Texas Tech University, Sayani Mallick, July 2016 · Texas Tech University, Sayani Mallick, July...
Transcript of Texas Tech University, Sayani Mallick, July 2016 · Texas Tech University, Sayani Mallick, July...
Texas Tech University, Sayani Mallick, July 2016 CHARACTERIZATION OF ARABIDOPSIS PYRABACTIN–LIKE ABA RECEPTOR
(PYL4 AND PYL7) AND TRANSCRIPTION FACTOR (RAV AND ABI5)
ACTIVITIES IN TRANSIENTLY TRANSFORMED NICOTIANA BENTHAMIANA
AND STABLE TRANSGENIC LINES OF COTTON (GOSSYPIUM HIRSUTUM)
By
SAYANI MALLICK B.Sc. (Honors), M.Sc.
A THESIS
IN
BIOLOGICAL SCIENCES
Submitted to the Graduate Faculty
of Texas Tech University in
Partial Fulfillment of
the requirements for
the Degree of
MASTER OF SCIENCE
Approved
Dr. Christopher D Rock
Chairperson of the Committee
Dr. Jane Dever
Dr. Jatindra N. Tripathy
July,2016
1
Texas Tech University, Sayani Mallick, July 2016
Copyright © 2016, SAYANI MALLICK
2
Texas Tech University, Sayani Mallick, July 2016
ACKNOWLEDGEMENTS
To begin with, I would like to thank my PI - Dr. Christopher Rock for his time,
effort, support, and guidance. I would also like to acknowledge him for his help in
shaping my thesis document. I would also like to thank my committee members, Dr. Jane
Dever her help and assistance and Dr Jatindra Tripathy for his encouragement and
support.
My cordial thanks to Dr. Densmore, Dr.Chesser and Dr. Holaday for
supporting me with a Teaching Assistantship.
I would also like to thank all my past and present lab members. I specifically
acknowledge Dr.Fan Jia, who made the UPS cDNA donor::pKYLX acceptor constructs for
RAV1, ABI5, PYL4 and PYL7 that I used in my transient expression assay studies and were
the means to make the stably transformed cotton lines studied by others in collaboration with
Dr. John Burke, Plant Germplasm and Stress Lab, USDA Lubbock. I gratefully acknowledge
Dr. Justin Fiene, who made available to me for analysis of stomatal density his epidermal
peel images of transgenic cotton lines RAV11-1-5
, ABI513-4-1
and ABI51-1-1
provided to him
as a collaboration with the Rock lab. The images were subject material for his Ph.D. studies
at Texas A&M University on stomatal dynamics of cotyledonary leaves in response to
drought stress. I also specifically acknowledge Dr. Amandeep Mittal for sharing with me his
unpublished photosynthetic parameter assay data for these same transgenic lines grown in the
greenhouse and subjected to drought stress. Chapter 5 in my thesis is drawn in part from their
gifts of data for my analysis and interpretation. Chapter 5 has been developed by me, Drs.
Fiene, Dever, and Rock into a
ii
Texas Tech University, Sayani Mallick, July 2016
manuscript for publication with Dr. Fiene as co-first author, and Dr. Mittal as co-author.
I hereby declare that except for these disclosed portions of my thesis drawn from co-
author contributions of data, all other work is originated by me.
iii
Texas Tech University, Sayani Mallick, July 2016
TABLE OF CONTENTS
ACKNOWLEDGEMENTS……………………………………………………………..ii
ABSTRACT…………………….………………………………………….…………...ix
LIST OF TABLES…………………………………………………..…………………xii
LIST OF FIGURES…………………………………………….………………………xiii
CHAPTER 1
I. INTRODUCTION, BACKGROUND, HYPOTHESIS, OBJECTIVES ............1
1.1 General Introduction ................................................................................................................ 1
1.1.1 ABA Gene Expression ........................................................................................................ 2
1.1.2 ABA Signaling ....................................................................................................................... 5
1.1.3 ABA response elements and post-translational modifications ................................. 7
1.1.4 ABA agonists .......................................................................................................................... 9
1.1.5 ABA receptors: monomeric and dimeric ....................................................................... 13
1.1.6 ABA signaling transcription factors ................................................................................. 15
1.2 Background………………………………………………………………………..15
1.2.1 Hypotheses ............................................................................................................................... 15
1.2.2 Specific Objectives ................................................................................................................ 16
iv
Texas Tech University, Sayani Mallick, July 2016
CHAPTER 2
II. MATERIALS AND METHODS .......................................................................................19
2.1 Plant Material ............................................................................................................................ 19
2.2 Sampling procedures ................................................................................................................ 19
2.3 Primer Design ……........................................................................... ......................... 23
2.3.1 Polymerase Chain Reaction (PCR)…………………………………………..... 23
2.3.1 GUS histochemical Assay ................................................................................................... 23
2.3.2 GUS Fluorometric Assay ..................................................................................................... 23
2.3.3 Microscopy .............................................................................................................................. 24
2.4 BLAST ......................................................................................................................................... 25
2.4.1 Total RNA Extraction and Quantification ...................................................................... 25
2.4.2 Northern Blot analysis .......................................................................................................... 25
2.4.3 Northern Probe design .......................................................................................................... 26
2.4.4 Radiolabelling ......................................................................................................................... 28
2.5 Protein Analysis ......................................................................................................................... 28
2.5.1 Total protein extraction ........................................................................................................ 28
2.5.2 Protein concentration (Bradford) Assay .......................................................................... 29
2.5.3 SDS-PAGE .............................................................................................................................. 29
2.5.4 Analyses of the relative protein concentration using western blots ........................ 30
2.6 Guard cell morphology……………………………………………………………31
2.7 Statistical Analyses ……………………………………………………………….31
v
Texas Tech University, Sayani Mallick, July 2016
CHAPTER 3
III. STUDIES ON THE UTILITY OF THE NICOTIANA BENTHAMIANA
TRANSIENT EXPRESSION SYSTEM
3.1 INTRODUCTION………………………………………………………….39 3.2 RESULTS AND DISCUSSION……………………………………………41 3.2.1
Pilot Experiment for transient assays: to test the system and parameters of time by GUS
histochemical assay and GFP (reporter enzyme assays)………………41
3.2.2 Control experiments for establishment of Nicotiana benthamiana transient assay
system at protein level by Immunoblot, an important parameter for interpreting effector
activities…………………………………………………………………………44
3.2.3 Validate the time point parameter of response of the effectors with an independent
vector construct p201G_Cas9……………………………………………………47
CHAPTER 4
IV. STUDIES ON PYL4 AND PYL7 AND ABA INDUCTION IN
N. BENTHAMIANA AND STABLY TRANSFORMED COTTON
4.1 INTRODUCTION……………………………………………………………49
4.2 RESULTS …………………………………………………………………….51
4.2.1 Bidirectional clustering of Arabidopsis ABA receptor PYRL gene expression
intensity and experimental treatments/genotypes…………………………………51
vi
Texas Tech University, Sayani Mallick, July 2016
4.2.2 ABA induction experiment: A result at a 1 hour time-point depicting ABA
induction by Northern blot…………………………………………………….52
4.2.3 Results for various effector’s activity towards transactivation of endogenous
readout NtERD10 (GV2260)…………………………………………………..54
4.2.4 Results for various effectors' activity towards transactivation of probe NtERD10
(GV3101)………………………………………………………………………57
4.2.5 Results for various effector’s activity towards transactivation of endogenous
readout TAS14 (GV2260)………………………………………………………58
4.2.6 Results for various effector’s activity towards transactivation of endogenous
readout LEA (GV2260)…………………………………………………………60
4.2.7 Summary of comparative analysis of Fold Induction quantified by Northern blots by
three ABA-inducible endogenous reporter genes………………………………..64
4.2.8 Positive Control immunoblot for c-myc Mab C9E10……………………...66 4.2.9 Immunoblot with Monoclonal antibody c-myc for effectors in protein extracts from
N.benthamiana……………………………………………………………………67
4.2.10 Approach for phenotypic segregations in PYL cotton stable transgenics…68
4.3 DISCUSSION…………………………………………………………………77
vii
Texas Tech University, Sayani Mallick, July 2016
CHAPTER 5.
V. CHARACTERIZATION OF RAV1 AND ABI5 DROUGHT-STRESS
PHENOTYPES IN COTYLEDONS AND LEAVES OF TRANSGENIC COTTON
5.1. INTRODUCTION, BACKGROUND, HYPOTHESIS, OBJECTIVES ................ 79
5.2 RESULTS…………………………………………………………………………81
5.2.1 Characterization of transgene protein accumulation in cotton seeds……………81
5.2.2 RAV11-1-5
cotyledonary leaves have higher stomatal density and smaller guard cell
apertures during drought stress and recovery………………………………………….84
5.2.3 RAV11-1-5
and ABI51-1-1
mature leaves have higher stomatal conductance and
photosynthetic rates under drought stress……………………………………………...86
5.3 DISCUSSION……………………………………………………………………...88
CHAPTER 6
VI. CONCLUSION AND FUTURE DIRECTIONS
6.1 CONCLUSION……………………………………………………………………92 6.2 Future Directions…………………………………………………………………..94
REFERENCES……………………………………………………………………100
viii
Texas Tech University, Sayani Mallick, July 2016
ABSTRACT
Abscisic acid (ABA) is a plant hormone that regulates numerous developmental
processes and adaptive stress responses in plants. Although many ABA signaling
components have been identified, understanding in the functional and structural
conservation of ABA signaling networks across species remains to be elucidated. The
family of homologous proteins encoding pyrabactin resistance (PYR), pyrabactin
resistance 1-like (PYL), and regulatory component of ABA receptor (RCAR) have been
discovered by forward genetic screens in Arabidopsis and shown to function as ABA
receptors.
The main objective of this study is to test the functions of select PYL ABA receptors
and downstream transcription factors in heterologous systems (cotton, tobacco) to gain
insight into conserved ABA signaling modules in plants. The transient expression of
Arabidopsis effectors of ABA signaling in .Nicotiana benthamiana and upland cotton,
Gossypium hirsutum, was undertaken to gain deeper insights into the utility of ABA
receptors and transcription factors for genetic engineering of agronomic traits such as stress
adaptation or stress avoidance to improve yields and seed value. The potential significance
is a deeper understanding of efficacy and molecular mechanisms of deeply conserved ABA
gene effectors. I found via RNA blot analysis that AtPYL7 overexpression results in agonist
(inductive) ABA signaling activity in N. benthamiana. AtRAV1, a known ABA
transcription factor (TF) and positive effector of ABA sensitivity also showed similar
agonist activity on endogenous ABA-inducible gene
ix
Texas Tech University, Sayani Mallick, July 2016
expression of Late Embryogenesis Abundant (LEA) in N. benthamiana. The results were
strengthened by comparative data analysis across three endogenous LEA target genes
with significant inductive correlations across genes that were of similar magnitude of
agonist activity as exogenous ABA treatment of N. benthamiana leaves. I further
correlated protein expression for these effectors to functional effects via immunoblots.
These data together at the transcriptional and translational levels support the claim that
Nicotiana benthamiana transient assays are a robust and facile system to functionally
characterize the various effectors of ABA signaling pathways and study their molecular
interactions.
In previous studies from the Rock lab, transgenic cotton (Gossypium hirsutum
L.) that over-express cDNAs encoding the Arabidopsis transcription factors Related to
ABA-Insensitive3/Vivivparous1 (AtRAV1/2), encoding a B3 domain class TF,and ABA-
Insensitive5 (AtABI5), a bZIP class TF, showed improved photosynthesis in the field and
greater root and leaf biomass under deficit irrigation. We investigated a subset of these
transgenic lines to further characterize RAV1 and ABI5 expression at the protein level in
seeds and to address mechanisms of drought tolerance and adaptation by morphological
and physiological assays of cotyledonary leaves and greenhouse-grown plants subjected
to drought stress. I hypothesized that the transgenic lines may have enhanced responses
to abscisic acid (ABA), resulting in greater water use efficiency under drought stress. I
measured stomatal density whereas Dr. Fiene and collaborators measured absolute and
relative sizes (i.e. pore area/guard cell area) of guard cell apertures. I characterized
transgene expression in seeds by immunoblot. AtRAV1 cotyledons had significantly
higher stomatal densities, and 26% smaller guard cell apertures than control line
x
Texas Tech University, Sayani Mallick, July 2016
Coker312 under drought stress, raising the possibility that smaller guard cell pores and
greater stomatal densities may contribute to water use efficiencies measured in AtRAV1
plants in the greenhouse and field. These results are consistent with the hypothesis that
over-expression of AtRAV1 resulted in an ABA-hypersensitive phenotype manifest as
lower levels of endogenous ABA in cotyledons associated with greater reductions in pore
apertures during stress and increased stomatal density. Our results further substantiate the
potential for engineering drought tolerance in agricultural crops such as cotton by over-
expression of AtABI5 and AtRAVs.
xi
Texas Tech University, Sayani Mallick, July 2016
LIST OF TABLES
Table 2-1 List of Primer and their Sequences used in this study
Table 4 -1 Normalized SEM for three probes to validate the expression
Table 4-2: Normalized SEM for 1 hour ABA induction blot
xii
Texas Tech University, Sayani Mallick, July 2016
LIST OF FIGURES
Figure 1: Summary of abscisic acid (ABA) signaling factors: Signaling
through PYR/PYL/RCAR proteins.
Figure 2: Phylogram of BetvI-PYL-MLP family in Arabidopsis,showing homology of
PYLs and available cDNA clones
Figure 3: Cre-lox recombination-ready acceptor vector for transient and stable plant
expression assays
Figure 4: Functional genomics with pUNI Arabidopsis cDNAs and General Scheme
for creating the ready-to-transform T-DNA binary vector constructs.
Figure 5: GUS Histochemical Staining of pBI121 vector (35S promoter driving GUS)
at 24 hours and at 12 hours time frame.
Figure 6: GFP expression as seen by using a compound microscope (Olympus BX41) in
pBI121-Gfp driven by 35S promoter at 24 hours and at 12 hours time frame
Figure 7: Calibration of the fluorimeter :generate a 4MU product standard curve to
know dynamic range of instrument
Figure 8: Calibration of Fluorimetric assay to GUS protein quantitation by Immunoblot
with polyclonal Antibody
Figure 9: p201G Cas9 (addgene)
Figure 10: GFP expression by using a UV-trans-illuminator showed fluorescence at
1DPI time point and higher fluorescence at 6DPI time point using GV2260 strain
xiii
Texas Tech University, Sayani Mallick, July 2016
Figure 11: Immunoblot with anti-GFP and anti-Cas9 monoclonal antibodies for effectors
in protein extracts from Nicotiana benthamiana
Figure 12: Bidirectional clustering of Arabidopsis ABA receptor PYRL gene
expression intensity and experimental treatments/genotypes
Figure 13: ABA induction experiment: A result at a 1 hour time-point depicting
ABA induction by Northern blot
Figure 14: Results for various effector’s activity towards transactivation of endogenous
readout NtERD10 (GV2260)
Figure 15: Results for various effectors' activity towards transactivation of probe
NtERD10 (GV3101).
Figure 16: Results for various effector’s activity towards transactivation of endogenous
readout TAS14.
Figure 17: Results for various effector’s activity towards transactivation of endogenous
readout LEA.
