit)

Epiphytic

Ambiguous

Non-epiphytic

61

62

PART III

FURTHER INSIGHT INTO THE EVOLUTION AND DIVERSIFICATION OF

SEED-FREE VASCULAR PLANTS

Other Contributions

During my time as a graduate student at Duke University, I enjoyed several

collaborations and made substantial contributions to seven studies, in addition to the two

publications that set the stage for my dissertation work (Pryer & al., 2004; Schneider & al.,

2004c). Some of these studies were more closely related to the evolution and diversification of

epiphytic ferns than others, but all had at least some connection to the evolution and

diversification of seed-free vascular plants.

Schneider & Schuettpelz (2006) demonstrated the feasibility of DNA-based

identification for fern gametophytes. Using plastid DNA sequences, we were able to successfully

determine the phylogenetic affinities of a sterile gametophyte of unknown origin. This approach

promises to improve our understanding of differences in gametophyte and sporophyte

distributions and abundances, and could contribute greatly to our understanding of fern ecology.

Schuettpelz & Hoot (2006) focused on inferring the phylogenetic root of the lycopsid

genus Isoëtes, a difficult problem due to the remarkable morphological and genetic uniformity

within the genus and the considerable morphological and genetic disparity between Isoëtes and its

closest living relative (Selaginella). Using an expanded set of taxa, multiple molecular markers,

and a variety of analytical approaches, we identified the root of Isoëtes to be located among three

major, well-supported clades.

Schuettpelz & Pryer (2006) aimed to uncover the factors responsible for the extreme

rbcL branch length disparity observed between the two main filmy fern clades. Analyses

63

indicated it was due to a significant difference in molecular evolutionary rate at this locus and

pointed to a substantial rate slow-down in one of the clades. Further analysis ruled out selection

as a culprit and instead suggested that a genome-wide deceleration in the rate of nucleotide

substitution was responsible.

Schuettpelz & Trapnell (2006) revealed an extraordinary level of epiphyte diversity, as

encountered during an exhaustive survey of vascular epiphytes on a single mature canopy tree in

Costa Rica. A total of 126 morphospecies (representing at least 52 genera and 21 plant families)

were found growing epiphytically on the host tree, accounting for more than one percent of the

entire vascular flora of Costa Rica.

Schuettpelz & al. (2006) explored the phylogenetic utility of the plastid atpA gene. An

atpA data set—obtained using newly designed primers—had more variable characters than any of

the other single gene data sets examined. Analysis of these data resulted in an especially robust

hypothesis of fern relationships, and suggested that atpA would be exceptionally useful in more

extensive studies of fern phylogeny and perhaps also in studies of other plant lineages.

Schuettpelz & al. (2007) examined the phylogeny of the Pteridaceae, a leptosporangiate

family that accounts for roughly 10% of extant fern diversity and occupies an unusually broad

range of ecological niches. Our broad-scale and multi-gene phylogenetic analyses resolved five

major clades within the Pteridaceae, and revealed the phylogenetic affinities of several previously

unsampled genera.

Smith & al. (2006b) presented a revised classification for extant ferns combining the

principle of monophyly with a desire to maintain well-established names. The classification

reflects our current understanding of fern phylogeny and recognizes 11 orders and 37 families

within ferns.

64

Future Prospects

The phylogeny resulting from my dissertation research is by far the most comprehensive

and well-supported to date, providing an unparalleled framework within which to explore the

evolution and diversification of leptosporangiate ferns. I have utilized this phylogeny herein to

reconstruct the evolutionary history of epiphytism and assess the timing of epiphytic fern

diversification. However, there are countless other ecological, morphological, and even genomic

traits that could—and should—be examined in the future. Reconstructions of these traits across

the phylogeny now in hand will provide further insight into the origins of fern diversity, and may

well reveal previously unidentified synapomorphies for major leptosporangiate clades. Such

reconstructions will of course also shed light on the evolution of the traits themselves.

Although it is clear from my analyses that the epiphytic habit has evolved numerous

times within leptosporangiate ferns, the morphological and ecological innovations associated with

the transition to epiphytism are still largely unknown. Furthermore, the evolutionary origins of

epiphytism are poorly understood—epiphytic species may have evolved from rupestral, climbing,

or strictly terrestrial ancestors. The future reconstructions described above will help me to

identify the origins of epiphytism and determine what innovations may have facilitated the

evolution of this trait.

65

REFERENCES

Barthel, M. 1976. Farne und Cycadeen. Abhandlungen des Zentralen Geologischen Institutes 26: 1–507.

Batten, D. J., Collinson, M. E. & Brain, A. P. R. 1998. Ultrastructural interpretation of the Late Cretaceous megaspore Glomerisporites pupus and its associated microspores, American Journal of Botany 85: 724–735.

Benzing, D. H. 1990. Vascular Epiphytes. Cambridge University Press, Cambridge, UK.

Berry, P. E., Holst, B. K. & Yatskievych, K. (eds.). 1995. Flora of the Venezuelan Guayana, Vol. 2, Pteridophytes and Spermatophytes (Acanthaceae to Araceae). Missouri Botanical Garden Press, St. Louis, MO, and Timber Press, Portland, OR.

Bonde, S. D. & Kumaran, K. P. N. 2002. The oldest macrofossil record of the mangrove fern Acrostichum L. from the Late Cretaceous Deccan Intertrappean beds of India. Cretaceous Research 23: 149–152.

Brenner, G. J. 1996. Evidence for the earliest stage of angiosperm pollen evolution: a paleoequatorial section from Israel. Pp. 91–115 in: Taylor, D. W. & Hickey, L. J. (eds.), Flowering Plant Origin, Evolution, and Phylogeny. Chapman and Hall, New York, NY.

Burnham, R. J. & Johnson, K. R. 2004. South American palaeobotany and the origins of neotropical rainforests. Philosophical Transactions of the Royal Society of London B: Biological Sciences 359: 1595–1610.

Cantrill, D. J. 1998. Early Cretaceous fern foliage from President Head, Snow Island, Antarctica. Alcheringa 22: 241–258.