Figure 18: Summary of comparative analysis of Fold Induction quantified (by
Northern blots) by three independent, traceable (validated) ABA-inducible endogenous
reporter genes
Figure 19: Positive Control immunoblot for c-myc Monoclonal anitibody(Mab)
Figure 20: Immunoblot with Monoclonal antibody c-myc for effectors in protein
extracts from Nicotiana benthamiana.
xiv
Texas Tech University, Sayani Mallick, July 2016
Figure 21: Image demonstrates the junction between tap root and hypocotyls
Figure 22: Screening of T1 cotton seedlings on Stewart’s Germination
media supplemented with 50 μg/ml Kanamycin
Figure 23: Establishment of plantlets in soil
Figure 24: T2 Plants in Greenhouse after screening for transgene with kanamycin
Figure 25: Preliminary Physiological Phenotypes: Showed Better developed lateral
root system and longer internode lengths under greenhouse conditions for the
kanamaycin-selected transgenic lines
Figure 26: Immunoblot with Mab c-myc for effectors in seed protein
extracts from cotton stable transgenics
Figure 27: Stomatal densities on abaxial side of 13-day-old cotyledons of Coker 312
and ABI5 and RAV1 overexpressing transgenics.
Figure 28: Time course over six days of drought stress and recovery of five-week old
greenhouse-grown transgenic cotton (Gossypium hirsutum L.) over-expressing
AtABI5 or AtRAV1.
xv
Texas Tech University, Sayani Mallick, July 2016
LIST OF ABBREVIATIONS
ABA abscisic acid
PYR pyrabactin resistance
PYL pyrabactin resistance 1-like
RCAR regulatory component of ABA receptor
TF transcription factor
LEA Late Embryogenesis Abundant
RAV1/2 Related to ABA-Insensitive3/Vivivparous1
COR Cold-Regulated
bZIP Basic Leucine Zipper
SnRK2 Sucrose Non-fermenting1-Related Protein Kinases2
PP2Cs type 2C protein phosphatases
CHLH Mg-chelatase H subunit
GCR2 G-protein coupled receptor 2
xvi
Texas Tech University, Sayani Mallick, July 2016
GTG1 and GTG2 G-protein coupled receptor-type G proteins
OST1 open stomata 1
SLAC1 slow anion channel 1
AREB/ABF ABRE-binding protein/ABRE-binding factor
ABI5 ABA Insensitive 5
RSL1 RING-type E3 ubiquitin ligase
DCAFs CUL4–associated factors
NO nitric oxide
DDB1 damaged DNA binding protein1
UPS Universal Plasmid Recombination Vector System
dwa DWD hypersensitive to ABA
CUL4 CULLIN4-based E3
ABD1 ABA-hypersensitive DCAF1
DWD DNA Binding1-DDB1 binding WD40
DDA1 DDB1-ASSOCIATED1
xvii
Texas Tech University, Sayani Mallick, July 2016
CDD COP10-DET1-DDB1
PTM post-translational modification
xviii
Texas Tech University, Sayani Mallick, July 2016
CHAPTER I
INTRODUCTION TO THE STUDY AND BACKGROUND
1.1 General Introduction
Plants have multifaceted response pathways for abiotic stresses such as drought,
salt, cold, as well as hormonal cues. Of the plant hormones, abscisic acid (ABA) is
one of the important plant growth regulators for stress responses and physiological
processes, which include plant vegetative and root growth as well as plant responses
to environmental stress such as drought, salt, cold, and wound, or pathogen attack
[1,2,3,4]. It has been shown that ABA response to biotic stress in plants is mediated
through RCAR3 receptor. This receptor along with PP2CA–mediated ABA signaling
modulates the plant immune system in response to infection by Pseudomonas
syringae [5]. Another significant role of ABA is in regulation of key aspects of
germination checkpoints/seedling establishment, seed development and maturation,
and seed dormancy. ABA mediates a myriad of physiological processes in growth
and development, including cell division, water use efficiency, and gene expression
during seed development and in response to environmental stresses such as drought,
chilling, salt, pathogen attack, UV and high light. Transcriptional profiling studies in
Arabidopsis have shown that 8-10% of the genes (> 2000) are either induced or
repressed by ABA at a single developmental stage and many of the same genes are
co-regulated by salt, cold, and drought [6]. The sorghum SbPYL gene family
members were down-regulated, apart from SbPYL1 and SbPYL7 which showed
substantial up-regulation in leaf tissues under drought stress conditions. Both
1
Texas Tech University, Sayani Mallick, July 2016
SbPYL1 and SbPYL5 were up-regulated in response to ABA, cold, high salt and
PEG-induced osmotic stress, but SbPYL4 exhibited significant up-regulation only
under cold stress [7]. However, it is not known if the PYL homologs in other species
are similarly regulated, raising questions about function conservation of PYLs across
plant clades and the utility of heterologous expression of PYLs in crops for
engineering stress tolerance.
1.1.1 ABA Gene Expression
ABA modulates the transcription of chloroplast genes by PP2C-
dependent activation of nuclear genes [8]. ABA negatively regulates elongation
of the hypocotyl by dephosphorylating plasma membrane proteins in Arabidopsis
thaliana [9]. A number of plant genes have been identified that function in
desiccation tolerance. The COR genes are cold-, drought-, salt-, and ABA-
responsive genes whose protein products are heat stable and hydrophilic; some
COR genes have structural similarities to the late embryogenesis-abundant (LEA)
proteins. LEA homologues in wheat, maize, barley, carrot, and the resurrection plant
Craterostigma plantagineum are induced by ABA and dehydration stress. The exact
roles of COR and LEA genes in cold and desiccation tolerance are not yet known,
but there is strong evidence that they have an adaptive function in desiccation,
freezing, and salt tolerance. Altered expression of ABA signaling can have
beneficial effects on stress adaptation of plants.
2
Texas Tech University, Sayani Mallick, July 2016
1.1.2 ABA signaling
The clan of proteins comprising pyrabactin resistance (PYR), pyrabactin
resistance 1-like (PYL), and regulatory component of ABA receptor (RCAR) has been
identified as a family of ABA receptors. ABA recognition by the PYR/PYL/RCAR
proteins results in a cascade of signaling that activates the SnRK2 family of protein
kinases through inactivation of their central negative regulators, the type 2C protein
phosphatases (PP2Cs) [10, 11, 12, 13]. Arabidopsis PYR/PYL/RCAR proteins have been
shown to play a key role in quantitative regulation of stomatal aperture and
transcriptional response to ABA [14, 15, 16 ]. In addition to the other PYR/PYL/RCAR
family proteins, numerous other candidate ABA receptors have been reported,
comprising the Mg-chelatase H subunit (CHLH) [17, 18], G-protein coupled receptor 2
(GCR2) [19], and G-protein coupled receptor-type G proteins (GTG1 and GTG2) [20].
Both CHLH and GCR2 are noted as ABA receptor protein candidates, but have been
controversially debated [13,20,21]. CHLH is one of the three subunits of Mg-chelatase
(D,H, and I subunits). PYR/RCAR receptors play a vital role for the whole-plant stomatal
alterations and responses to low humidity, darkness, and ozone [22]. Analogous to the
ABA-dependent regulation of transcription factors, ABA perception by RCAR/PYR/PYL
receptors causes inactivation of PP2C protein phosphatase ABI1 (ABA Insensitive 1), as
well as release of OST1 (open stomata 1) from ABI1 inhibition, and activation of the
slow anion channel 1 (SLAC1) by phosphorylation [23,24,25]. The structure of OST1
kinasel includes the catalytic domain and the ABA independent regulatory domain. The
latter forms an α-helix that binds to a hydrophobic patch of the catalytic domain and
stabilizes the catalytically essential α C helix conformation. The
3
Texas Tech University, Sayani Mallick, July 2016
structure provides the molecular basis of the ABA-independent activation of SnRK2
family of kinases. OST1 is also called SnRK2.6/SRK2E, a major SnRK2-type protein
kinase. Fixed loops of PYL1 act as a framework to interact with the PP2C domain of
ABI1 (the hydrophobic pocket accepting the Trp300
of ABI1). This ABA-dependent
interaction between PYL1 and ABI1 allows access of the β3–β4 loop to the active site
of the PP2C domain. As a result, PYL1–(1)-ABA activates the SnRK2-dependent
phosphorylation pathways by inhibiting the phosphatase activity of ABI1 (Fig. 1)[26].
4
Texas Tech University, Sayani Mallick, July 2016
Figure 1. Summary of abscisic acid (ABA) signaling factors: Signaling through
PYR/PYL/RCAR proteins. Reproduced from [13] ..
1.1.3 Cis-acting ABA response elements, their trans-acting transcription factors,
and TF post-translational modifications
Endogenous ABA levels increase in response to osmotic stresses such as
drought and high salinity, and ABA turns on gene expression by signal transduction
through ABA receptors. ABA binds to the PYR/PYL/RCARs which in turn leads to
the inactivation of the PP2Cs in the ABA-bound PYRs; subsequently, the SnRk2s
downstream are activated as they are relieved from the repression activity of the
PP2Cs. The activated SnRk2s in turn phosphorylate and activate the ABA-responsive
element (ABRE)-binding proteins. ABRE-binding protein/ABRE-binding factor
(AREB/ABF) transcription factors (TFs) regulate the ABRE-mediated transcription
of downstream target genes. AREB/ABF-SnRK2 pathway plays a key role as a
positive regulator of ABA and stress signaling in the course of AREB-mediated
transcription of target genes containing cis-acting ABREs in their promoters [27].
The ABA receptor PYR1 demonstrates extremely high sensitivity to external
application of chemicals thus supporting its interactive responses to ABA and other
drought tolerance conditions. The ligand binding features of PYR1 have been
elucidated from crystallographic studies that demonstrate receptor binding can be a
major target for bioengineering [28,29].
5
Texas Tech University, Sayani Mallick, July 2016
Many chemicals are critical for plant growth and development and play
an important role in integrating various stress signals and controlling downstream
stress responses by modulating gene expression machinery and regulating various
transporters/pumps and biochemical reactions. These are the second messengers.
As a developmental regulator, NO promotes germination, leaf extension and root
growth, and delays leaf senescence and fruit maturation. Moreover, NO acts as a
key signal in plant resistance to incompatible pathogens by triggering resistance-
associated hypersensitive cell death. In addition, NO activates the expression of
several defense genes namely, pathogenesis-related genes, phenylalanine
ammonia lyase, chalcone synthase and could play a role in pathways leading to
systemic acquired resistance. A different role for NO in the regulation of lateral
root development in tomato has been reported which probably operates in the
auxin signaling transduction pathway.68 NO has been associated with plant
defense responses during microbial attack, and with induction and regulation of
programmed cell death The expression of genes in response to NO has also been
shown to mediate via SA and JA signaling pathway. Various members of the
ABA receptor PYR/PYL/RCAR family were modified post-translationally by
tyrosine nitration or S-nitrosylation at cysteine residues, two covalent
modifications that can increase nitric oxide (NO) levels. These NO-mediated
modifications and poly-ubiquitylation, which target proteins for degradation.
This results in the formation of a complex, possibly interconnected, and receptor-
specific pattern in plants overexpressing their individual receptors. Similarly,
6
Texas Tech University, Sayani Mallick, July 2016
tyrosine nitration but not S-nitrosylation inhibited ABA-induced activity in
vitro, which suggests that tyrosine nitration may be a mechanism to rapidly tune
the cellular sensitivity to ABA [30]. Furthermore it is known, that hydrogen
sulfide acts upstream of nitric oxide which in turn modulates ABA-dependent
stomatal closure[31]. Phenotypic studies of PYL orthologs (OsPYL) over
expressed in transgenic rice showed PYL family members (OsPYL3 and
OsPYL9) substantially improve drought and cold stress tolerance and are
putative candidates for the improvement of abiotic stress tolerance [32]. Both
PYL3 and PP2C proteins interacted in vitro and in vivo as evidenced by
induction of their expression by exogenous ABA [33]. It is known that PYL8
positively influences the functioning of MYB77 and its paralogs MYB44 and
MYB73 to augment auxin signaling. This in turn helps PYL8 to promote lateral
root growth independently of the core ABA-SnRK2 signaling pathway [34].
Also, the turnover of PYL4 and PYR1 in the proximity of the plasma membrane
is regulated by the interaction with a single subunit RING-type E3 ubiquitin
ligase, RSL1 [35, 36].
7
Texas Tech University, Sayani Mallick, July 2016
1.1.4 ABA Agonists
Pyrabactin sulfonamide is an artificial naphthalene that mimics ABA [37,
38]. It is a selective ABA agonist that acts through PYR1 ABA receptor, the
founding component of a family of START proteins called PYR/PYLs (Pyrabactin-
Like), which are essential for both pyrabactin and ABA signaling in vivo [39]. Fig. 2
shows the phylogenetic relationship of START domain proteins most homologous to
PYR/PYLs. It is now known that ABA binds to PYR1, which in turn binds to and
inhibits a family of ABI1/2 (ABA-Insensitive1/2) PP2Cs (protein phosphatase 2C
PP2C), which have been shown genetically to be negative regulators of ABA
responses. Homo- and heteromerization of OST1 occurs with SnRK2.2, SnRK2.3,
OST1, and SnRK2.8, and several OST1-complexed proteins were identified as type
2A protein phosphatase (PP2A) subunits and as proteins involved in lipid and
galactolipid metabolism [40]. OST1 has kinase activity and it also functions in guard
cells. Two modules of regulatory features Ser-175 and the SnRK2-specific box are
critical for kinase activity and the mechanisms involved are probably shared by all
kinases of the SnRK2 family, whatsoever the signaling pathway in which they act. In
comparison, Ser-7, Ser-18, and Ser-29 and the ABA-specific box are required for
OST1 function in ABA responses of guard cells. These Ser residues may be targets
of upstream phosphorylation or dephosphorylation events, and the ABA-specific
motif might bind specific regulatory constituents of the pathway. These
phosphorylations and
8
Texas Tech University, Sayani Mallick, July 2016
interactions with upstream cohorts may regulate the function of OST1 kinase in
guard cells by controlling its activity, stability, or employment of specific
substrates. The work adds PP2A-type protein phosphatases as another class to the
interaction network of SnRK2-type protein kinases. PYR/PYLs are ABA-
receptors that function at the beginning of a negative regulatory pathway that
controls ABA sensitivity by inhibiting PP2Cs [11].
Also, PYR/PYL/RCARs hence bind to and inhibit PP2Cs when bound to
ABA, which allows accumulation of phosphorylated SnRK2s (targets of PP2Cs)
and subsequent activation by phosphorylation of ABA Response Element Binding
Factors (ABFs), encoded by a family of ABI5-like basic leucine zipper TFs. An
important recent development in this arena is the realization that PYR/PYL-
interacting C2 domain partners arbitrate a transient Ca2+
-dependent interaction
with phospholipid vesicles, which affects PYR/PYL subcellular localization and
positively regulates ABA signaling pathway [41].
9
Texas Tech University, Sayani Mallick, July 2016
pUNI donor construct
U15941 (Gateway®) U18080
U12806 U13617 U50118
U83484 U22850 U23619 C103436 U13623
Figure 2: Phylogram of BetvI-PYL-MLP family in Arabidopsis, showing homology of
PYLs and available cDNA clones. Cotton transgenic lines are shown in red
10
Texas Tech University, Sayani Mallick, July 2016
1.1.4 ABA receptors: monomeric and dimeric
ABA receptors can be distinguished on the basis of their oligomeric states:
PYR1, PYL1, and PYL2 form stable dimers in solution, whereas PYL4–PYL12 are
monomeric in solution and PYL3 is in monomer-dimer exchange equilibrium under
physiological conditions [42, 43, 44, 45]. The dimeric receptors are essentially less
sensitive to ABA than the monomeric receptors [44]. Regardless of this lower sensitivity,
genetic data suggests that the dimeric receptors are essential in all ABA responses
measured [11,16, 42].