Collinson, M. E. 1996. “What use are fossil ferns” - 20 years on: with a review of the fossil history of extant pteridophyte families and genera. Pp. 349-394 in: Camus, J. M., Gibby, M. & Johns, R. J. (eds.), Pteridology in Perspective. Royal Botanic Gardens, Kew.

Collinson, M. E. 2001. Cainozoic ferns and their distribution. Brittonia 53: 172-235.

Conant, D. S., Raubeson, L. A., Attwood, D. K. & Stein, D. B. 1995. The relationships of Papuasian Cyatheaceae to New World tree ferns. American Fern Journal 85: 328–340.

Conant, D. S., Raubeson, L. A., Attwood, D. K., Perera, S., Zimmer, E. A., Sweere, J. A. & Stein, D. B. 1996. Phylogenetic and evolutionary implications of combined analysis of DNA and morphology in the Cyatheaceae. Pp. 231–248 in: Camus, J. M. Gibby, M. & Johns, R. J. (eds.), Pteridology in Perspective. Royal Botanic Gardens, Kew.

Crane, E. H., Farrar, D. R. & Wendel, J. F. 1995. Phylogeny of the Vittariaceae: convergent simplification leads to a polyphyletic Vittaria. American Fern Journal 85: 283–305.

66

Crane, P. R. 1987. Vegetational consequences of angiosperm diversification. Pp. 107–144 in: Friis, E. M., Chaloner, W. G. & Crane, P. R. (eds.). The Origin of Angiosperms and Their Biological Consequences. Cambridge University Press, Cambridge, UK.

Crane, P. R., Friis, E. M. & Pederson, K. R. 1995. The origin and early diversification of angiosperms. Nature 374: 27–33.

Cranfill, R. B. 2001. Phylogenetic Studies in the Polypodiales (Pteridophyta) with an Emphasis on the Family Blechnaceae. Ph.D. thesis, University of California, Berkeley, California.

Cranfill, R. & Kato, M. 2003. Phylogenetics, biogeography, and classification of the woodwardioid ferns (Blechnaceae). Pp. 25–48 in: Chandra, S. & Srivastava, M. (eds.). Pteridology in the New Millenium. Kluwer Academic Publishers, Dordrecht.

Davis, C. C., Webb, C. O., Wurdack, K. J., Jaramillo, C. A. & Donoghue, M. J. 2005. Explosive radiation of Malpighiales supports a mid-Cretaceous origin of modern tropical rain forests. American Naturalist 165: E36–E65.

Dettmann, M. E. & Clifford, T. 1992. Phylogeny and biogeography of Ruffordia, Mohria and Anemia (Schizaeaceae) and Ceratopteris (Pteridaceae): evidence from in situ and dispersed spores. Alcheringa 16: 269-314.

Dubuisson, J.-Y. 1997. rbcL sequences: a promising tool for the molecular systematics of the fern genus Trichomanes (Hymenophyllaceae)? Molecular Phylogenetics and Evolution 8: 128–138.

Dubuisson, J.-Y. Hennequin, S., Douzery, E. J. P., Cranfill, R. B., Smith, A. R. & Pryer, K. M. 2003a. rbcL phylogeny of the fern genus Trichomanes (Hymenophyllaceae), with special reference to neotropical taxa. International Journal of Plant Sciences 164: 753–761.

Dubuisson, J.-Y., Hennequin, S., Rakotondrainibe, F. & Schneider, H. 2003b. Ecological diversity and adaptive tendencies in the tropical fern Trichomanes L. (Hymenophyllaceae) with special reference to climbing and epiphytic habits. Botanical Journal of the Linnean Society 142: 41-63.

Ebihara, A., Dubuisson, J.-Y., Iwatsuki, K., Hennequin, S. & Ito, M. 2006. A taxonomic revision of Hymenophyllaceae. Blumea 51: 221–280.

Ebihara, A., Hennequin, S., Iwatsuki, K., Bostock, P. D., Matsumoto, S., Jaman, R., Dubuisson, J.-Y. & Ito, M. 2004. Polyphyletic origin of Microtrichomanes (Prantl) Copel. (Hymenophyllaceae), with a revision of the species. Taxon 53: 935–948.

Ebihara, A., Iwatsuki, K., Kurita, S. & Ito, M. 2002. Systematic position of Hymenophyllum rolandi-principis Rosenst. or a monotypic genus Rosenstockia Copel. (Hymenophyllaceae) endemic to New Caledonia. Acta Phytotaxonomica et Geobotanica 53: 35–49.

Galtier, J., Wang, S. J., Li, C. S. & Hilton, J. 2001. A new genus of filicalean fern from the Lower Permian of China. Botanical Journal of the Linnean Society 137: 429–442.

67

Gandolfo, M. A., Nixon, K. C., Crepet, W. L. & Ratcliffe, G. E. 1997. A new fossil fern assignable to Gleicheniaceae from Late Cretaceous sediments of New Jersey. American Journal of Botany 84: 483-493.

Gastony, G. J. & Johnson, W. P. 2001. Phylogenetic placements of Loxoscaphe thecifera (Aspleniaceae) and Actiniopteris radiata (Pteridaceae) based on analysis of rbcL nucleotide sequences. American Fern Journal 91: 197–213.

Gastony, G. J. & Rollo, D. R. 1995. Phylogeny and generic circumscriptions of cheilanthoid ferns (Pteridaceae: Cheilanthoideae) inferred from rbcL nucleotide sequences. American Fern Journal 85: 341–360.

Gastony, G. J. & Rollo, D. R. 1998. Cheilanthoid ferns (Pteridaceae: Cheilanthoideae) in the southwestern United States and adjacent Mexico—a molecular phylogenetic reassessment of generic lines. Aliso 17: 131–144.

Gastony, G. J. & Tryon, R. M. 1976. Spore morphology in the Cyatheaceae. II. The genera Lophosoria, Metaxya, Sphaeropteris, Alsophila, and Nephelea. American Journal of Botany 63: 738–758.

Gastony, G. J. & Ungerer, M. C. 1997. Molecular systematics and a revised taxonomy of the onocleoid ferns (Dryopteridaceae: Onocleeae). American Journal of Botany 84: 840–849.

Geiger, J. M. O. & Ranker, T. A. 2005. Molecular phylogenetics and historical biogeography of Hawaiian Dryopteris (Dryopteridaceae). Molecular Phylogenetics and Evolution 34: 392–407.