1.1.6 ABA signaling transcription factors
The RAV (Related to ABI3/Viviparous1) family of transcription factors have the
N-terminal AP2-like (DNA Binding Domain) DBD that binds 5'-CAACA-3' sequence,
and the C-terminal Basic3 (B3)-like DBD that binds 5'- CACCTG-3' sequence in
promoters of ABA-inducible genes. Six members of RAV TFs family have been
classified in Arabidopsis [46]. The ABI5 clade of bZIP TFs (about 12 homologues from
a total of ~87 in the Arabidopsis genome) play a major role in ABA-mediated responses
at seed and seedling stages of development. ABI5 (ABA Insensitive 5) is involved in
seed-specific responses.
CULLIN4-RING E3 ubiquitin ligases (CRL4s) regulate key developmental and stress
responses in eukaryotes. It has been previously published that members of the DDB1-
CUL4–associated factors (DCAFs) clan of proteins directly bind to DAMAGED DNA
11
Texas Tech University, Sayani Mallick, July 2016
BINDING PROTEIN1 (DDB1) and function as the substrate receptors in CULLIN4-
based E3 (CUL4) ubiquitin ligases, which regulate the selective ubiquitination of
proteins. A particular DCAF protein -the ABD1 (ABA-hypersensitive DCAF1), has been
shown to negatively regulate ABA signaling in Arabidopsis thaliana. It has been also
shown that loss of ABD1 leads to subsequent hyper-induction of ABA-responsive genes
and higher accumulation of the ABA-responsive TF ABI5 and a retardation of ABI5
degradation by the 26S proteasome [47]. Furthermore, it has been recognized that in the
same CULLIN4-based E3 (CUL4) ubiquitin ligase complex, DWD (DNA Binding1-
DDB1 binding WD40) is also a critical element in the post translational regulation of
ABI5. Studies on dwa (DWD hypersensitive to ABA) mutants have revealed ABI5
accumulates to higher levels in these mutants and the proteasomal degradation rate of
ABI5 is highly reduced in dwa plants as compared to the wild type counterparts [48].
Both evidences point to the fact that TFs in the ABA signaling pathway (viz. ABI5) are
undergoing post translational modification (PTM) through the interaction of multi protein
complexes, regulating the ABA signaling pathway in a direct or indirect manner. From
my study, it has further corroborated the fact ABI5 is indeed subjected to post
translational modifications, as evidenced by my results is Figure 20. Besides TFs,
receptors for ABA signaling pathway like PYL8 and PYR4 have also been shown to be
post translationally modified by undergoing polyubiquitination and subsequent
proteasomal degradation. The COP10-DET1-DDB1 (CDD)–related protein complexes,
have been proposed to facilitate target recognition by CRL4. DET1-, DDB1-
ASSOCIATED1 (DDA1) as part of the CDD complex, providing substrate specificity for
CRL4 by interacting with ubiquitination targets. DDA1 has been shown to bind to the
12
Texas Tech University, Sayani Mallick, July 2016
abscisic acid (ABA) receptor PYL8, as well as PYL4 and PYL9, in vivo thus
facilitating its proteasomal degradation. These receptors gain stability through ABA
binding by limiting their polyubiquitination [49].
Enhancement of crops for an assortment of traits, including disease resistance,
adaptation to abiotic and biotic stresses, and seed quality improvements such as oil,
starch or protein content, can be accomplished by introducing new or modified
transgenes into the genome. Overexpression of ABA receptors and transcription factors
responsible for drought-inducible gene expression have established the practical benefits
of synchronized activation of gene sets that confer non-specific protection by up-
regulation of stress-response pathways [50,51]. Heterologous transgene systems that
regulate hormone and stress responses as proposed in this study can be used to tap into
the natural defense and seed development processes of crop plants such as cotton, with
the potential benefits of increasing yields under stress conditions and enhancing seed
qualities. Testing the functions of these major effectors/ players of ABA pathway both
transiently in Nicotiana benthamiana and stably in cotton could help predict phenotypes
for translational applications such as engineering stress tolerance in crops and improved
seed qualities.
13
Texas Tech University, Sayani Mallick, July 2016
BACKGROUND TO THE PROJECT
FUNCTIONAL ANALYSES OF ABI1-LIKE PP2CS IN TRANSIENTLY
TRANSFORMED MAIZE PROTOPLASTS
Transient gene expression studies with maize and rice protoplasts in our lab and
numerous others' have shown that transient expression is a powerful, reproducible and
facile system for studying gene regulation [52,53]. Previously, Arabidopsis donor cDNAs
in the UPS (universal plasmid system) vector pUNI51 were made available to the
scientific community [54] (Fig. 4) and a set of UPS acceptor plasmids (pCR701-pCR705)
were engineered to comprise in-frame N-terminal epitope tags recognized by
commercially available antibodies (6xHis, 2xHA, 2xFLAG, 2xcMyc) and driven by the
maize Ubiquitin promoter for expression of tagged cDNA effectors [55] in protoplasts-
plant cells devoid of their cell walls. As was hypothesized, Pro35S-Ppdk:abi1-1 dominant
negative allele and ProUbi:ABI2 constructs significantly antagonized the ABA-inducible
ProEm:GUS reporter expression more than 90% for abi1-1 and 50% for ABI2
respectively , while the tested effects of more distantly related PP2C-homologous family
members ProUbi:AP2C7, ProUbi:AP2C9, and ProUbi:AP2C18 candidate PP2Cs were
substantiated as negative ABA regulators of ABA-inducible gene expression. The minor
antagonism by ABI1-clade HAB2 observed for ABA-inducible ProEm:GUS gene
expression was consistent with others' genetic results that HAB2 is a weak negative
14
Texas Tech University, Sayani Mallick, July 2016
regulator of ABA-induced chlorophyll loss in seedlings [56]. Interestingly, transient
expression of the PP2C test construct ProUbi:AP2C1 transactivated ProEm:GUS
expression instead of antagonizing it as hypothesized. The conserved Gly residue at
amino acid position 180 of ABI1 is critical for ABA signaling and the G180→D mutation
results in dominant-negative alleles for ABI1 and ABI2 (G168D) [57]. A site-directed
mutant derivative of AP2C1 (ProUbi:AP2C1m) containing four amino acid residue
changes, in particular G178E which is analogous to the dominant-negative allele G180D
in abi1-1, did not transactivate ProEm:GUS expression, supporting that the
transactivation effect of AP2C1 was specific.
15
Texas Tech University, Sayani Mallick, July 2016
Figure 3. Cre-lox recombination-ready acceptor vector for transient and stable plant
expression assays. pCR701-705 are transient acceptors driven by the maize Ubi
promoter with loxH alone, 2xHIS6, 2x-HA, 2x-FLAG, and 2x-cMYC epitope tags,
respectively, upstream (5’) and in frame with loxH recombination site to give N-terminal
fusion peptides with acceptor pUNI cDNA plasmids. From [55]
Reproducibility of several PP2C effects obtained with Cre-lox recombination-
generated constructs has been documented [55]. Altogether, the functional data
suggested that genes highly homologous to ABI1 are functionally conserved across
monocot and dicot species for ABA-inducible gene regulation and that some genes
outside the ABI1-Like clade (e.g. AP2C1, AP2C18) can also affect ABA signaling when
overexpressed. I speculate this may be because the crosstalk machineries flanked by
stress pathways may be arbitrated by PP2Cs either directly by sharing of some targets, or
indirectly by changing the homeostatic equilibria of phosphorylated signaling effectors in
regulatory cascades.
16
Texas Tech University, Sayani Mallick, July 2016
In my study I am using the aforementioned UPS donor vector pUNI51 containing
the various full length cDNAs comprising the PYL family of ABA receptors and a T-
DNA acceptor vector pKYLX
(https://www.arabidopsis.org/servlets/TairObject?type=vector&id=500600073) which
affords high activities in transient expression assays with N. benthamiana infiltrated with
Agrobacterium tumifaciens harboring UPS effector binary plasmids [58]. The acceptor
vector for cDNA gene donors also has a 9x N-terminal c-MYC tag for transgene
protein characterization as a chimaeric fusion. These constructs had already been
generated at the start of my project for stably transformed expression of AtPYL4 and
AtPYL7 in transgenic cotton. My work then focused on phenotypic and molecular
studies to assess the conservation of ABA receptor activities across species.
Previously in the lab, a maize mesophyll protoplast transient assay was used to show
that B3-DBD effector RAVs, and ABA effector bZIPs most closely related to ABI5
transactivate ABA-inducible gene expression and show synergy in their activities when co-
expressed [59]. Transgenic cotton expressing Arabidopsis RAVs and ABI5 have a
‘less-stressed phenotype’, which may have wide-ranging utility for engineering abiotic
stress tolerance in crop species. Functional characterization of AtRAV2 cDNA has
already been conducted on ABA-inducible reporter gene expression and interactions with
known positive effectors (ABI5, ABF3, VP1) and the dominant-negative ABA effector
mutant abi1-1 encoding a protein phosphatase type 2C (PP2C) [59]. The ABA effectors
ABI5 and ABF3 [60] resulted in transactivation of between 4- and 16-fold above the
promoter of Early-methionine-rich driving bacterial β-glucuronidase (uidA) GUS reporter
17
Texas Tech University, Sayani Mallick, July 2016
gene (Em:GUS) alone in the absence or presence of a saturating concentration (100 uM)
ABA, respectively. ABA treatment resulted in ~5 fold induction of the Em:GUS reporter
alone, whereas overexpression of AtRAV2 resulted in transactivation of 2-3 fold above
the reporter gene alone in both the presence and absence of exogenous ABA, values
somewhat less than overexpression of ABI5 or ABF3. Thus, past works demonstrated
that transient assays are a value-added and rapid means to characterize redundant signal
transduction pathways. I endeavored to extend the transient assay system to dicots,
specifically Nicotiana benthamiana, a model system for high-level transgene functional
genomics [61].
Evidence from fibers of transgenic cotton lines showed RAV2 and ABI5
overexpressers had significantly finer fibers, and ABI5, RAV2-L and RAV1 transgenics
had considerably longer fibers [62]. Lines of AtRAV1 and AtRAV2-overexpressing
cotton had approximately 5% significantly longer fibers with only minor decreases in
yields under well-watered or drought stress conditions. The longer transgenic fibers from
drought-stressed transgenics could be spun into yarn which was measurably stronger and
more uniform than that from well-watered control fibers. A number of the transgenic
lines showed robust vegetative growth phenotypes in the greenhouse compared to non-
transgenic controls with more number of bolls and larger plant size [62]. Further
characterization of these materials with agronomic potential are therefore warranted at
the protein level, which is facilitated by the c-myc epitope N-terminal tag engineered into
the transformation vectors.
18
Texas Tech University, Sayani Mallick, July 2016
Objectives:
The main objective of this study is to test the functions of ABA receptors and
downstream transcription factors in heterologous systems to gain insight into
conserved ABA signaling modules in plants.
The transient expression levels of key genes like transcription factors and
receptors in ABA signaling in a model plant species for biopharming [63] , Nicotiana
benthamiana and also to comprehend the henceforth stable expression of these very
genes in a heterologous system in upland cotton, namely Gossypium hirsutum.
To study the expression of regulatory genes (receptors and transcription actors)
genes in Nicotiana and Gossypium, we are proposing the following aim.
19
Texas Tech University, Sayani Mallick, July 2016
Specific Aim:
Use the robust and reproducible transient assay system of Nicotiana benthamiana
to test the activities of known ABA effectors by measuring the read-out of the effectors
as endogenous reporter (ERD10C, a LEA gene) transcripts, relative to abundance of
transiently expressed transgene effectors quantified by immunoblots. Test in the transient
system the ABA signaling activities of AtPYL7, AtPYL4, outlier control MLP423 (Fig.
2) on endogenous ABA signaling pathway ERD10C transcriptional readouts.
Hypothesis:
Nicotiana benthamiana is an established system for transient assays at both
transcriptional and translational levels. If we can exploit the rapid and robust nature of
N.benthamiana assays to functionally characterize the ABA receptors (and transcription
factors), then results can be translated to stable transformation of crops like upland cotton
(Gossypium hirsutum) to gain deeper insights into the utility of ABA receptors. Our
overall goal is for deeper understanding of efficacy and molecular mechanisms of deeply
conserved ABA gene effectors by characterization in heterologous systems (both
transient and stable).
20
Texas Tech University, Sayani Mallick, July 2016
CHAPTER II.
MATERIALS AND METHODS
2.1 cDNA clones of PYLs, RAVs and ABI5 and making recombinant vectors for
Agrobacterium-mediated transformation in Arabidopsis and cotton
Arabidopsis annotated expressed genes for plant functional and proteomics
studies. These plasmids are compatible with the Universal Plasmid Recombination
Vector System(UPS) of Dr. Steve Elledge. Universal Plasmid Recombination Vector
System (UPS) employs the 34 bp cre-lox site-specific recombination site-specific
system of bacteriophage P1 to catalyze plasmid fusion between the Univector, a plasmid
containing the gene of interest without promoter elements, and host vectors containing
regulatory information. Fusion events are genetically selected and result in placement of
the effector gene under the control of novel regulatory elements.
UPS eliminates the need for restriction enzymes, DNA ligases, and many in vitro
manipulations required for subcloning and allow the rapid construction of multiple
constructs for expression in multiple organisms. pUNI51-derivative full length cDNA
clones of Arabidopsis RAV family members from Arabidopsis Biological Resource
Center, Ohio State University, http://abrc.osu.edu/) were recombined to pKYLX-myc9-
loxP binary acceptor vector[58] in the presence of cre-recombinase (Fig. 5). pUNI51 has
a Neomycin Phosphotransferase NPT II kanamycin selectable marker and an origin of
21
Texas Tech University, Sayani Mallick, July 2016
replication (oriRK6ɣ) that can only be propagated in PIR1 host cells (Invitrogen,
Carlsbad, CA) in the absence of another origin of replication.
The T-DNA binary acceptor vector pKYLX-myc9-loxP (ABRC stock#CD3-637;
plant selectable marker is kanamycin driven by the strong plant promoter 35S from
Cauliflower Mosaic Virus) has a tetracycline selectable marker for the bacterial host and
a low copy number RK2 origin of replication that functions in E. coli strain GC10 (which
is pir- and cannot replicate the pUNI donor plasmid alone). After in vitro recombination
the products are electroporated into GC10 cells and selected genetically on kanamycin,
whereby only recombinant plasmids can replicate.
The acceptor vector has been engineered to provide 9 repeats of the c-myc epitope
(EQKLISEEDL) at the N-terminus of the donor protein that facilitates detection of the
expressed transgene expression using an immunoblot (western) assay. Expected protein sizes
from different pKYLX-pUNI cDNA recombinant constructs are as follows; Pyl7~38kDa,
Pyl4 ~36kDa, Mlp423 ~ 31kDa, RAV 1 ~52 kDa, Rav 2 ~53 kDa, Abi5~ 61 kDa,RAV2L ~
52kDa.Transformation-ready constructs were restriction digested and were confirmed to be
comprised of a dimer of one acceptor and one pUNI donor plasmid. For recombination, in a
20 μL reaction volume 500 ng acceptor and donor vector DNAs were mixed with 2 μL 10x
recombination buffer (New England Biolabs; www.neb.com), 2 μL GST::CRE recombinase
and incubated at 37° C for 20 min. The DNAs were
22
Texas Tech University, Sayani Mallick, July 2016
precipitated with EtOH, the pellet dissolved in 10 μL water and the DNA measured by a
Nanodrop spectrophotometer (Willmington DE; www.nanodrop.com).
About 100-200 ng of DNA products were electroporated into electrocompetent
pir- E. coli GC10 cells (Invitrogen, Carlsbad, CA) and the recombinant fusion plasmids
was selected on kanamycin containing LB plates.
After validation by restriction enzyme mapping of recombinant plasmids,
pure supercoiled plasmids were prepared by CsCl density gradient ultracentrifugation
and electroporated into electrocompetent Agrobacterium tumifaciens strain GV3101
and GV2260. Electroporation conditions were 2000 volts, at 200 Ω and 25μF.