Gentry, A. H. & Dodson, C. H. 1987. Diversity and biogeography of neotropical vascular epiphytes. Annals of the Missouri Botanical Garden 74: 205–233.

Gradstein, F. M., Ogg, J. G. & Smith, A. G. 2004. A Geologic Time Scale. Cambridge University Press, Cambridge, UK.

Hasebe, M., Ito, M., Kofuji, R., Ueda, K. & Iwatsuki, K. 1993. Phylogenetic relationships of ferns deduced from rbcL gene sequence. Journal of Molecular Evolution 37: 476–482.

Hasebe, M., Omori, T., Nakazawa, M., Sano, T., Kato, M. & Iwatsuki, K. 1994. rbcL gene sequences provide evidence for the evolutionary lineages of leptosporangiate ferns. Proceedings of the National Academy of Sciences of the United States of America 91: 5730–5734.

Hasebe, M., Wolf, P. G., Pryer, K. M., Ueda, K., Ito, M., Sano, R., Gastony, G. J., Yokoyama, J., Manhart, J. R., Murakami, N., Crane, E. H., Haufler, C. H. & Hauk, W. D. 1995. Fern phylogeny based on rbcL nucleotide sequences. American Fern Journal 85: 134–181.

Haufler, C. H., Grammer, W. A., Hennipman, E., Ranker, T. A., Smith, A. R. & Schneider, H. 2003. Systematics of the ant-fern genus Lecanopteris (Polypodiaceae): testing phylogenetic hypotheses with DNA sequences. Systematic Botany 28: 217–227.

68

Hennequin, S., Ebihara, A., Ito, M., Iwatsuki, K. & Dubuisson, J.-Y. 2003. Molecular systematics of the fern genus Hymenophyllum s.l. (Hymenophyllaceae) based on chloroplastic coding and noncoding regions. Molecular Phylogenetics and Evolution 27: 283–301.

Hennequin, S., Ebihara, A., Ito, M., Iwatsuki, K. & Dubuisson, J.-Y. 2006a. New insights into the phylogeny of the genus Hymenophyllum s.l. (Hymenophyllaceae): revealing the polyphyly of Mecodium. Systematic Botany 31: 271–284.

Hennequin, S., Ebihara, A., Ito, M., Iwatsuki, K. & Dubuisson, J.-Y. 2006b. Phylogenetic systematics and evolution of the genus Hymenophyllum (Hymenophyllaceae: Pteridophyta). Fern Gazette 17: 247–257.

Hennipman, E., Veldhoen, P. & Kramer, K. U. 1990. Polypodiaceae. Pp. 203–230 in: Kramer, K. U. & Green, P. S. (vol. eds.). The Families and Genera of Vascular Plants. Vol. 1. Pteridophytes and Gymnosperms. Springer-Verlag, Berlin.

Herendeen, P. S. & Skog, J. E. 1998. Gleichenia chaloneri—a new fossil fern from the Lower Cretaceous (Albian) of England. International Journal of Plant Sciences 159: 870–879.

Hirohara, M., Nakane, T., Terayama, Y., Kobayashi, A., Arai, Y., Masuda, K., Hamashima, H., Shiojima, K. & Ageta, H. 2000. Chemotaxonomy of ferns: triterpenoids and rbcL gene sequences of Polypodium, Polypodiodes and Goniophlebium. Natural Medicines 54: 330–333.

Holttum, R. E. 1986. Studies in the fern-genera allied to Tectaria Cav. VI. A conspectus of genera in the Old World regarded as related to Tectaria, with descriptions of two genera. Gardens' Bulletin (Singapore) 39: 153–167.

Jacobs, B. F. 2004. Palaeobotanical studies from tropical Africa: relevance to the evolution of forest, woodland and savannah biomes. Philosophical Transactions of the Royal Society of London B: Biological Sciences 359: 1573–1583.

Janssen, T. & Schneider, H. 2005. Exploring the evolution of humus collecting leaves in drynarioid ferns (Polypodiaceae, Polypodiidae) based on phylogenetic evidence. Plant Systematics and Evolution 252: 175–197.

Jarrett, F. M. 1980. Studies in the classification of the leptosporangiate ferns: I. The affinities of the Polypodiaceae sensu stricto and the Grammitidaceae. Kew Bulletin 34: 825–833.

Johnson, K. R. & Ellis, B. 2002. A tropical rainforest in Colorado 1.4 million years after the Cretaceous-Tertiary boundary. Science 296: 2379–2383.

Judd, W. S., Campbell, C. S., Kellogg, E. A., Stevens, P. F. & Donoghue, M. J. 2002. Plant Systematics: A Phylogenetic Approach, Second Edition. Sinauer Associates, Sunderland, MA.

Kato, M., Yatabe, Y., Sahashi, N. & Murakami, N. 2001. Taxonomic studies of Cheiropleuria (Dipteridaceae). Blumea 46: 513–525.

Kato, M., & Setoguchi, H. 1998. An rbcL-based phylogeny and heteroblastic leaf morphology of Matoniaceae. Systematic Botany 23: 391–400.

69

Klavins, S. D., Taylor, T. N. & Taylor, E. L. 2004. Matoniaceous ferns (Gleicheniales) from the Middle Triassic of Antarctica. Journal of Paleontology 78: 211-217.

Korall, P., Conant, D. S., Metzgar, J. S., Schneider, H. & Pryer, K. M. 2007. A molecular phylogeny of scaly tree ferns (Cyatheaceae). American Journal of Botany: in press.

Korall, P., Conant, D. S., Schneider, H., Ueda, K., Nishida, H. & Pryer, K. M. 2006a. On the phylogenetic position of Cystodium: It's not a tree fern—it's a polypod! American Fern Journal 96: 45–53.

Korall, P., Pryer, K. M., Metzgar, J. S., Schneider, H. & Conant, D. S. 2006b. Tree ferns: monophyletic groups and their relationships as revealed by four protein-coding plastid loci. Molecular Phylogenetics and Evolution 39: 830–845.

Kramer, K. U. 1990. Oleandraceae. Pp. 190–193 in: Kramer, K. U. & Green, P. S. (vol. eds.). The Families and Genera of Vascular Plants. Vol. 1. Pteridophytes and Gymnosperms. Springer-Verlag, Berlin.

Kramer, K. U., Holttum, R. E., Moran, R. C. & Smith, A. R. 1990. Dryopteridaceae. Pp. 101–144 in: Kramer, K. U. & Green, P. S. (vol. eds.). The Families and Genera of Vascular Plants. Vol. 1. Pteridophytes and Gymnosperms. Springer-Verlag, Berlin.

Krassilov, V. & Bacchia, F. 2000. Cenomanian florule of Nammoura, Lebanon. Cretaceous Research 21: 785–799.

Kreier, H.-P. & Schneider, H. 2006a. Phylogeny and biogeography of the staghorn fern genus Platycerium (Polypodiaceae, Polypodiidae). American Journal of Botany 93: 217–225.

Kreier, H.-P. & Schneider, H. 2006b. Reinstatement of Loxogramme dictyopteris for a New Zealand endemic fern known as Anarthropteris lanceolata based on phylogenetic evidence. Australian Systematic Botany 19: 309–314.

Kress, W. J. 1986. The systematic distribution of vascular epiphytes: an update. Selbyana 9: 2–22.

Lantz, T. C., Rothwell, G. W. & Stockey, R. A. 1999. Conantiopteris schuchmanii, gen. et sp. nov., and the role of fossils in resolving the phylogeny of Cyatheaceae s.l. Journal of Plant Research 112: 361-381.

Li, C.-X. & Lu, S.-G. 2006. Phylogenetic analysis of Dryopteridaceae based on chloroplast rbcL sequences. Acta Phytotaxonomica Sinica 44: 503–515.

Li, C.-X., Lu, S.-G. & Yang, Q. 2004. Asian origin for Polystichum (Dryopteridaceae) based on rbcL sequences. Chinese Science Bulletin 49: 1146–1150.

Lidgard, S. & Crane, P. R. 1990. Angiosperm diversification and Cretaceous floristic trends: a comparison of palynofloras and leaf macrofloras. Paleobiology 16: 77–93.

Little, D. P. & Barrington, D. S. 2003. Major evolutionary events in the origin and diversification of the fern genus Polystichum (Dryopteridaceae). American Journal of Botany 90: 508–514.

70

Lovis, J. D. 1977. Evolutionary patterns and processes in ferns. Advances in Botanical Research 4: 229–415.

Lupia, R., Lidgard, S. & Crane, P. R. 1999. Comparing palynological abundance and diversity: implications for biotic replacement during the Cretaceous angiosperm radiation. Paleobiology 25: 305–340.

Lupia, R., Schneider, H., Moeser, G. M., Pryer, K. M. & Crane, P. R. 2000. Marsileaceae sporocarps and spores from the Late Cretaceous of Georgia, U. S. A. International Journal of Plant Sciences 161: 975-988.

Mabberley, D. J. 1997. The Plant Book: A Portable Dictionary of the Vascular Plants. Cambridge University Press, Cambridge, UK.

Maddison, D. R. & Maddison, W. P. 2005. MacClade 4: Analysis of phylogeny and character evolution. Version 4.08. Sinauer Associates, Sunderland, Massachusetts.

Maddison, W. P. & Maddison, D. R. 2006a. Mesquite: A Modular System for Evolutionary Analysis, Version 1.12. http://mesquiteproject.org.

Maddison, W. P. & Maddison, D. R. 2006b. StochChar: A Package of Mesquite Modules for Stochastic Models of Character Evolution, Version 1.1. http://mesquiteproject.org.

Manhart, J. R. 1994. Phylogenetic analysis of green plant rbcL sequences. Molecular Phylogenetics and Evolution 3: 114–127.

Masuyama, S., Yatabe, Y., Murakami, N. & Watano, Y. 2002. Cryptic species in the fern Ceratopteris thalictroides (L.) Brongn. (Parkeriaceae). I. Molecular analyses and crossing tests. Journal of Plant Research 115: 87–97.

Metzgar, J. S., Schneider, H. & Pryer, K. M. 2007. Phylogeny and divergence time estimates for the fern genus Azolla (Salviniaceae). International Journal of Plant Sciences: in press.

Miller, C. N. 1971. Evolution of the fern family Osmundaceae based on anatomical studies. Contributions from the Museum of Paleontology University of Michigan 28: 105–169.

Moffett, M. W. 2000. What’s “up”? A critical look at the basic terms of canopy biology. Biotropica 32: 569–596.

Mohr, B. A. R. & Lazarus, D. B. 1994. Paleobiogeographic distribution of Kuylisporites and its possible relationship to the extant fern genus Cnemidaria (Cyatheaceae). Annals of the Missouri Botanical Garden 81: 758–767.

Moran, R. C., Klimas, S. & Carlsen, M. 2003. Low-trunk epiphytic ferns on tree ferns versus angiosperms in Costa Rica. Biotropica 35: 48–56.

Morley, R. J. 2000. Origin and Evolution of Tropical Rain Forests. John Wiley and Sons, Chichester, UK.

Murakami, N., Nogami, S., Watanabe, M. & Iwatsuki, K. 1999. Phylogeny of Aspleniaceae inferred from rbcL nucleotide sequences. American Fern Journal 89: 232–243.

71

Murakami, N. & Schaal, B. A. 1994. Chloroplast DNA variation and the phylogeny of Asplenium sect. Hymenasplenium (Aspleniaceae) in the New World tropics. Journal of Plant Research 107: 245–251.

Nakahira, Y. 2000. A Molecular Phylogenetic Analysis of the Family Blechnaceae, Using the Chloroplast Gene rbcL. M.S. thesis, Graduate School of Science, Univ. Tokyo, Tokyo.

Nakazato, T. & Gastony, G. J. 2003. Molecular phylogenetics of Anogramma species and related genera (Pteridaceae: Taenitidoideae). Systematic Botany 28: 490–502.

Nagalingum, N. S., Drinnan, A. N., Lupia, R. & McLoughlin, S. 2002. Fern spore diversity and abundance in Australia during the Cretaceous. Review of Palaeobotany and Palynology 119: 69–92.