23
Texas Tech University, Sayani Mallick, July 2016
CONSTRUCTS
Figure 4. Functional genomics with pUNI Arabidopsis cDNAs and general scheme for
creating the ready-to-transform T-DNA binary vector constructs. The pUNI51 vector
containing a full length cDNA obtained from the Arabidopsis Biological Resource Center.
pUNI clones were recombined with pKYLXmyc9-LoxP binary vector in the
24
Texas Tech University, Sayani Mallick, July 2016
presence of cre-recombinase enzyme. The two vectors recombine at the 34 bp LOX-P
site and the resultant recombined cDNA will be under the control of 35S Promoter from
the acceptor vector and the bovine growth hormone (BGH) transcription termination
signal [55]. The resulting protein will have N-terminal 9X c-myc epitope that can be used
to detect the protein in plant extracts.
2.3 Methods for characterization of transgenes in plants
2.3.1 Plant Material
Plants were grown at 21°C temperature with a 16 hr/8 hr, light/dark cycle for
long day conditions for 4 weeks. Transient assays in tobacco plant (Nicotiana
benthamiana) is used to determine the subcellular location of a gene of interest. The root
tumor-inducing bacterium Agrobacterium tumefactions is used as intermediate to
introduce the target gene expression cassette into leaf cells.
25
Texas Tech University, Sayani Mallick, July 2016
2.3.2 Sampling procedures
These sections were immediately placed into microfuge tubes and frozen in
liquid nitrogen for storage at -80 °C freezer.
2.4 Generating transgenic cotton plants by Agrobacterium-mediated
hypocotyls explants transformation and regeneration
T₁ cotton seeds were collected from self-fertilized bolls of transgene- expressing
T0 parental lines and were planted in test tubes on Stewarts media (pH 6.8) containing 50
parts-per-million kanamycin and 5 gram/Liter glucose at 28° C under 16/8 hr light/dark
conditions. Lines expressing transgenes showed Mendelian segregation ratio for lateral
root growth on kanamycin medium, whereas wild type control (WT) Coker312 plants
never showed lateral root growth on kanamycin supplemented media. Plants showing
vigorous lateral roots (~ 10-12 days from planting) were transferred to pots comprising
potting soil. Pots were kept in a tub tray covered with Saran wrap to maintain a high
relative humidity environment. After a week to 10 days, well-established seedlings were
transferred to pots and moved to greenhouse. The T2 seeds from T1 plants were selected
on kanamycin to cull out the segregating T1 plants. Authentication of the presence of a
single T-DNA insertion event in progeny seeds from self-fertilized T1 transgenic lines
26
Texas Tech University, Sayani Mallick, July 2016
was by demonstration of 3:1 Mendelian ratio of dominant resistance trait to kanamycin
susceptible by genetic selection on kanamycin-containing rooting medium.
Primer Design
Primers were designed by using the Nicotiana benthamiana draft genome on
Solgenomics® (https://solgenomics.net). Upon performing alignment using BLAST
function and finding significant similarity (shown below), the open source software
Perlprimer® (http://perlprimer.sourceforge.net/) was used to design the primer oligos.
PerlPrimer® is a GUI application written in Perl that is aimed at automating and
simplifying the process of primer design. Primers were synthesized commercially from
Sigma Aldrich® (https://www.sigmaaldrich.com/). The list of Primers used in this work
are listed in Table 2-1.
27
Texas Tech University, Sayani Mallick, July 2016
Table 2-1: List of Primer and their Sequences used in this study
Primer Name Sequence
NtERD10C_2_F GATGAGGAGGAAGAAATAGG
NtERD10C_2_R CTTCAGTCTTTGAGTGGTAT
*NtLEA-Q_F TTGTTAGCAGGCGTGGGTAT
*NtLEA-Q_R CTCTCGCTCTTGTTGGGTTC
Ntom_F AGCTAGAGCTGTCGGATCGA
Ntom_R GGCACAATACAACGAGGGATA
Nsyl_F CAGAGAACTTACAGAGCTAG
Nsyl_R AGCATCTTGATAAGGTAAAGA
*Yongjin Huo et al . Plant Cell, Tissue and Organ Culture (PCTOC) September 2015
28
Texas Tech University, Sayani Mallick, July 2016
Probe for ERD10C gene Query: 310 agtgatgaggaggaagaaataggagaggacgggcagaaaatcaagaagaagaaaaagaag 369
||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 44025 agtgacgacgaggaagaaataggagaggacggacagaaaatcaagaagaagaaaaagaag 43966 Query: 370 ggtttgaaggataaaatcaaggataaaatatctggagaacacaaggaagaagagaaggcg 429
|||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 43965 ggtttgaaggataagatcaaggagaaaatatctggagaacacaaggaagaagagaaggca 43906 Query: 430 ggtgaggacacggctgtaccagtggagaaatacgaggaaacagaggagaagaaaggattc 489
| ||||||| ||||| ||||||||||||||||||||| |||||||||| || ||||||
Sbjct: 43905 g---aggacacagctgttccagtggagaaatacgaggaagcagaggagaaaaagggattc 43849 Query: 490 ctagacaagattaaggagaagttgccaggtggcgggcaaaagaagacagaggaagtggcg 549
|||||||||||||||||||||||||||||| |||||||||| || ||||||||||| ||| Sbjct: 43848 ctagacaagattaaggagaagttgccaggttgcgggcaaaataaaacagaggaagtagcg 43789 Query: 550 cctccaccaccgcctgcggcggagcacgaggctgagggaaaagagaagaagggatttttg 609
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 43788 cctccaccaccggctgcggcggagcacgaggctgagggaaaagagaagaagggatttttg 43729 Query: 610 gacaagattaaggagaaattaccaggatatcactcaaagaccgaag 655
||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 43728 gacaagattaaggagaaattaccaggataccactcaaagaccgaag 43683
29
Texas Tech University, Sayani Mallick, July 2016
Query - Nicotiana Tabacum ERD10C
Subject – Nicotiana Benthamiana draft genome
Score = 523 bits (264),
Expect = 1e-146
Identities = 326/346 (94%),
Gaps = 3/346 (0%), Frame = +1 / -1
N. tabacum genome comprising two subgenomes from Nicotiana sylvestris and Nicotiana tomentosiformis
N. tabacum genome comprising two subgenomes from Nicotiana sylvestris and
Nicotiana tomentosiformis. Nicotiana tabacum (tobacco) is a 5–6 million year old
allotetraploid species derived from ancestors of N. sylvestris, the maternal S genome
donor, and N. tomentosiformis the paternal T genome donor. As a species, N. tabacum
evolved through the interspecific hybridization of the ancestors of Nicotiana sylvestris
(maternal donor) and Nicotiana tomentosiformis ( paternal donor).
30
Texas Tech University, Sayani Mallick, July 2016
Probe 1 for TAS14 gene
Query: 100 gaaagagatggcacaatacaacgagggatacggtagccaggggcaaatgcgccagactga 159
|||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||
Sbjct: 10692 gaaagaaatggcacaatacaacgagggatacggtagccaggagcaaatgcgacagactga 10751
Query: 160 tgaatatggaaaccgggtccaagaaagtgggggcatgggcagtactggtgcctatggaac 219 ||||||||||||||| |||||||||| |||||||||||||| |||||||||||||||| Sbjct: 10752 tgaatatggaaaccgtgtccaagaaactgggggcatgggca---ctggtgcctatggaac 10808
Query: 220 tcagcaag------gtatggggggcataggtggtggagaatatggaacccaaggccaagg 273
|||| | |||| |||||||| |||| |||||||||||| |||||||||||||| Sbjct: 10809 tcagggtgataccggtattgggggcatgggtgctggagaatatggcacccaaggccaagg 10868
Query: 274 tactggtatggggaccactggtggtggagcctatggaactcagggtggtactggaatggg 333
||||||||| || | |||||||||||||||||||||||||||||||||||||||||
Sbjct: 10869 tactggtataggtatg---ggtggtggagcctatggaactcagggtggtactggaatggg 10925
Query: 334 ggctatgggtggagatcagtatggaacccaaggtactggaatgggtatgggtactggtgg 393
||| |||| |||||| |||||||||||||||||| |||||||||||||||||||| || Sbjct: 10926 ggccatggatggaga---gtatggaacccaaggtaccggaatgggtatgggtactggggg 10982
Query: 394 tatgcatactcagcaccatgagggccaacaacagcttcgtcgatccgacagctctagctc 453
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| Sbjct: 10983 tatgcatactcagcaccataagggccaacaacagcttcatcgatccgacagctctagctc 11042
Query: 454 tgtaagtt 461 ||| ||||
Sbjct: 11043 tgttagtt 11050
Query - Nicotiana tomentosiformis TAS14 gene
Subject – Nicotiana Benthamiana draft genome
Score = 418 bits (211), Expect = 1e-114
Identities = 330/368 (89%), Gaps = 15/368 (4%),Frame = +1 / +1
31
Texas Tech University, Sayani Mallick, July 2016
Probe 2 for TAS14 gene
Query: 20 gtgaaagagatggcacaatacaacgagggatacggtagccaggggcaaatgcgccagact 79
|||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||| Sbjct: 41423 gtgaaagaaatggcacaatacaacgagggatacggtagccaggagcaaatgcgacagact 41364
Query: 80 gatgaatatggaaaccgggtccaggaaactgggggcatgggcactggtgcctatggaact 139 ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| Sbjct: 41363 gatgaatatggaaaccgtgtccaagaaactgggggcatgggcactggtgcctatggaact 41304
Query: 140 cagggtggtaccggtattgggggcatgggtgctggagaatatggaacccaaggccaaggt 199 ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 41303 cagggtgataccggtattgggggcatgggtgctggagaatatggcacccaaggccaaggt 41244
Query: 200 actggtatgggtatgggtggtggagcctatggaactcagggtggtactggaatgggggcc 259 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 41243 actggtataggtatgggtggtggagcctatggaactcagggtggtactggaatgggggcc 41184
Query: 260 atgggtggagagtatggaacccaaggtactggaatgggtatgggtactggtggtatgcat 319 |||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 41183 atggatggagagtatggaacccaaggtaccggaatgggtatgggtactgggggtatgcat 41124
Query: 320 actcagcaccatgagggccaacaacagcttcgtcgatccgacagctctagctctgtaagt 379 |||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 41123 actcagcaccataagggccaacaacagcttcatcgatccgacagctctagctctgttagt 41064
Query: 380 tttgtaacatcaataaaagttcaagaaagaaaattttttgcacgtatcaaaaagtattac 439 |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| Sbjct: 41063 tttgtaacatcaataaaagttcaagaaagaaagatttttgcacctatcaaaaagtattac 41004
Query: 440 tcctcttagagaataattggtaggtttaaacgtgtcatcacatttttatgactataaaat 499 ||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||| Sbjct: 41003 tcctcttagag---aattggtaggtttaatcatgtcatcacatttttatgactataaaat 40947
Query - Nicotiana sylvestris TAS 14 gene
Subject – Nicotiana Benthamiana draft genome
Score = 910 bits (459),
Expect = 0.0
Identities = 624/675 (92%),
Gaps = 18/675 (2%),
Frame = +1 / -1
32
Texas Tech University, Sayani Mallick, July 2016
Polymerase Chain Reaction (PCR)
PCR were performed using an Eppendorf thermocycler for 30 cycles and bands
were analyzed on a 1% agarose gel by electrophoresis. The annealing temperature was
60°C.
GUS Histochemical Assay
β-Glucuronidase GUS assays. Plant samples were developed at 37°C for 12 h
with a 1 mM solution of the indigogenic GUS substrate 5-bromo-4-chloro-3-indolyl b-D-
glucu-ronide (X-Gluc; Rose Scientific) in 50 mM KH2 PO4 (pH 7.0), 0.1 mM EDTA, 0.5
mM ferricyanide, 0.5 mM ferrocyanide, 0.05% sodium azide, 0.1% Triton X-100. After
staining overnight, samples were immersed in 70% ethanol overnight.
GUS Fluorometric Assay
Although spectrophotometric substrates for GUS are available, GUS activity in
solution is usually measured with the fluorometric substrate 4-methylumbelliferyl-β-
D-glucuronide (MUG). Fluorometry is preferred over spectrophotometry because of its
greatly increased sensitivity and wide dynamic range. The assay is highly reliable and
33
Texas Tech University, Sayani Mallick, July 2016
simple to use. After hydrolysis of methyl-umbelliferyl-glucuronide (MUG) substrate by
GUS enzyme, the reaction first must be terminated with basic solution. This not only
stops the enzyme reaction, but also causes the fluorescence.
Total RNA Extraction and Quantification
Tobacco total RNA was extracted from leaves using liquid nitrogen and processed with
the Spectrum® Plant Total RNA Kit ( SIGMA ALDRICH, St. Loius MO). The extraction
process was carried out step-by-step as described in the protocol manual of the
commercial extraction kit. Extracted total RNA was then quantified using the Nanodrop
quantification instrument (Thermo Fisher Scientific, www.thermofisher.com).
RNA Blot analysis
For RNA (Northern) blot analysis, 6 μg total RNA was loaded on 1.2 % denaturing
agarose gel and subjected to electrophoresis. One of the most frequently used denaturants
for RNA agarose gel electrophoresis is formaldehyde. Since RNA is a single-stranded
nucleic acid and tends to form secondary structures, a standard agarose gel will not give
an accurate size separation of your total RNA or mRNA sample. Therefore a denaturing
agent like formaldehyde must to be added to the agarose gel and the RNA to ensure the
molecules remain single-stranded. Afterwards, the RNA gel was blotted to a Hybond-N+
nylon membrane (GE healthcare, Piscataway, NJ) according to the manufacturer’s
34
Texas Tech University, Sayani Mallick, July 2016
instructions. An RNA molecular weight marker was also used as reference to estimate
mRNA transcript sizes (Ambion Millenium Marker, cat# AM7151). The probes used for
labeling in the Northern hybridization were synthesized using Random Primer DNA
Labeling Kit Ver.2® (TAKARA, Shiga, Japan). The radioactive isotope used in the
process was [α-32P]-dCTP (PerkinElmer, Waltham, MA). Membranes were
prehybridized briefly in the PerfectHyb® Plus hybridization buffer (SIGMA
ALDRICH,Saint Louis, MO) and then subjected to hybridization in the same buffer
according to the manufacturer’s instructions. For auto-radiographic detection, a storage
phosphor screen (GE Healthcare, Piscataway, NJ) was used and it was scanned using a
Personal Molecular Imager™ (PMI™) System (Biorad).
Quantification of Northern Blots
Ethidium bromide-stained total RNA was quantified by imaging the intensity of
ribosomal rRNA bands using Quantity One® software (Biorad). A rectangle was drawn
around bands for each lane in total RNA and area was measured. The Northern blot band
intensity of each lane was quantified similarly using the same Quantity One® software.
The ratio of value for blot and gel gives us the desired quantitative result for each lane.
35
Texas Tech University, Sayani Mallick, July 2016
Immunoblot Analysis from Nicotiana benthamiana and Cotton (Gossypium
hirsutum)
Total protein from both N. benthamiana leaves and cotton seeds was extracted
using lysis buffer (10 mM EDTA, 0.1% (v/v) Triton X-100, 40 mM sodium phosphate
buffer (pH 7.0), 10 mM β-mercaptoethanol, 1 mM PMSF) and the lysate was quantified
using Bradford Coomassie assay (Pierce; www.piercenet.com). 10 μg of total protein
was loaded onto a mini vertical SDS-PAGE gel (Thermo Fisher Scientific;
www.thermofisher.com) and blotted on to Immobilon-P PVDF transfer membrane
(Millipore; www.millipore.com). For detection of protein, Monoclonal mouse anti c-
myc primary antibody (Pierce, 1:2000 dilutions), anti GFP primary antibody (Invitrogen,
1:3000 dilutions) and anti Cas9 (Novusbio,1:2000 dilutions) were used. Horseradish
peroxidase-labeled anti mouse secondary antibody (1:20,000 dilution) was then used to
detect the primary antibody. ECL Advance chemiluminescence detection method
(Amersham Biosciences; www.gehealthcare.com) was used to detect protein and images
were captured using ImageLab® software (ver. 5.2) (Biorad). To validate lane loadings,
blots were reprobed with anti-Ubiquitin primary antibody (PD41 Cell Signaling) was
used as internal control and Coomassie blue dye was used as loading control.