Nagalingum, N. S., Schneider, H. & Pryer, K. M. 2007. Molecular phylogenetic relationships and morphological evolution in the heterosporous fern genus Marsilea. Systematic Botany 32: 16–25.

Nieder, J., Engwald, S. & Barthlott, W. 1999. Patterns of neotropical epiphyte diversity. Selbyana 20: 66–75.

Niklas, K. J., Tiffney, B. H. & Knoll, A. H. 1985. Patterns in vascular land plant diversification: a factor analysis at the species level. Pp. 97–128 in: Valentine, J. W. (ed.). Phanerozoic Diversity Patterns: Profiles in Macroevolution. Princeton University Press, Princeton.

Palmer, J. D., Soltis, D. E. & Chase, M. W. 2004. The plant tree of life: an overview and some points of view. American Journal of Botany 91: 1437–1445.

Parris, B. S. 1990. Grammitidaceae. Pp. 153–156 in: Kramer, K. U. & Green, P. S. (vol. eds.). The Families and Genera of Vascular Plants. Vol. 1. Pteridophytes and Gymnosperms. Springer-Verlag, Berlin.

Perrie, L. R. & Brownsey, P. J. 2005. Insights into the biogeography and polyploid evolution of New Zealand Asplenium from chloroplast DNA sequence data. American Fern Journal 95: 1–21.

Phipps, C. J., Taylor, T. N., Taylor, E. L., Cuneo, N. R., Boucher, L. D. & Yao, X. 1998. Osmunda (Osmundaceae) from the Triassic of Antarctica: an example of evolutionary stasis. American Journal of Botany 85: 888–895.

Pinter, I., Bakker, F., Barrett, J., Cox, C., Gibby, M., Henderson, S., Morgan-Richards, M., Rumsey, F., Russell, S., Trewick, S., Schneider, H. & Vogel, J. 2002. Phylogenetic and biosystematic relationships in four highly disjunct polyploid complexes in the subgenera Ceterach and Phyllitis in Asplenium (Aspleniaceae). Organisms, Diversity, and Evolution 2: 299–311.

Pryer, K. M. 1999. Phylogeny of marsileaceous ferns and relationships of the fossil Hydropteris pinnata reconsidered. International Journal of Plant Sciences 160: 931–954.

72

Pryer, K. M., Schneider, H., Smith, A. R., Cranfill, R., Wolf, P. G., Hunt, J. S. & Sipes, S. D. 2001a. Horsetails and ferns are a monophyletic group and the closest living relatives to seed plants. Nature 409: 618–622.

Pryer, K. M., Schuettpelz, E., Wolf, P. G., Schneider, H., Smith, A. R. & Cranfill, R. 2004. Phylogeny and evolution of ferns (monilophytes) with a focus on the early leptosporangiate divergences. American Journal of Botany 91: 1582–1598.

Pryer, K. M., Smith, A. R. & Skog, J. E. 1995. Phylogenetic relationships of extant ferns based on evidence from morphology and rbcL sequences. American Fern Journal 85: 205–282.

Pryer, K. M., Smith, A. R., Hunt, J. S. & Dubuisson, J.-Y. 2001b. rbcL data reveal two monophyletic groups of filmy ferns (Filicopsida: Hymenophyllaceae). American Journal of Botany 88: 1118–1130.

Ranker, T. A., Geiger, J. M. O., Kennedy, S. C., Smith, A. R., Haufler, C. H. & Parris, B. S. 2003. Molecular phylogenetics and evolution of the endemic Hawaiian genus Adenophorus (Grammitidaceae). Molecular Phylogenetics and Evolution 26: 337–347.

Ranker, T. A., Smith, A. R., Parris, B. S., Geiger, J. M. O., Haufler, C. H., Straub, S. C. K. & Schneider, H. 2004. Phylogeny and evolution of grammitid ferns (Grammitidaceae): a case of rampant morphological homoplasy. Taxon 53: 415–428.

Reid, J. D., Plunkett, G. M. & Peters, G. A. 2006. Phylogenetic relationships in the heterosporous fern genus Azolla (Azollaceae) based on DNA sequence data from three noncoding regions. International Journal of Plant Sciences 167: 529–538.

Richards, P. W. 1996. The Tropical Rain Forest: An Ecological Study. Cambridge University Press, Cambridge, UK.

Rößler R. & Galtier J. 2002. First Grammatopteris tree ferns from the Southern Hemisphere—new insights in the evolution of the Osmundaceae from the Permian of Brazil. Review of Palaeobotany and Palynology 121: 205–230.

Rothwell, G. W. 1987. Complex Paleozoic Filicales in the evolutionary radiation of ferns. American Journal of Botany 74: 458–461.

Rothwell, G. W. & Stockey, R. A. 1991. Onoclea sensibilis in the Paleocene of North America, a dramatic example of structural and ecological stasis. Review of Palaeobotany and Palynology 70: 113–124.

Rouhan, G., Dubuisson, J.-Y., Rakotondrainibe, F., Motley, T. J., Mickel, J. T., Labat, J.-N. & Moran, R. C. 2004. Molecular phylogeny of the fern genus Elaphoglossum (Elaphoglossaceae) based on chloroplast non-coding DNA sequences: contributions of species from the Indian Ocean area. Molecular Phylogenetics and Evolution 33: 745–763.

Sánchez-Baracaldo, P. 2004. Phylogenetic relationships of the subfamily Taenitoideae, Pteridaceae. American Fern Journal 94: 126–142.

73

Sanderson, M. J. 2002. Estimating absolute rates of molecular evolution and divergence times: a penalized likelihood approach. Molecular Biology and Evolution 19: 101–109.

Sanderson, M. J. 2003. r8s: inferring absolute rates of molecular evolution and divergence times in the absence of a molecular clock. Bioinformatics 19: 301–302.

Sano, R., Takamiya, M., Ito, M., Kurita, S. & Hasebe, M. 2000. Phylogeny of the lady fern group, tribe Physematieae (Dryopteridaceae), based on chloroplast rbcL gene sequences. Molecular Phylogenetics and Evolution 15: 403–413.

Schneider, H., Janssen, T., Hovenkamp, P., Smith, A. R., Cranfill, R., Haufler, C. H. & Ranker, T. A. 2004a. Phylogenetic relationships of the enigmatic Malesian fern Thylacopteris (Polypodiaceae, Polypodiidae). International Journal of Plant Sciences 165: 1077–1087.

Schneider, H. & Kenrick, P. 2001. The first record of lindsaeoid ferns (Lindsaeaceae, Polypodiidae) from the Lower Cretaceous of Wyoming (Aspen Shale, Albian). Review of Palaeobotany and Palynology 115, 33–41.

Schneider, H., Kreier, H.–P., Perrie, L. R. & Brownsey, P. J. 2006a. The relationships of Microsorum (Polypodiaceae) species occurring in New Zealand. New Zealand Journal of Botany 44: 121-127.

Schneider, H., Kreier, H.-P., Wilson, R. & Smith, A. R. 2006b. The Synammia enigma: evidence for a temperate lineage of polygrammoid ferns (Polypodiaceae, Polypodiidae) in southern South America. Systematic Botany 31: 31–41.

Schneider, H., Ranker, T. A., Russell, S. J., Cranfill, R., Geiger, J. M. O., Aguraiuja, R., Wood, K. R., Grundmann, M., Kloberdanz, K. & Vogel, J. C. 2005. Origin of the endemic fern genus Diellia coincides with the renewal of Hawaiian terrestrial life in the Miocene. Proceedings of the Royal Society B: Biological Sciences 272: 455–460.

Schneider, H., Russell, S. J., Cox, C. J., Bakker, F., Henderson, S., Gibby, M. & Vogel, J. C. 2004b. Chloroplast phylogeny of asplenioid ferns based on rbcL and trnL-F spacer sequences (Polypodiidae, Aspleniaceae) and its implications for the biogeography. Systematic Botany 29: 260–274.

Schneider, H. & Schuettpelz, E. 2006. Identifying fern gametophytes using DNA sequences. Molecular Ecology Notes 6: 989–991.

Schneider, H., Schuettpelz, E., Pryer, K. M., Cranfill, R., Magallón, S. & Lupia, R. 2004c. Ferns diversified in the shadow of angiosperms. Nature 428: 553–557.

Schneider, H., Smith, A. R., Cranfill, R., Haufler, C. H., Ranker, T. A. & Hildebrand, T. 2002. Gymnogrammitis dareiformis is a polygrammoid fern (Polypodiaceae)—resolving an apparent conflict between morphological and molecular data. Plant Systematics and Evolution 234: 121–136.

Schneider, H., Smith, A. R., Cranfill, R., Hildebrand, T. E., Haufler, C. H. & Ranker, T. A. 2004d. Unraveling the phylogeny of polygrammoid ferns (Polypodiaceae and Grammitidaceae): exploring aspects of the diversification of epiphytic plants. Molecular Phylogenetics and Evolution 31: 1041–1063.

74

Schuettpelz, E. & Hoot, S. B. 2006. Inferring the root of Isoëtes: exploring alternatives in the absence of an acceptable outgroup. Systematic Botany 31: 258–270.

Schuettpelz, E., Korall, P., & Pryer, K. M. 2006. Plastid atpA data provide improved support for deep relationships among ferns. Taxon 55: 897–906.

Schuettpelz, E. & Pryer, K. M. 2006. Reconciling extreme branch length differences: decoupling time and rate through the evolutionary history of filmy ferns. Systematic Biology 55: 485–502.

Schuettpelz E., Schneider, H., Huiet, L., Windham, M. D. & Pryer, K. M. 2007. A molecular phylogeny of the fern family Pteridaceae: assessing overall relationships and the affinities of previously unsampled genera. Molecular Phylogenetics and Evolution: in press.

Schuettpelz, E. & Trapnell, D. W. 2006. Exceptional epiphyte diversity on a single tree in Costa Rica. Selbyana 27: 65–71.

Serbet, R. & Rothwell, G. W. 2003. Anatomically preserved ferns from the Late Cretaceous of western North America: Dennstaedtiaceae. International Journal of Plant Sciences 164: 1041–1051.

Shinohara, W., Takamiya, M. & Murakami, N. 2003. Taxonomic study of Japanese Deparia petersenii (Woodsiaceae) based on cytological and molecular information. Acta Phytotaxonomica et Geobotanica 54: 137-148.

Skog, J. E. 1976. Loxsomopteris anasilla, a new fossil fern rhizome from the Cretaceous of Maryland. American Fern Journal 66: 8-14.

Skog, J. E. 1992. The Lower Cretaceous ferns in the genus Anemia (Schizaeaceae), Potomac Group of Virginia, and relationships within the genus. Review of Palaeobotany and Palynology 70: 279-295.

Skog, J. E. 2001. Biogeography of Mesozoic leptosporangiate ferns related to extant ferns. Brittonia 53: 236-269.

Skog, J. E., Mickel, J. T., Moran, R. C., Volovsek, M., Zimmer, E. A. 2004. Molecular studies of representative species in the fern genus Elaphoglossum (Dryopteridaceae) based on cpDNA sequences rbcL, trnL-F, and rps4-trnS. International Journal of Plant Sciences 165: 1063–1075.

Skog, J. E., Zimmer, E. & Mickel, J. T. 2002. Additional support for two subgenera of Anemia (Schizaeaceae) from data for the chloroplast intergenic spacer region trnL-F and morphology. American Fern Journal 92: 119–130.

Smith, A. R. 1972. Comparison of fern and flowering plant distributions with some evolutionary interpretations for ferns. Biotropica 4: 4–9.

Smith, A. R. 1990. Thelypteridaceae. Pp. 263–272 in: Kramer, K. U. & Green, P. S. (vol. eds.). The Families and Genera of Vascular Plants. Vol. 1. Pteridophytes and Gymnosperms. Springer-Verlag, Berlin.

75

Smith, A. R. 1995. Non-molecular phylogenetic hypotheses for ferns. American Fern Journal 85: 104–122.

Smith, A. R. & Cranfill, R. B. 2002. Intrafamilial relationships of the thelypteroid ferns (Thelypteridaceae). American Fern Journal 92: 131–149.

Smith, A. R., Kreier, H.-P., Haufler, C. H., Ranker, T. A. & Schneider, H. 2006a. Serpocaulon (Polypodiaceae), a new genus segregated from Polypodium. Taxon 55: 919–930.