36
Texas Tech University, Sayani Mallick, July 2016
Analyses of the relative protein concentration
Quantity One® software (Biorad) was used again for determining the relative
protein concentration. A rectangle was drawn around bands for each lane in ubiquitin and
area was measured. The band intensity of each lane was quantified similarly for every
other detected protein of interest using Quantity One®. The ratio of value for these
proteins and ubiquitin gives us the desired quantitative result for each lane.
Guard cell morphology
Guard cell morphology was analyzed by a modified technique described by
Travaglia and others (2010). A layer of clear nail polish (nitrocellulose in ethyl acetate)
was brushed on the abaxial side of a cotyledon, allowed to dry for 15s, and then carefully
extracted with forceps and mounted on a microscope slide. The slide was examined using
a standard compound microscope, and digital photomicrographs taken of the abaxial leaf
impression. The photomicrographs were then imported into Image-J (Rasband, 1997-
2012), and the numbers and area (μm2) of guard cells (i.e., individual stoma) and their
pore (i.e., aperture) were analyzed. Stomata measurements were chosen at random from
those that could be clearly focused as to avoid distortion in the measurements. Because
of variation in the clarity of individual guard cells in images, the
37
Texas Tech University, Sayani Mallick, July 2016
number of guard cells per cotyledon characterized for aperture ranged from 15-20
stomata per cotyledon, and the total number of stomata counted per genotype was from
300 to 440, with 12 individual plants for each genotype sampled from seven to eight
times. The area of guard cells and pores were summed to produce a single data point for
that cotyledon, and then scaled to 15 to correct for the uneven number of guard cells
collected per cotyledon. We also investigated the area of guard cell pores relative to the
size of guard cells (pore area/guard cell areas) by dividing the total areas of 15 guard cells
by the summed areas of the pores. Stomatal area (μm2) and apertures (μm
2), met
assumptions of normality and were analyzed separately using ANOVA.
Statistical analysis
Comparative analysis of Fold Induction quantified by three independent, traceable
(validated) ABA-inducible endogenous reporter genes.The error bars indicate the ±
S.E.M.(Standard Error of Mean) values for the biological replicates of northern blots
from these probes (n=3). For statistical significance analysis, a two-tailed Student’s t-test
was applied with unequal variance assumed.
To determine the effects of each transgenic event on responses to drought-stress
and recovery, we conducted pair-wise analyses of Coker312 against each transgenic cotton
line under specific treatment conditions. This was done using a two-tailed
38
Texas Tech University, Sayani Mallick, July 2016
Student's t-test, assuming equal variance except for the ABA quantitations, where a one-
tailed t-test was used on grounds prior work [59, 62] showed the test genotypes were
drought tolerant/ABA hypersensitive. The same one-tailed method was applied to
analyze the effects of drought-stress (versus well-watered controls) and drought recovery
(peak drought vs. drought recovery) independently within each cotton line.
39
Texas Tech University, Sayani Mallick, July 2016
CHAPTER III.
STUDIES ON THE UTILITY OF NICOTIANA BENTHAMIANA TRANSIENT
GENE EXPRESSION SYSTEM:
3.1 INTRODUCTION
An opening step to my work was to select a time point which can be reproduced
for various experimental parameters. Since we want to interpret the readout of an
endogenous ABA-inducible gene reporter, and ABA responses are expressed in plant
cells in seconds to minutes, therefore we want to establish the shortest possible window
for relevant time-points of response. It's a kind of a trade-off, where we have to
experiment with different factors or parameters so that the effector and reporter genes
that are being assayed as ABA response gets interpreted without knock-on/indirect
effects over time. Pilot Experiments for transient assays were conducted to test the
system and parameters of time by GUS histochemical assay [62] and GFP reporter
enzyme assays. Both assays show good expression at 1 DPI (days post infiltration) / 24
hours, I chose 1DPI (24 hours) as my experimental time conditions.
40
Texas Tech University, Sayani Mallick, July 2016
I studied the efficacy of the Nicotiana benthamiana transient gene expression
system with the following three approaches using the utility of N.benthamiana model
system (as evidenced by GUS, GFP, and CAS9.
i) Pilot Experiment for transient assays: to test the system and parameters of time by GUS
histochemical assay and GFP (reporter enzyme assays)
ii) Control experiments for establishment of Nicotiana benthamiana transient assay
system at protein level, an important parameter for interpreting effector activities:
Calibration of Fluorimetric assay to GUS protein quantitation by Immunoblot
with polyclonal Antibody
iii)Validate the time point parameter of response of the effectors with an
independent vector construct p201G_Cas9
41
Texas Tech University, Sayani Mallick, July 2016
3.2 RESULTS AND DISCUSSION
3.2.1 Pilot Experiment for transient assays: to test the system and parameters of time
by GUS histochemical assay and GFP (reporter enzyme assays)
Since the construct that we are using is the pKYLX binary vector
(https://www.arabidopsis.org/servlets/TairObject?type=vector&id=500600073) which
has a 35S CaMV promoter driving donor cDNA expression, therefore we tested our
time parameters using pBI121 (35S:GUS) [64, 65] and pBI121_GFP as vectors for high
level transgene protein expression .
42
Texas Tech University, Sayani Mallick, July 2016
Figure 5: GUS Histochemical Staining of pBI121 vector (35S promoter driving GUS)
at 24 hours and at 12 hours time frame.
GUS histochemical assay [57] is a technique that is used to test and evaluate the
activity of a promoter (with respect to expression of a gene under that promoter) through
visualization of its activity in tissues. The assay is based on reporter gene beta-
glucuronidase (uidA). The most common substrate for GUS histochemical staining is 5-
bromo-4-chloro-3-indolyl glucuronide (X-Gluc).The product of this chromogenic
reaction is a blue precipitate.
35S CaMV promoter is a strong constitutive promoter in plant tissues. It drives high
levels of gene expression in both monocot and dicot plants. Nicotiana benthamiana being
dicot plant (is an ideal candidate) and also the promoter under study is the 35S promoter
both for the abi1-1 effector challenge experiments (pBI121) and experimental
constructs(pKYLX),we found high signals for this assay 24 hours post-infection (Fig. 6).
43
Texas Tech University, Sayani Mallick, July 2016
Figure 6: GFP expression as seen by using a compound microscope (Olympus BX41) in
pBI121-Gfp driven by 35S promoter at 24 hours and at 12 hours time frame.
Findings: Since both GUS and GFP (Figs. 6 and 7) show good expression at 1
DPI (days post infiltration) / 24 hours, I chose 1DPI(24 hours) as my experimental
time conditions.
44
Texas Tech University, Sayani Mallick, July 2016
3.2.2 Control experiments for establishment of Nicotiana benthamiana transient assay
system at protein level, an important parameter for interpreting effector activities.
Another way of conducting GUS reporter enzyme assay is GUS fluorometric
assay. GUS activity in solution is determined with the fluorogenic substrate 4-
methylumbelliferyl β-D-glucuronide (MUG).The enzyme stability and the high
sensitivity of the GUS assay to qualitative (histochemical assay) and to quantitative
(fluorometric or spectrophotometric assay) detection underlie extensive use of uidA gene
in plant genetic transformation [58].
I endeavored to unify the readout parameters for a seamless interpretation of
"high level" gene expression. In short, how much chromogenic product (from GUS
histochemical assay) correlates to how much fluorescent product which in turn
correlates to how much protein signal that can be quantified in a western blot using a
polyclonal antibody and chemiluminescence (Fig. 8).
45
Texas Tech University, Sayani Mallick, July 2016
Figure 7: calibration of the fluorimeter :generate a 4MU product standard curve to know
dynamic range of instrument
46
Texas Tech University, Sayani Mallick, July 2016
Figure 8: Calibration of Fluorimetric assay to GUS protein quantitation by Immunoblot
with polyclonal Antibody. How much of blue colored product (in GUS histochemical
assay) correlates to how much of activity of fluorescent product which in turn correlates
to how much protein that can be quantified in a western blot. Experiment was conducted
in GV2260 strain.
47
Texas Tech University, Sayani Mallick, July 2016
3.2.3 p201G Cas9 (addgene)
We also wanted to validate the time point parameter of response of the effectors
with an independent vector construct p201G_Cas9 (https://www.addgene.org/59178/)
[66]. The vector p201G_Cas9 consists of two genes: namely Cas9 and GFP- both being
driven under the effect of the constitutive 35s (2x) promoter.
Figure 9: p201G Cas9 (addgene)
Jacobs et al BMC Biotechnology. 2015;15:16 https://www.addgene.org/59178/
48
Texas Tech University, Sayani Mallick, July 2016
Figure 10: GFP expression by using a UV-trans-illuminator showed fluorescence at
1DPI time point and higher fluorescence at 6DPI time point using GV2260 strain. GFP
expression as seen by using a UV-transilluminator. p201G Cas9 (addgene)
49
Texas Tech University, Sayani Mallick, July 2016
Figure 11: Immunoblot with anti-GFP and anti-Cas9 monoclonal antibodies for effectors
in protein extracts from Nicotiana benthamiana. Ubiquitin was used here as an internal
control and Coomassie stain were conducted as the loading control.
(A) Immunoblot with Mab anti-GFP in protein extracts from Nicotiana
benthamiana infiltrated with p201G_Cas9
(B) Immunoblot with Mab anti-Cas9 in protein extracts from Nicotiana benthamiana
infiltrated with p201G_Cas9
50
Texas Tech University, Sayani Mallick, July 2016
CHAPTER IV.
STUDIES ON PYL4 AND PYL7 AND ABA INDUCTION IN N. BENTHAMIANA
AND STABLY TRANSFORMED COTTON
4.1 INTRODUCTION
PYR/PYLs are ABA-receptors that function at the beginning of a negative
regulatory pathway that controls ABA sensitivity by inhibiting PP2Cs.
PYR/PYL/RCARs hence bind to and inhibit PP2Cs when bound to ABA, which allows
accumulation of phosphorylated SnRK2s (targets of PP2Cs) and subsequent activation by
phosphorylation of ABA Response Element Binding Factors (ABFs), encoded by a
family of ABI5-like basic leucine zipper TFs[11]. We are studying PYL4 and PYL7
selectively among the Pyrabactin like receptors activities in transiently transformed
Nicotiana benthamiana and stable transgenic lines of cotton (Gossypium hirsutum). We
are also studying the transient RAVs and ABI5 as references for PYL7 inductive activity.
We want to correlate their activities with respect to ABA induction effect.
We have consistent and reproducible results in both strains of Agrobacteria:
GV3101 and GV2260. I wanted to validate the system with yet other ABA –inducible
endogenous transcriptional readouts.
51
Texas Tech University, Sayani Mallick, July 2016
From our results we can infer and conclude AtPYL7 overexpression results
in agonist ABA signaling activity in N. benthamiana.
It is known from literature that the sorghum SbPYL gene family members were
down-regulated, apart from SbPYL1 and SbPYL7 which showed substantial up-
regulation in leaf tissues under drought stress conditions. This is turn is corroborated
by our findings [7].
52
Texas Tech University, Sayani Mallick, July 2016
4.2 RESULTS
4.2.1 Bidirectional clustering of Arabidopsis ABA receptor PYRL gene
expression intensity and experimental treatments/genotypes.
Figure 12: Bidirectional clustering of Arabidopsis ABA receptor PYRL gene
expression intensity and experimental treatments/genotypes.
The figure shows Bidirectional clustering of Arabidopsis ABA receptor PYRL
gene expression intensity and experimental treatments/genotypes: showing down
regulation (green) of pyl 1/4/6/14(mlp423) by 2 and 10 hr aba and drought and up-
regulation of PYL7 (red). Data extracted from A. thaliana Microarray Gene Expression
database [6].This was the rationale underlying PYL7, PYL4 and mlp423 focus for
transgenic work.
53
Texas Tech University, Sayani Mallick, July 2016
4.2.2 ABA induction experiment: A result at a 1 hour time-point depicting ABA
induction by Northern blot
0
0.32 1 2.33 Norm. Relative Abundance
± 0.09 ±0.03 ±0.03 ±0.04 Normalized (± S.E.M)
Figure 13: ABA induction experiment: A result at a 1 hour time-point depicting ABA
induction (by Northern blot) by probe ERD10C (a traceable and validated ABA-inducible
endogenous reporter gene) in GV3101 strain.
54
Texas Tech University, Sayani Mallick, July 2016
In our transient assays, we used the same readout probe that we used in our
preliminary study. We used Nicotiana tabacum ERD10C as Query and performed
BLAST alignment in sol genomics.com against N. benthamiana database and found
99% homology, verifying that interpretation of hybridization experiments would be
straightforward.
The probe was designed for NtERD10 gene.ERD10 dehydrin gene in Arabidopsis
thaliana encodes a gene induced by drought stress and belongs to the dehydrin protein
family. It is widely known that all NtERD10 genes were weakly expressed under the
normal growth conditions like that in the control plants and strongly induced by drought
and cold stresses. NtERD10 genes are target stress-inducible genes of DREB1A in
tobacco and are possibly accountable for the stress tolerance of the transgenic tobacco.
Transformation of Arabidopsis DREB1A genes in tobacco under the control of
constitutive 35S or stress-inducible rd29A promoter resulted in enhanced drought and
cold stress tolerance and constitutive expression of NtERD10, a family of genes encoding
group 2 LEA proteins [59].
55
Texas Tech University, Sayani Mallick, July 2016
4.2.3 Results for various effector’s activity towards transactivation of endogenous
readout NtERD10 (GV2260)
Strain GV2260: 1DPI Post Infiltration: 1DPI treatment
Size ~ 1kb
Probe:
ERD10C
0 0.72 1 2.22 0.90 1.24 1.75 0.61 0.44 Normalized Relative Abundance
± 0.05 ±0.04 ±0.05 ±0.03 ±0.04 ±0.10 ±0.04 ±0.03 ±0.09 Normalized (± S.E.M)
(A)
56
Texas Tech University, Sayani Mallick, July 2016
(B) Biological Replicate 2 – ERD10C probe
Biological Replicate 3 –ERD10C probe
57
Texas Tech University, Sayani Mallick, July 2016
Figure 14: Results for various effector’s activity towards transactivation of endogenous
readout NtERD10.
(A) The experiment was conducted in GV2260 strain of Agrobacterium. The
timescale for this experiment being 1DPI/24 hours. This experiment was repeated
for three independent biological replicates for the same probe. The normalized
relative abundances and standard error of the mean values was performed on the best
of three replicates, and this replicate was also considered for comparative analysis.
The normalized relative abundances for effector readouts are presented as the ratio of
normalized abundance that from respective ethidium bromide-stained RNA samples.
(B) These results were consistent across two more biological replicates.
58
Texas Tech University, Sayani Mallick, July 2016
4.2.4 Results for various effectors' activity towards transactivation of probe NtERD10
(GV3101)
Strain GV3101: 1DPI Post Infiltration: 1DPI treatment
Probe: ERD10C
Figure 15: Results for various effectors' activity towards transactivation of probe
NtERD10.The probe that is being used encodes a gene induced by drought stress and
belongs to the dehydrin protein family. The experiment was conducted in GV3101
strain of Agrobacterium. The timescale for this experiment being1DPI/24 hours. This
experiment was repeated for three independent biological replicates for the same probe
(data not shown).