Smith, A. R., Pryer, K. M., Schuettpelz, E., Korall, P., Schneider, H. & Wolf, P. G. 2006b. A classification for extant ferns. Taxon 55: 705–731.

Smith, A. R., Tuomisto, H., Pryer, K. M., Hunt, J. S. & Wolf, P. G. 2001. Metaxya lanosa, a second species in the genus and fern family Metaxyaceae. Systematic Botany 26: 480–486.

Stamatakis, A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–2690.

Stewart, W. N. & Rothwell, G. W. 1993. Paleobotany and the Evolution of Plants. Cambridge University Press, Cambridge, UK.

Stockey, R. A., Nishida, H. & Rothwell, G. W. 1999. Permineralized ferns from the Middle Eocene Princeton chert. I. Makopteris princetonensis gen. et sp. nov. (Athyriaceae). International Journal of Plant Sciences 160: 1047–1055.

Tidwell, W. D. & Ash, S. R. 1994. A review of selected Triassic to Early Cretaceous ferns. Journal of Plant Research 107: 417–442.

Tidwell, W. D. & Nishida, H. 1993. A new fossilized tree fern stem, Nishidacaulis burgii gen. et sp. nov., from Nebraska-South Dakota, USA. Review of Palaeobotany and Palynology 78: 55–67.

Tiffney, B. H. 1984. Seed size, dispersal syndromes, and the rise of the angiosperms: evidence and hypothesis. Annals of the Missouri Botanical Garden 71: 551–576.

Trevisan, L. 1988. Angiospermous pollen (monosulcate-trichotomosulcate phase) from the very early Lower Cretaceous of southern Tuscany (Italy): some aspects. P. 165 in: 7th International Palynological Congress, Brisbane, Abstracts.

Tsutsumi, C. & Kato, M. 2005. Molecular phylogenetic study on Davalliaceae. Fern Gazette 17: 147–162.

Tsutsumi, C. & Kato, M. 2006. Evolution of epiphytes in Davalliaceae and related ferns. Botanical Journal of the Linnean Society 151: 495–510.

Upchurch, G. R. & Wolfe, J. A. 1987. Mid-Cretaceous to Early Tertiary vegetation and climate: evidence from fossil leaves and woods. Pp. 75–105 in: Friis, E. M., Chaloner, W. G. & Crane, P. R. (eds.), The Origins of Angiosperms and Their Biological Consequences. Cambridge University Press, Cambridge, UK

76

Upchurch, G. R. & Wolfe, J. A. 1993. Cretaceous vegetation of the western interior and adjacent regions of North America. Pp. 243–281 in: Caldwell, W. G. E. & Kauffman, E. G. (eds.), Evolution of the Western Interior Basin. Geological Association of Canada, St. Johns, Canada.

Van Konijnenburg-van Cittert, J. H. A. 1981. Schizaeaceous spores in situ from the Jurassic of Yorkshire, England. Review of Palaeobotany and Palynology 33: 169-181.

Van Konijnenburg-van Cittert, J. H. A. 2002. Ecology of some Late Triassic to Early Cretaceous ferns in Eurasia. Review of Palaeobotany and Palynology 119: 113-124.

Van Uffelen, G. A. 1991. Fossil Polypodiaceae and their spores. Blumea 36: 253–272.

Vangerow, S., Teerkorn, T. & Knoop, V. 1999. Phylogenetic information in the mitochondrial nad5 gene of pteridophytes: RNA editing and intron sequences. Plant Biology 1: 235–243.

Wang, M.-L., Chen, Z.-D., Zhang, X.-C, Lu, S.-G. & Zhao, G.-F. 2003. Phylogeny of the Athyriaceae: evidence from chloroplast trnL-F region sequences. Acta Phytotaxonomica Sinica 41: 416–426.

Wheeler, E. A. & Baas, P. 1991. A survey of the fossil record for dicotyledonous wood and its significance for evolutionary and ecological wood anatomy. IAWA Bulletin New Series 12: 275–332.

Whitmore, T. C. 1998. An Introduction to Tropical Rain Forests. Oxford University Press, Oxford, UK.

Wikström, N., Kenrick, P. & Vogel, J. C. 2002. Schizaeaceae: a phylogenetic approach. Review of Palaeobotany and Palynology 119: 35–50.

Wikström, N. & Pryer, K. M. 2005. Incongruence between primary sequence data and the distribution of a mitochondrial atp1 group II intron among ferns and horsetails. Molecular Phylogenetics and Evolution 36: 484–493.

Wing, S. L. & Boucher, L. D. 1998. Ecological aspects of the Cretaceous flowering plant radiation. Annual Review of Earth and Planetary Sciences 26: 379–421.

Wing, S. L. & Tiffney, B. H. 1987. Interactions of angiosperms and herbivorous tetrapods through time. Pp. 203–225 in: Friis, E. M., Chaloner, W. G. & Crane, P. R. (eds.), The Origins of Angiosperms and Their Biological Consequences. Cambridge University Press, Cambridge, UK.

Wolf, P. G. 1995. Phylogenetic analyses of rbcL and nuclear ribosomal RNA gene sequences in Dennstaedtiaceae. American Fern Journal 85: 306–327.

Wolf, P. G. 1996. Pteridophyte phylogenies based on analysis of DNA sequences: a multiple gene approach. Pp. 203–215 in: Camus, J. M., Gibby, M. & Johns, R. J. (eds.), Pteridology in Perspective. Royal Botanic Gardens, Kew, UK.

77

Wolf, P. G. 1997. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes. American Journal of Botany 84: 1429–1440.

Wolf, P. G., Rowe, C. A., Sinclair, R. B. & Hasebe, M. 2003. Complete nucleotide sequence of the chloroplast genome from a leptosporangiate fern, Adiantum capillus-veneris L. DNA Research 10: 59–65.

Wolf, P. G., Sipes, S. D., White, M. R., Martines, M. L., Pryer, K. M., Smith, A. R. & Ueda, K. 1999. Phylogenetic relationships of the enigmatic fern families Hymenophyllopsidaceae and Lophosoriaceae: evidence from rbcL nucleotide sequences. Plant Systematics and Evolution 219: 263–270.

Wolf, P. G., Soltis, P. S. & Soltis, D. E. 1994. Phylogenetic relationships of dennstaedtioid ferns: evidence from rbcL sequences. Molecular Phylogenetics and Evolution 3: 383–392.

Wolfe, J. A. & Upchurch, G. R. 1987. North American nonmarine climates and vegetation during the Late Cretaceous. Palaeogeography, Palaeoclimatology, Palaeoecology 61: 33–77.

Yamada, T. & Kato, M. 2002. Regnellites nagashimae gen. et sp. nov., the oldest macrofossil of Marsileaceae, from the Upper Jurassic to Lower Cretaceous of Western Japan. International Journal of Plant Sciences 163: 715–722.

Yao, Z. & Taylor, T. N. 1988. On a new gleicheniaceous fern from the Permian of South China. Review of Palaeobotany and Palynology 54: 121-134.

Yatabe, Y., Nishida, H. & Murkami, N. 1999. Phylogeny of Osmundaceae inferred from rbcL nucleotide sequences and comparison to the fossil evidence. Journal of Plant Research 112: 397–404.

Zhang, G., Zhang, X. & Chen, Z. 2005. Phylogeny of cryptogrammoid ferns and related taxa based on rbcL sequences. Nordic Journal of Botany 23: 485–493.

78

BIOGRAPHY

Eric Schuettpelz

Born 13 March 1977 in Waukesha, Wisconsin, USA

Education 2001–2007 Ph.D., Biology

Department of Biology, Duke University Dissertation: The evolution and diversification of epiphytic ferns Advisor: Dr. Kathleen M. Pryer

1999–2001 M.S., Biological Sciences

Department of Biological Sciences, University of Wisconsin—Milwaukee Thesis: Phylogenetic relationships within Caltha (Ranunculaceae) based on three molecular data sets and morphology Advisor: Dr. Sara B. Hoot

1995–1999 B.S., Biological Sciences

Department of Biological Sciences, University of Wisconsin—Milwaukee Honors Degree; Italian minor; Summa cum laude

Grants, Fellowships, and Awards 2004–2007 Doctoral Dissertation Improvement Grant (Evolution and diversification of

epiphytic ferns), co-PI with K. M. Pryer, DEB-0408077, National Science Foundation

2006 Edgar T. Wherry Award (for the best paper presented during the contributed

papers session of the Pteridological Section), Botanical Society of America Pteridological Section and the American Fern Society

2006 Lawrence Memorial Award, Hunt Institute for Botanical Documentation,

Carnegie Mellon University 2006 Botanical Society of America Pteridological Section Student Travel Award 2004–2005 Conference Travel Awards (2), Graduate School, Duke University 2003–2005 Deep Time Research Coordination Network Travel Awards (4) 2005 Rogers McVaugh Graduate Student Research Grant, American Society of Plant

Taxonomists 2005 International Research Travel Award, Graduate School, Duke University

79

2003–2004 A.W. Mellon Plant Systematics Program Graduate Student Fellowship, Department of Biology, Duke University

2001–2004 Deep Gene Research Coordination Network Travel Awards (2) 2001–2004 A. W. Mellon Plant Systematics Program Awards (6), Department of Biology,

Duke University 2003 Society of Systematic Biologists Graduate Student Research Award 2002 Organization for Tropical Studies Post-Course Research Award 2000–2001 Graduate School Fellowship, University of Wisconsin—Milwaukee 2000 Joseph G. Baier Memorial Scholarship, Department of Biological Sciences,

University of Wisconsin—Milwaukee

Refereed Publications 12. Schuettpelz, E., Schneider, H., Huiet, L., Windham, M. D. & Pryer, K. M. A molecular

phylogeny of the fern family Pteridaceae: assessing overall relationships and the affinities of previously unsampled genera. Molecular Phylogenetics and Evolution: accepted 15 April 2007.

11. Schuettpelz, E. & Pryer, K. M. Fern phylogeny inferred from 400 leptosporangiate

species and three plastid genes. Taxon: accepted 29 March 2007. 10. Schuettpelz, E., Korall, P. & Pryer, K. M. 2006. Plastid atpA data provide improved

support for deep relationships among ferns. Taxon 55: 897–906. 9. Schneider, H. & Schuettpelz, E. 2006. Identifying fern gametophytes using DNA

sequences. Molecular Ecology Notes 6: 989–991. 8. Smith, A. R., Pryer, K. M., Schuettpelz, E., Korall, P., Schneider, H. & Wolf, P. G.

2006. A classification for extant ferns. Taxon 55: 705–731. 7. Schuettpelz, E. & Trapnell, D. W. 2006. Exceptional epiphyte diversity on a single tree

in Costa Rica. Selbyana 27: 65–71. 6. Schuettpelz, E. & Pryer, K. M. 2006. Reconciling extreme branch length differences:

decoupling time and rate through the evolutionary history of filmy ferns. Systematic Biology 55: 485–502.

5. Schuettpelz, E. & Hoot, S. B. 2006. Inferring the root of Isoëtes: exploring alternatives

in the absence of an acceptable outgroup. Systematic Botany 31: 258–270. 4. Pryer, K. M., Schuettpelz, E., Wolf, P. G., Schneider, H., Smith, A. R. & Cranfill, R.

2004. Phylogeny and evolution of ferns (monilophytes) with a focus on the early leptosporangiate divergences. American Journal of Botany 91: 1582–1598.

80

3. Schneider, H., Schuettpelz, E., Pryer, K. M., Cranfill, R., Magallón, S. & Lupia, R. 2004.

Ferns diversified in the shadow of angiosperms. Nature 428: 553–557. 2. Schuettpelz, E. & Hoot, S. B.. 2004. Phylogeny and biogeography of Caltha

(Ranunculaceae) based on chloroplast and nuclear DNA sequences. American Journal of Botany 91: 247–253.

1. Schuettpelz, E., Hoot, S. B., Samuel, R. & Ehrendorfer, F. 2002. Multiple origins of

Southern Hemisphere Anemone (Ranunculaceae) based on plastid and nuclear sequence data. Plant Systematics and Evolution 231: 143–151.