59
Texas Tech University, Sayani Mallick, July 2016
4.2.5 Results for various effector’s activity towards transactivation of endogenous
readout TAS14 (GV2260)
Strain GV2260: 1DPI Post Infiltration: 1DPI treatment
(A) Probe: TAS14
0 0.94 1 2.4 0.47 0.90 1.90 0.94 0.66 Normalized Relative Abundance
± 0.05 ±0.06 ±0.07 ±0.03 ±0.07 ±0.04 ±0.03 ±0.09 ±0.10 Normalized (± S.E.M)
60
Texas Tech University, Sayani Mallick, July 2016
(B) Replicate 2 –TAS14 probe
Figure 16: Results for various effector’s activity towards transactivation of endogenous
readout TAS14.
(A) The experiment was conducted in GV2260 strain of Agrobacterium. The
timescale for this experiment being 1DPI/24 hours. This experiment was repeated
for three independent biological replicates for the same probe. The normalized
relative abundances and standard error of the mean values was performed on the best
of three replicates, and this replicate was also considered for comparative analysis.
The normalized relative abundances for effector readouts are presented as the ratio of
normalized abundance that from respective ethidium bromide-stained RNA samples.
(B) These results were consistent across one more biological replicate. 61
Texas Tech University, Sayani Mallick, July 2016
We further validated our work by using another probe namely, NtLEA [67].Late
Embryogenesis Abundant proteins (LEA proteins) are proteins in plants that protect the
plants from desiccation stress or osmotic stresses associated with low temperature.
4.2.6 Results for various effector’s activity towards transactivation of
endogenous readout LEA (GV2260)
Strain GV2260: 1DPI Post Infiltration: 1DPI treatment
Probe - LEA
0 0.13 1 2.35 1.45 1.95 2.36 1.77 1.36 Norm. Relative Abundance
± 0.14 ±0.02 ±0.12 ±0.02 ±0.06 ±0.02 ±0.04 ±0.03 ±0.13 Normalized (± S.E.M)
62
Texas Tech University, Sayani Mallick, July 2016
Figure 17: Results for various effector’s activity towards transactivation of endogenous
readout LEA.
The experiment was conducted in GV2260 strain of Agrobacterium. The
timescale for this experiment being 1DPI/24 hours. This experiment was repeated
for three independent biological replicates for the same probe. The normalized
relative abundances and standard error of the mean values was performed on the best
of three replicates, and this replicate was also considered for comparative analysis.
The normalized relative abundances for effector readouts are presented as the
ratio of normalized abundance that from respective ethidium bromide-stained RNA
samples.
63
Texas Tech University, Sayani Mallick, July 2016
Table 4 -1
Normalized SEM for three probes to validate the expression
Normalized Normalized Normalized Mean SEM ttest
Relative Relative Relative of
Abundance Abundance Abundance probes
LEA TAS14 ERD10C
0.00 0.00 0.00 0.0 0 -
0.13 0.94 0.72 0.6 0.24 -
1.00 1.00 1.00 1.0 0.08 -
2.35 2.40 2.22 2.3 0.05 0.000016
1.45 0.47 0.90 0.9 0.28 -
1.95 0.90 1.24 1.4 0.31 -
2.36 1.90 1.75 2.0 0.19 0.00544
1.77 0.94 0.61 1.1 0.35 -
1.36 0.66 0.44 0.8 0.28 -
64
Texas Tech University, Sayani Mallick, July 2016
Table 4-2:
Normalized SEM for 1 hour ABA induction blot
Normalized Relative Abundance SEM
0 0.09
0.32 0.03
1 0.03
2.33 0.04
65
Texas Tech University, Sayani Mallick, July 2016
4.2.7 Summary of comparative analysis of Fold Induction quantified by Northern blots by
three ABA-inducible endogenous reporter genes.
Figure 18:
(A) Summary of comparative analysis of Fold Induction quantified (by Northern
blots) by three independent, traceable (validated) ABA-inducible endogenous
reporter genes (ERD10C, TAS14, LEA) at 1DPI (with reference to Tables 4-
1 and 4-2).
The error bars indicate the ± S.E.M.(Standard Error of Mean) values for the
biological replicates of northern blots from these probes (n=3). For statistical
significance analysis, a two-tailed Student’s t-test was applied with unequal
variance assumed. Three asterisks (***) indicates significantly different (P < 0.001)
and (**) also indicates significantly different (where P < 0.01) compared
66
Texas Tech University, Sayani Mallick, July 2016
to vector only. Both PYL7 and RAV1 had significantly different readouts than
vector only control. These results were consistent across all three probes and their
biological replicates.
(B) ABA induction experiment: An independent result at a different time point (1
hour) depicting ABA induction (by Northern blot) by probe ERD10C (a
traceable and validated ABA-inducible endogenous reporter gene).
(C) Both Figures A and B in conjunction validate that the fold induction depicted by
vector +ABA is comparable to the fold induction of effectors of ABA signaling,
viz, RAV1 (transcription factor) and PYL7 (receptor) per se.
67
Texas Tech University, Sayani Mallick, July 2016
4.2.8 Positive Control immunoblot for c-myc Mab C9E10
PROTEIN QUANTITATION by Immunoblot: to validate and substantiate our
transient assay system
1 2 3
Lane 1 – RAV1 construct, Nicotiana benthamiana total protein extract
Lane 2 - Untreated /non infiltrated Nicotiana benthamiana total protein
Lane 3 – Thermo Scientific Pierce c-Myc-tagged Positive Control 1mg/mL, E. coli extract
containing c-Myc tagged GST fusion protein(26kDa in size)
Figure 19: Positive Control immunoblot for c-myc Mab C9E10. 15 % SDS PAGE gel –
15ug loading each lane
68
Texas Tech University, Sayani Mallick, July 2016
4.2.9 Immunoblot with Monoclonal antibody c-myc for effectors in protein extracts from
N.benthamiana
69
Texas Tech University, Sayani Mallick, July 2016
Figure 20: Immunoblot with Monoclonal antibody c-myc for effectors in protein
extracts from Nicotiana benthamiana. Ubiquitin was used here as an internal control and
Coomassie stain was conducted as the loading control
4.2.10 Approach for phenotypic segregations in PYL cotton stable transgenics
PYL stable transgenics - Transformation and regeneration of the Pyrabactin gene
constructs in the elite Coker312 variety of cotton completed. Our aim is to conduct c-myc
Western assays for cotton tissues to establish the post translational molecular phenotypes
for correlation between effector expression in independent events and any observed
phenotypes. We also want to study the potential impact of these transgenes on agronomic
traits in cotton. Screening of T1 cotton seedlings was done on Stewart’s Germination
media supplemented with 50 μg/ml Kanamycin .Wild type Coker 312, showing no lateral
root development in all control seedlings, whereas ~ 3:1 segregation for kanamycin
resistance gene in the transgenic lines.
70
Texas Tech University, Sayani Mallick, July 2016
Figure 21: Image demonstrates the junction between tap root and hypocotyls
71
Texas Tech University, Sayani Mallick, July 2016
Figure 22: Screening of T1 cotton seedlings on Stewart’s Germination media
supplemented with 50 μg/ml Kanamycin
72
Texas Tech University, Sayani Mallick, July 2016
Figure 23: Establishment of plantlets in soil
73
Texas Tech University, Sayani Mallick, July 2016
Figure 24: T2 Plants in Greenhouse after screening for transgene with kanamycin
74
Texas Tech University, Sayani Mallick, July 2016
Preliminary Physiological Phenotypes: PYL stable transgenics
(A)
75
Texas Tech University, Sayani Mallick, July 2016
(B)
76
Texas Tech University, Sayani Mallick, July 2016
(C)
77
Texas Tech University, Sayani Mallick, July 2016
Figure 25: Preliminary Physiological Phenotypes: Showed Better developed lateral root
system and longer internode lengths under greenhouse conditions for the kanamaycin-
selected transgenic lines. Also increased weight of fiber with seed (grams) and increased
number of bolls.
(A) Growth of plants after 4 months of full irrigation - All ten PYL4 lines, showed
such phenotypes
(B) Growth of plants after 4 months of full irrigation - All ten PYL7 lines, showed such
phenotypes
(C) Growth of plants after 4 months of full irrigation - All ten mlp423 lines, showed such
phenotypes
78
Texas Tech University, Sayani Mallick, July 2016
4.3 DISCUSSION
We have consistent and reproducible results in both strains of Agrobacteria:
GV3101 and GV2260 .Traditionally, Gv2260 strain is used for N. benthamiana and
GV3101 is used for Arabidopsis. However, in recent years, there has been several
studies conducted in N. benthamiana well with the GV3101 strain [60, 62, 64].
But, I wanted to validate the system with yet other endogenous transcriptional
readout. I designed a probe for TAS14 marker gene.TAS14 is a dehydrin gene that
accumulates in response to mannitol, NaCl or ABA treatment [65, 66, 67]. We used
Nicotiana tabacum TAS14 as Query and performed BLAST alignment in sol
genomics.com against N. benthamiana database and found significant
homology matches.
AtPYL7 overexpression results in agonist ABA signaling activity in N.
benthamiana. This is further substantiated by the fact that PYL7 overexpression results in
similar agonist activity as the ABA induction effect in Figure 17B.This is also validated
by comparative data analysis showing statistical significance. For PYL7 agonist activity,
the results were significantly different at P < 0.01.Similar results were obtained in terms
of AtRAV1 (a known ABA effector by our prior work), which also showed similar
agonist activity as the ABA induction effect. For the RAV1, the results were significantly
different at P < 0.001.These data suggest as evidence that these effectors result in agonist
ABA activity in N.benthamiana assays and hence enables us to functionally characterize
the various effectors of ABA signaling pathway in this transient system.
79
Texas Tech University, Sayani Mallick, July 2016
The results support and is validated by previous literature that SbPYL gene
family members were down-regulated, apart from SbPYL1 and SbPYL7 which showed
substantial up-regulation in leaf tissues under drought stress conditions[7].
Protein expression for these effectors to functional effects via immunoblots
confirmed that - these data together at the transcriptional and translational levels support
the claim that Nicotiana benthamiana transient assays are a robust and facile system to
functionally characterize the various effectors of ABA signaling pathways and study their
molecular interactions.
For further future work, the stable cotton transgenics could be characterized for
further insightful studies at the molecular level. Molecular characterization of the PYL
(PYL4, PYL7 and mlp423) stable transgenic cotton lines by analyzing readouts both at
the transcriptional (via northern blots) and translational level (via western blots) could be
carried out
If we can exploit the rapid and robust nature of N.benthamiana assays to
functionally characterize the ABA receptors (and transcription factors), then results can
be translated to stable transformation of crops like upland cotton (Gossypium hirsutum) to
gain deeper insights into the utility of ABA receptors. Our overall goal is for deeper
understanding of efficacy and molecular mechanisms of deeply conserved ABA gene
effectors by characterization in heterologous systems (both transient and stable).
80
Texas Tech University, Sayani Mallick, July 2016
CHAPTER 5
CHARACTERIZATION OF RAV1 AND ABI5 DROUGHT-STRESS
PHENOTYPES IN COTYLEDONS AND LEAVES OF TRANSGENIC COTTON
5.1 INTRODUCTION TO THE STUDY AND BACKGROUND
Restricted water availability is one of the major abiotic factors impacting
crop production worldwide. Significant efforts have been taken to enhance drought
tolerance (high water use efficiency, osmotic adjustment) and avoidance (early flowering,
increased root biomass) traits [68, 69] in crop plants through two main approaches: 1)
traditional plant breeding at the scale of whole plants (so called ‘top-down’ approaches),
and 2) advanced bioengineering at the scale of individual genes (so called ‘bottom-up’
approaches) [70] .While advances have been made in the development of drought-
tolerant cultivars, knowledge about the metabolic and physiological traits that
functionally contribute to the drought-tolerant phenotypes remains limited.
Understanding how genotypes produce a given phenotype will contribute towards closing
the gap between the top-down and bottom-up approaches [71], and may facilitate
development of efficient protocols for screening candidate drought-tolerant cultivars [72].
Genomic and genetic analyses primarily of the model plant Arabidopsis thaliana (L.
81
Texas Tech University, Sayani Mallick, July 2016
Heynh.) have elucidated the biosynthetic and signal transduction pathways of abscisic
acid (ABA) and its roles in stress response. Similarly, transgenic cotton (Gossypium
hirsutum L.) lines have been generated that over-express the basic leucine zipper domain
transcription factor AtABA-INSENSITIVE5 [73] and Basic3/APETALA2-domain
transcription factors of the Related to ABI3/Viviparous1 (RAV) clade AtRAV1,
AtRAV2/TEMPRANILLO2, and AtRAV2L/TEMPRANILLO1.
The resultant cotton transgenics expressing AtRAV1, AtRAV2, and AtABI5 showed
many genetic and morphological responses, including altered environment-regulated and
fiber-associated gene expression, delayed flowering time, increased water use
efficiency, and greater root biomass and fiber length under drought irrigation stress in
the greenhouse and field [59, 62].
Hypothesis:
Our initial hypothesis was the transgenic lines would exhibit drought tolerance
through an enhanced responsiveness to ABA, because previous research has shown that
these transgenes are effectors of (i.e., downstream respondents to endogenous) ABA.
Hence, the hypothesis is that over-expression of AtRAV1 resulted in an ABA-
hypersensitive phenotype manifest as lower levels of endogenous ABA in cotyledons
associated with greater reductions in pore apertures during stress and increased stomatal
density. Therefore, the transgenic lines may have enhanced responses to abscisic acid
(ABA), resulting in greater water use efficiency under drought stress.
82
Texas Tech University, Sayani Mallick, July 2016
Objective:
To characterize RAV1 and ABI5 expression at the protein level in seeds and to address
mechanisms of drought tolerance and adaptation by morphological and physiological
assays of cotyledonary leaves and greenhouse-grown plants subjected to drought stress.
5.2 RESULTS
5.2.1 Characterization of transgene protein accumulation in cotton seeds
Previous work showed high levels of mRNA expression in leaves and
developing ovules for the ABI5 and RAV1 transgenes driven by the 35S promoter
[59, 62], so we endeavored to validate transgene protein accumulation in the events
under study.
Immunoblot of proteins extracted from seeds of transgenic ABI5 and
RAV1 overexpressing lines and from leaves of Nicotiana benthamiana transiently
transformed with Agrobacterium harboring the same T-DNA vector for production of
RAV1 stable cotton transformants. Immunoblot probed with monoclonal anti c-myc
antibody. c-myc:ABI5 protein expected size is 61 kDa; c-myc:RAV1 protein expected
size is 52 kDa. Same blot probed with anti-ubiquitin antibody, as loading control.
Coomassie-stained gel.
83
Texas Tech University, Sayani Mallick, July 2016
84
0 126.7 121.1 1 3 1.2 14.1 58.1 100 Norm Relative Abundance
± 0.03 ± 0.02 ±0.01 ± 0.07 ±0.03 ±0.01 ±0.09 ±0.12 ±0.01 Normalized(±S.E.M.)
± 0.03 ±0.02 ±0.01 ±0.07 ±0.03 ±0.01 ±0.09 ±0.12 ±0.01 Normalized (± S.E.M)
Texas Tech University, Sayani Mallick, July 2016
Figure 26: Immunoblot with Mab c-myc for effectors in seed protein extracts
from cotton stable transgenics. Study of established cotton lines as in [59,61] for protein
level allelic variations. The normalized relative abundances for effector protein readouts
are presented as the ratio of normalized abundance that from respective ubiquitin control
samples. Whereas there is not much quantitative variation between each of the
independent events of ABI5 and RAV1 cotton lines. There seems to substantial variation
in the expression profile of the three independents events pertaining to RAV2L lines.
This may be correlated with our previous work at the physiological level [59,61].Cotton
seed plus fiber yield/plant (in grams) of transgenics compared to wild type under well-
watered greenhouse conditions was highest in 40-24-2-1 >40- 4-2-1> 40-23-4-4.Also in
studies of Late boll cracking in transgenic lines 99 days after sowing (DAS) treatments in
the field – it was found that the percent Cracked Bolls was significantly higher in 40-24-
2-1 both in under well watered (WW) and deficit irrigation (DI),and the percent cracked
bolls was lowest in 40-23-4-4 (40-24-2-1 >40- 4-2-1> 40-23-4-4).
85
Texas Tech University, Sayani Mallick, July 2016
5.2.2 RAV11-1-5
cotyledonary leaves have higher stomatal density and smaller guard
cell apertures during drought stress and recovery (data contributed by Dr. Justin Fiene)
Guard cell pores (i.e., stomatal apertures) are the primary means of water loss and
CO2 uptake in plants. Recent work has revealed that guard cell ABA sensitivity increases
as the leaf ages, and ABA controls plasticity of stomatal patterning in cotyledons [74, 75,
76, 77]. Since our prior work with these ABI5 and RAV1 transgenic cotton lines found
transgene effects on photosynthesis and stress response physiology, we measured
stomatal density and apertures in cotyledons. Figure shows that the RAV11-1-5
overexpression line had significantly more stomata on the abaxial side of cotyledons than
Coker312, and that ABI51-1-1
genotype trended toward higher stomatal density.
Drought stress conditions cause guard cell pores to shrink in size (literally area as
measured, μm2) to minimize water loss, and to increase in size during drought recovery
to promote uptake of CO2, thereby enhancing photosynthetic capabilities. Guard cell
pores can change in two different ways when observed in two dimensions by microscopic
analysis of epidermal casts: (i) the area (μm2) of the guard cells (i.e., stomata) per se
could change by fluctuations in plant turgor pressure, with the pore area (μm2) changing
proportionally, or (ii) the area (μm2) of guard cell pores might change differently with
respect to the overall size of the guard cells. To tease apart the two different possibilities
86
Texas Tech University, Sayani Mallick, July 2016
for changes in guard cell pores, we quantified the area of both guard cells and their pores,
and analyzed the relationship between pore size and guard cells (i.e., pore area / guard
cell area).
Figure 27: Stomatal densities on abaxial side of 13-day-old cotyledons of Coker 312 and
ABI5 and RAV1 overexpressing transgenics. Bars represent mean density ± S.E.; n= 11-12
individual plants per genotype, seven to eight images per plant. Asterisk (*) indicates
87
Texas Tech University, Sayani Mallick, July 2016
significantly different (P < 0.00001) from Coker312 control (this data is contributed
by Dr. Justin Fiene)
5.2.3 RAV11-1-5
and ABI51-1-1
mature leaves have higher stomatal conductance and
photosynthetic rates under drought stress (data contributed by Dr. Amandeep Mittal)
To extrapolate the working hypothesis from cotyledonary to mature leaves, we
directly measured photosynthetic parameters including stomatal conductance in five-
week-old greenhouse-grown plants, and the results are shown in Fig. 28. Coker 312
(wild-type) plants had a strong wilting phenotype in the afternoon of day four after
withholding water (data not shown). This strong drought stress resulted in significant and
progressive inhibitory effects on stomatal conductance and photosynthesis, which were
partially relieved after two days of re-watering. The ABI51-1-1
transgenic line showed
significantly higher stomatal conductance (95% higher; P < 0.05) and photosynthetic
yields (75% higher; P < 0.05) at six days of drought (Fig. 28) and under drought stress
did not show wilting symptoms (data not shown), as previously shown [59] .The RAV11-
1-5 transgenic line at six days of drought showed a significantly higher stomatal
conductance rate (80% higher; P < 0.05) and higher photosynthetic rates (34% higher)
than Coker 312. Photosynthesis at six days of drought in ABI513-4-1
was strongly
88
Texas Tech University, Sayani Mallick, July 2016
inhibited, similar to that of Coker 312, while stomatal conductance trended higher
than Coker 312, consistent with lower ABI5 protein levels seen in seeds (Fig. 26).
89
Texas Tech University, Sayani Mallick, July 2016
Figure 28: Timecourse over six days of drought stress and recovery of five-week old
greenhouse-grown transgenic cotton (Gossypium hirsutum L.) over-expressing AtABI5
or AtRAV1. (A) Stomatal conductance rates and (B) photosynthetic assimilation.
Abbreviations: nD-Drt, n= 3,5, or 6 days of drought; nD-Rec, n days recovery from
drought after re-watering. Bars represent means ± S.E.; n = 3-6 on control, 3D-Drt, 5D-
Drt and 1D-Rec; n = 6-12 on 6D-Drt; n = 2-6 on 2D-Rec. Asterisk (*) indicates
significantly different (P < 0.05) than Coker312 (this data is contributed by Dr.
Amandeep Mittal)
5.3 DISCUSSION
Among the three transgenic lines, RAV11-1-5
had the lowest ABA levels during
drought stress compared to control Coker312. The evidence showing RAV11-1-5
plants had
higher stomatal conductance and photosynthesis rates. Our initial hypothesis was the
transgenic lines would exhibit drought tolerance through an enhanced responsiveness to
ABA, because previous research has shown that these transgenes are effectors of (i.e.,
downstream respondents to endogenous) ABA. Somewhat unexpectedly, despite smaller
pore spaces and stomatal opening, the cotyledons of AtRAV and AtABI5 transgenics had
90
Texas Tech University, Sayani Mallick, July 2016
increased stomatal conductance, transpiration and hence transpirational cooling. We
found evidence of a drought tolerance phenotype in ABI51-1-1
based on lower ABA
levels, lower LST, and higher stomatal conductance and photosynthetic rates than control
Coker312. However, we were unable to strictly correlate this phenotype with apparent
ABI5 protein expression (in seeds, Fig.26) or changes in stomatal density (Fig. 27) or
guard cell pore sizes , which suggests there may exist alternative mechanisms for drought
tolerance/avoidance in ABI51-1-1
than postulated for AtRAV1 in this study. The results
of this study suggest that over-expression of RAV11-1-5
can result in drought tolerance
through adaptive hypersensitive responses of guard cells to endogenous ABA. Given that
[59, 62] also found drought avoidance in RAV11-1-5
through greater root dry biomass, it
is possible that over-expression of RAV11-1-5
influences multiple plant traits which each
contribute to different facets of a complex of drought adaptation phenotypes. Since over-
expression of capsicum RAV1 in Arabidopsis results in enhanced resistance to a
pathogen known to infect hosts through guard cell pores, RAV1 may be a promising
target to impact crop resistance to biotic and abiotic stresses.
91
Texas Tech University, Sayani Mallick, July 2016
CHAPTER VI. CONCLUSION AND FUTURE DIRECTIONS
6.1 CONCLUSION
To summarize my findings, I would submit that to develop a transient assay
system for ABA induction in the shortest possible time frame allows us to functionally
characterize effectors of ABA signaling pathway and the modules or switches. This
system can be useful in many ways to study various ABA responsive genes. From the
very onset of the project, the idea was to conduct the experiment in the shortest possible
time as ABA responses are elicited in matter of seconds. Hence it was a trade off from
the very beginning, where I had to balance and weigh various parameters and factors so
that the effector and reporter genes that are being assayed as ABA response gets
interpreted without knock-on/indirect effects over time.
PYR/PYLs are ABA-receptors that function at the beginning of a negative
regulatory pathway that controls ABA sensitivity by inhibiting PP2Cs.
PYR/PYL/RCARs hence bind to and inhibit PP2Cs when bound to ABA, which allows
accumulation of phosphorylated SnRK2s (targets of PP2Cs) and subsequent activation by
phosphorylation of ABA Response Element Binding Factors (ABFs), encoded by a
family of ABI5-like basic leucine zipper TFs[11]. We are studying PYL4 and PYL7
selectively among the Pyrabactin like receptors activities in transiently transformed
Nicotiana benthamiana and stable transgenic lines of cotton (Gossypium hirsutum). I
92
Texas Tech University, Sayani Mallick, July 2016
have also studied the transient RAVs and ABI5 as references for PYL7 inductive
activity. I wanted to correlate their activities with respect to ABA induction effect.
We have consistent and reproducible results in both strains of
Agrobacteria: GV3101 and GV2260. I wanted to validate the system with other
ABA –inducible endogenous transcriptional readouts.
We got interpretable results of this transient assay at the protein level as well.
This was a very important exercise as until effector proteins were quantified, the activity
is not normalized to the cellular context, In that case, the transient assay will not help us
much in this aspect. If effector proteins were unstable or poorly expressed, this could
reflect unwanted pleiotropic effect, possible post translational modifications. In the
future, this established system will allow us to test various genes and effectors of the
ABA signaling pathway at a transient level, before moving on to stable transgenics. This
would be immensely beneficial in terms of understanding transcriptional and
translational read outs, in turn allowing us to interpret and propagate the results in stable
transgenics properly.
ABA directly affects guard cell physiology, and in our study guard cell pores of
RAV11-1-5
were 26% smaller than control Coker312. Interestingly, after correcting for
the size of the guard cells, the guard cell pores were disproportionally smaller (19%) than
control Coker312 . Hypersensitivity to ABA through over-expression of RAV1 showed
that exogenous ABA applied to Arabidopsis lines over-expressing a heterologous RAV1
resulted in ABA-hypersensitive inhibition of germination and root elongation. This result
is intriguing in light of our data showing smaller guard cell pores in over-expressing
93
Texas Tech University, Sayani Mallick, July 2016
AtRAV1 cotton plants, and begs the question of whether smaller guard cell pores in
Arabidopsis lines over-expressing RAV1 explain their enhanced resistance to pathogen
infection. Moreover, guard cell pores serve many critical functions in plants (i.e., water
loss, CO2 uptake, and pathogen susceptibility) .RAV1 transgenics may have value for the
development of drought-tolerant and pathogen-resistant crop varieties.
The “less stressed” phenotypes observed for AtRAV11-1-5
could be due to better
water use through disproportionally smaller guard cell pores. In [59,62] found an
additional mechanism of drought avoidance in RAV11-1-5
by showing that drought-
stressed plants grew ~80% more root dry biomass in the greenhouse than Coker 312. We
have also observed a late flowering phenotype of these AtRAV1 and AtRAV2 over-
expressing cotton lines [59, 62], supporting the drought avoidance mechanism. Taken
together, the “less stressed” phenotype by RAV11-1-5
may therefore be due to multiple
mechanisms of drought avoidance (late flowering, greater root biomass) and drought
tolerance (improved water use efficiency through stomatal regulation and attendant
increases in photosynthesis) (Fig. 28). Evidence of drought-avoidance traits in ABI51-1-1
[59, 62]. Under drought-stress conditions in the field, ABI51-1-1
had larger leaf area, root
biomass, and in greenhouse conditions longer internode length and greater yield than
control Coker 312, respectively. Furthermore, stacked transgenic lines from crosses
between ABI5 and AtRAV1 and AtRAV2 showed synergy in plant yield, among other
responses. It seems possible therefore that multiple mechanisms of drought tolerance and
avoidance exist in ABI5 and RAV1 lines studied here, which could potentially explain
why stacked transgenic lines of ABI5 plus RAVs showed synergies in some, but not all,
characterized phenotypes.
94
Texas Tech University, Sayani Mallick, July 2016
6.2 FUTURE DIRECTIONS
Approach to study functional interactions of ABI1 (ABA-INSENSITIVE 1) with PYL4/7
Future studies can be conducted to validate the observed candidate AtPYL4/7
activities as specific for ABA signaling per se by functional interaction with an
engineered abi1-1 dominant negative effector construct in transient assays, like has
been done before in protoplasts [55, 59].
Functional interaction studies of ABI1(ABA-INSENSITIVE 1) with PYL4/7 in
Nicotiana benthamiana by co-infiltration, and then getting the read outs both at the
transcriptional and translational level. In this study, my goal is to test the abi1-1 T-DNA
effector construct in pBI121 backbone [86].Arabidopsis ABI1 gene encodes a member of
the 2C class of protein serine/threonine phosphatases (PP2C), and the abi1-1 mutation
strikingly reduces ABA responsiveness in both seeds and vegetative tissues. However,
this mutation is dominant and has been the lone mutant allele accessible for ABI1 gene. A
loss of ABI1 PP2C activity leads to an enhanced responsiveness to ABA. Hence, the
wild-type ABI1 phosphatase is a negative regulator (suppressor) of ABA responses [87].
PP2Cs being monomeric enzymes can be more easily used for functional characterization
studies. Scores of Arabidopsis PP2Cs have the conserved Glycine amino acid residues
(aa174 and aa180 of ABI1 protein) that are necessary for phosphatase and ABA signaling
activity [88, 89], signifying that they too could function in ABA and/or stress responses
in plants. Previously, the phosphatase active site has been mutated (G174D) to express a
null mutant [57].The conserved Glycine residue at amino acid location 180 of ABI1 is
95
Texas Tech University, Sayani Mallick, July 2016
vital for ABA signaling and the G180→D mutation results in dominant-negative alleles
for ABI1 (G168D) .This means that G180D point dominant-negative mutation is
functionally negative but phenotypically dominant. In others words, this mutant when
functional it should behave like the wild type, but phenotypically its activity should be
low, due to the mutation being present. The semi-dominant abi1-1 alleles is a missense
mutation of a conserved Glycine residue to Aspartic Acid (G180D in abi1-1) that result in
a dominant negative phenotype in vivo and reduced phosphatase activities in vitro [57,
88].
The point mutation of PYR1 P88S severely compromises the physical interaction
between PYR1 and HAB1, but it does not hamper the ABA binding to PYR1 – which
establishes the fact that ABA binding can be uncoupled from PP2C inhibition [11].
Structural biology studies are consistent with this – which shows that Proline-88 (which
is invariant in the family and is located in the PYR1’s gate domain) is positioned to
make direct interaction with PP2Cs in response to ABA [26, 89, 90]. Moreover, the
dominant/hypermorphic abi1-1(ABI1^G180D) and abi2-1 (ABI2^G168D) encoded
mutant proteins do not bind PYR1 in response to ABA. This observation suggested that
their hypermorphic activity arises because they cannot be inhibited by PYR/PYL/RCAR
proteins in response to ABA. Also, the mutations in the hypermorphic ABI proteins map
close to the docking site of PYR/PYL proteins as revealed by X-ray structures.
96
Texas Tech University, Sayani Mallick, July 2016
Future Study of tissue-specific expression of the transgenes of RAVs and
ABI5 established cotton lines
An interesting area of study can be to characterize by immunoblot the
established AtRAV1, AtRAV2, AtABI5, and AtRAV2L transgenic cotton lines
described in [58] for effector protein level allelic variations, in order to test for
correlation to observed physiological phenotypes of multiple transgene events. For
established RAV & ABI5 cotton lines, try tissue-specific expression of the transgenes in
seed (already completed), stem, root and leaf in cotton.
A Computational Approach to characterize selective interactions of GhPYL4
and GhPYL7 with GhPP2C members:
Another approach of study can be to try computationaly to characterize selective
interactions of GhPYL4 and GhPYL7 with GhPP2C members: To demonstrate that
GhPYLs bind to GhPP2Cs in wide-ranging manner and with divergent intensities and to
show that the ABA-sensing machinery is preserved among diverse plant species. Now
that the tetraploid upland cotton genome has been recently published, we can
computationally predict the Pyrabactin Resistance-Like PYL4 and PYL7 Abscisic Acid
Receptor in Cotton. This will also help us to characterize their tissue-specific and stress-
responsive expressions compared to the results from other species like Arabidopsis.
97
Texas Tech University, Sayani Mallick, July 2016
Molecular characterization of the PYL (PYL4, PYL7 and mlp423) stable transgenic
cotton lines
The stable transgenic cotton lines can be characterized and studied. Molecular
characterization of the PYL (PYL4, PYL7 and mlp423) stable transgenic cotton lines
by analyzing readouts both at the transcriptional (via northern blots) and translational
level (via western blots).
Test in the transient system the ABA signaling activities of other Arabidopsis PYL
family members
Other effectors can be functionally characterized for their readouts in this
transient system. Test in the transient system the ABA signaling activities of other
Arabidopsis PYL family members AtPYR1 (univector donor U15941), AtPYL1
(U18010), AtPYL5 (U13617), AtPYL6 (U50118), AtPYL8.2 (U23619), AtPYL9
(U22850), and AtPYL10 (C103436) on endogenous ABA signaling pathway
ERD10C transcriptional readouts.
Co-immunoprecipitation experiments to show that PYL7 binds a PP2C
Co-immunoprecipitation experiments could also be designed to show that
PYL7 binds a PP2C. A co-immunoprecipitation approach to validate the PP2C subunit
binds with PYL7 in transient Nicotiana benthamiana assays.
98
Texas Tech University, Sayani Mallick, July 2016
Regulation of ABA catabolism and ABA sensitivities per se in the RAV and ABI5 cotton
transgenic lines
Among the three cotton transgenic lines, RAV11-1-5
had the lowest ABA levels
during drought stress compared to control Coker312. The evidence showing RAV11-1-5
plants had higher photosynthesis rates (Figure 28), and support a “less stressed”
phenotype under drought stress, which agrees with previous results [59,62]. However, all
three transgenic lines had higher ABA levels than Coker312 during drought recovery,
raising questions about regulation of ABA catabolism and ABA sensitivities per se and
activities of known ABA homeostatic feedback loop Further studies using 18
O2 to
quantify metabolic fluxes to and from ABA in the transgenics could shed light on this
issue.
99
Texas Tech University, Sayani Mallick, July 2016
References:
1. Leung J., Giraudat J.(1998) Abscisic acid signal transduction. Annual Review of
Plant Biology.1998;49(1):199–222.
2. Fan, W., Li, J., Jia, J., Wang, F., Cao, C., Hu, J., & Mu, Z. (2015). Pyrabactin
regulates root hydraulic properties in maize seedlings by affecting PIP
aquaporins in a phosphorylation-dependent manner. Plant Physiology and
Biochemistry, 94, 28-34.
3. Finkelstein, R. R., Gampala, S. S. L., & Rock, C. D. (2002). Abscisic Acid
Signaling in Seeds and Seedlings. The Plant Cell, 14(Suppl), s15–s45.
4. Antoni, R., Gonzalez-Guzman, M., Rodriguez, L., Peirats-Llobet, M., Pizzio, G.
A., Fernandez, M. A.,& Rodriguez, P. L. (2013). Pyrabactin resistance1-like8
plays an important role for the regulation of abscisic acid signaling in root. Plant
physiology, 161(2), 931-941.
5. Lim, C. W., Luan, S., & Lee, S. C. (2014). A prominent role for RCAR3-
mediated ABA signaling in response to Pseudomonas syringae pv. Tomato
DC3000 infection in Arabidopsis. Plant and Cell Physiology
6. Matsui A., Ishida J., Morosawa T., Mochizuki Y., Kaminuma E., Endo T. A., et al.
(2008). Arabidopsis transcriptome analysis under drought, cold, high-salinity and
ABA treatment conditions using a tiling array. Plant Cell Physiol. 49 1135–1149.
7. Monika Dalal , Madhuri Inupakutika (2014) Transcriptional regulation of ABA
core signaling component genes in sorghum (Sorghum bicolor L. Moench). Short
Communication. Molecular Breeding, Volume 34, Issue 3, pp 1517-1525 100
Texas Tech University, Sayani Mallick, July 2016
8. Yamburenko, M; Zubo, Y; Boerner, T (2015) Abscisic acid affects transcription of
chloroplast genes via protein phosphatase 2C-dependent activation of nuclear
genes: repression by guanosine-3-5-bisdiphosphate and activation by sigma factor
5 .Plant journal volume: 82 issue: 6 pages: 1030-1041
9. Hayashi, Y; Takahashi, K; Inoue, S (2014) Abscisic Acid Suppresses Hypocotyl
Elongation by Dephosphorylating Plasma Membrane H+-ATPase in
Arabidopsis thaliana Plant and Cell Physiology Volume: 55 Issue: 4 Special
Issue: SI Pages: 845-853
10. Ma, Y., Szostkiewicz, I., Korte, A., Moes, D., Yang, Y., Christmann, A., &
Grill, E. (2009). Regulators of PP2C phosphatase activity function as abscisic
acid sensors. Science, 324(5930), 1064-1068.
11. Park, S.-Y., Fung, P., Nishimura, N., Jensen, D. R., Fujii, H., Zhao, Cutler, S.
R. (2009). Abscisic acid inhibits PP2Cs via the PYR/PYL family of ABA-
binding START proteins. Science (New York, N.Y.), 324(5930), 1068–1071.
12. Santiago, J., Rodrigues, A., Saez, A., Rubio, S., Antoni, R., Dupeux, F. &
Rodriguez, P. L. (2009). Modulation of drought resistance by the abscisic
acid receptor PYL5 through inhibition of clade A PP2Cs. The Plant Journal,
60(4), 575-588.
101
Texas Tech University, Sayani Mallick, July 2016
13. Cutler, S. R., Rodriguez, P. L., Finkelstein, R. R., & Abrams, S. R. (2010).
Abscisic acid: emergence of a core signaling network. Annual Reviews
Plant Biology, 61, 651-679.
14. Lim, C; Baek, W; Jung, J (2015) Function of ABA in Stomatal Defense against
Biotic and Drought Stresses International Journal of Molecular Sciences
Volume: 16 Issue: 7 Pages: 15251-15270
15. Yoshida, T; Mogami, J; Yamaguchi-Shinozaki, K (2015) Omics Approaches
Toward Defining the Comprehensive Abscisic Acid Signaling Network in
Plants Plant and cell physiology Volume: 56 Issue: 6 Pages: 1043-1052
16. Gonzalez-Guzman, M., Pizzio, G. A., Antoni, R., Vera-Sirera, F., Merilo, E.,
Bassel, G. W. Rodriguez, P. L. (2012). Arabidopsis PYR/PYL/RCAR Receptors
Play a Major Role in Quantitative Regulation of Stomatal Aperture and
Transcriptional Response to Abscisic Acid. The Plant Cell, 24(6), 2483–2496.
17. Shen, Y. Y., Wang, X. F., Wu, F. Q., Du, S. Y., Cao, Z., Shang, Y. & Fan, R.
C. (2006). The Mg-chelatase H subunit is an abscisic acid receptor. Nature,
443(7113), 823-826.
18. Wu, F. Q., Xin, Q., Cao, Z., Liu, Z. Q., Du, S. Y., Mei, C. & Zhang, X. F.
(2009). The magnesium-chelatase H subunit binds abscisic acid and functions in
abscisic acid signaling: new evidence in Arabidopsis. Plant physiology, 150(4),
1940-1954.
102
Texas Tech University, Sayani Mallick, July 2016
19. Liu, X., Yue, Y., Li, B., Nie, Y., Li, W., Wu, W. H., & Ma, L. (2007). AG
protein-coupled receptor is a plasma membrane receptor for the plant hormone
abscisic acid. Science, 315(5819), 1712-1716.
20. Pandey, S., Nelson, D. C., & Assmann, S. M. (2009). Two novel GPCR-type G
proteins are abscisic acid receptors in Arabidopsis. Cell, 136(1), 136-148.
21. McCourt, P., & Creelman, R. (2008). The ABA receptors–we report you decide.
Current opinion in plant biology, 11(5), 474-478.
22. Merilo, E; Laanemets, K; Hu, H (2013) Pyr/Rcar Receptors Contribute to Ozone-
, Reduced Air Humidity-, Darkness-, and CO2-Induced Stomatal Regulation
Plant Physiology Volume: 162 Issue: 3 Pages: 1652-1668
23. Geiger D (2009) Activity of guard cell anion channel SLAC1 is controlled by
drought-stress signaling kinase-phosphatase pair. Proc Natl AcadSci USA
106(50): 21425–21430
24. Brandt, B; Brodsky, D; Xue, S (2012) Reconstitution of abscisic acid activation of
SLAC1 anion channel by CPK6 and OST1 kinases and branched ABI1 PP2C
phosphatase action Proceedings of the National Academy of Sciences of the
United states of America Volume: 109 Issue: 26 Pages: 10593-10598
25. Demir, F., Horntrich, C., Blachutzik, J. O., Scherzer, S., Reinders, Y.,
Kierszniowska, S. & Kreuzer, I. (2013). Arabidopsis nanodomain-delimited ABA
signaling pathway regulates the anion channel SLAH3. Proceedings of the
National Academy of Sciences, 110(20), 8296-8301.
103
Texas Tech University, Sayani Mallick, July 2016
26. Miyazono, K. I., Miyakawa, T., Sawano, Y., Kubota, K., Kang, H. J., Asano,
A. & Yoshida, T. (2009). Structural basis of abscisic acid signalling. Nature,
462(7273), 609-614.
27. Fujita, Y; Yoshida, T; Yamaguchi-Shinozaki, K (2013) Pivotal role of the
AREB/ABF-SnRK2 pathway in ABRE-mediated transcription in response to
osmotic stress in plants Physiologia Plantarum Volume: 147 Issue: 1Special Issue:
SIPages: 15-27
28. Park, SY; Peterson, F.; Mosquna, Assaf (2015) Agrochemical control of plant
water use using engineered abscisic acid receptors Nature Volume: 520 Issue:
7548 Pages: 545
29. Zhang, X L.; Jiang, L; Xin, Q (2015) Structural basis and functions of abscisic
acid receptors PYLs Frontiers In Plant Science Volume: 6 Article Number:88
30. Castillo, M. C., Lozano-Juste, J., González-Guzmán, M., Rodriguez, L.,
Rodriguez, P. L., & León, J. (2015). Inactivation of PYR/PYL/RCAR ABA
receptors by tyrosine nitration may enable rapid inhibition of ABA signaling by
nitric oxide in plants. Sci. Signal., 8(392), ra89-ra89.
31. Scuffi, D., Álvarez, C., Laspina, N., Gotor, C., Lamattina, L., & García-Mata, C.
(2014). Hydrogen sulfide generated by l-cysteine desulfhydrase acts upstream of
nitric oxide to modulate abscisic acid-dependent stomatal closure. Plant
physiology, 166(4), 2065-2076.
104
Texas Tech University, Sayani Mallick, July 2016
32. Tian, X; Wang, Z; Li, X (2015) Characterization and Functional Analysis of
Pyrabactin Resistance-Like Abscisic Acid Receptor Family in Rice. Rice
(New York, N.Y.) Volume: 8 Issue: 1 Pages: 28
33. Wang, Y. G., Yu, H. Q., Zhang, Y. Y., Lai, C. X., She, Y. H., Li, W. C., & Fu, F.
L. (2014). Interaction between abscisic acid receptor PYL3 and protein
phosphatase type 2C in response to ABA signaling in maize. Gene, 549(1), 179-
185.
34. Zhao, Y; Xing, L; Wang, X (2014) The ABA Receptor PYL8 Promotes Lateral
Root Growth by Enhancing MYB77-Dependent Transcription of Auxin-
Responsive Genes Science Signaling Volume: 7 Issue: 328
35. Vilela, B., Pagès, M., & Riera, M. (2015). Emerging roles of protein kinase CK2
in abscisic acid signaling. Frontiers in plant science.
36. Bueso, E., Rodriguez, L., Lorenzo‐Orts, L., Gonzalez‐Guzman, M., Sayas, E., Muñoz‐
Bertomeu, J. & Rodriguez, P. L. (2014). The single‐subunit RING‐type E3 ubiquitin ligase RSL1 targets PYL4 and PYR1 ABA receptors in plasma membrane to modulate abscisic acid signaling. The Plant Journal, 80(6), 1057-1071.
37. Van Overtveldt, M., Heugebaert, T. S. A., Verstraeten, I., Geelen, D., & Stevens,
C. V. (2015). Phosphonamide pyrabactin analogues as abscisic acid agonists.
Organic & biomolecular chemistry, 13(18), 5260-5264.
38. Benson, C. L., Kepka, M., Wunschel, C., Rajagopalan, N., Nelson, K. M.,
Christmann, A.,& Loewen, M. C. (2015). Abscisic acid analogs as chemical
105
Texas Tech University, Sayani Mallick, July 2016
probes for dissection of abscisic acid responses in Arabidopsis thaliana.
Phytochemistry, 113, 96-107.
39. Joshi-Saha, A., Valon, C., & Leung, J. (2011). A brand new START: abscisic acid
perception and transduction in the guard cell. Science signaling, 4(201).
40. Waadt, R; Manalansan, B; Rauniyar, N(2015) Identification of Open Stomatal-
Interacting Proteins Reveals Interactions with Sucrose Non-fermenting1-
Related Protein Kinases2 and with Type 2A Protein Phosphatases That Function
in Abscisic Acid Responses Plant physiology Volume: 169 Issue: 1 Pages: 760
41. Rodriguez, L., Gonzalez-Guzman, M., Diaz, M., Rodrigues, A., Izquierdo-
Garcia, A. C., Peirats-Llobet, M., & Mulet, J. M. (2014). C2-domain abscisic
acid-related proteins mediate the interaction of PYR/PYL/RCAR abscisic acid
receptors with the plasma membrane and regulate abscisic acid sensitivity in
Arabidopsis. The Plant Cell, 26(12), 4802-4820.
42. Nishimura, N., Hitomi, K., Arvai, A. S., Rambo, R. P., Hitomi, C., Cutler, S.
R.,& Getzoff, E. D. (2009). Structural mechanism of abscisic acid binding and
signaling by dimeric PYR1. Science, 326(5958), 1373-1379.
43. Hao Q, et al. (2011) The molecular basis of ABA-independent inhibition of
PP2Cs by a subclass of PYL proteins. Mol Cell 42(5):662–672.
44. Dupeux, F., Santiago, J., Betz, K., Twycross, J., Park, S. Y., Rodriguez, L.,
& Holdsworth, M. (2011). A thermodynamic switch modulates abscisic acid
receptor sensitivity. The EMBO journal, 30(20), 4171-4184.
106
Texas Tech University, Sayani Mallick, July 2016
45. Okamoto, M., Peterson, F. C., Defries, A., Park, S. Y., Endo, A., Nambara, E.,&
Cutler, S. R. (2013). Activation of dimeric ABA receptors elicits guard cell closure,
ABA-regulated gene expression, and drought tolerance.Proceedings of the National
Academy of Sciences, 110(29), 12132-12137
46. Kagaya, Y., Ohmiya, K., & Hattori, T. (1999). RAV1, a novel DNA-binding
protein, binds to bipartite recognition sequence through two distinct DNA-binding
domains uniquely found in higher plants. Nucleic Acids Research,27(2), 470–478.
47. Seo, K. I., Lee, J. H., Nezames, C. D., Zhong, S., Song, E., Byun, M. O., &
Deng, X. W. (2014). ABD1 is an Arabidopsis DCAF substrate receptor for
CUL4-DDB1–based E3 ligases that acts as a negative regulator of abscisic acid
signaling. The Plant Cell, 26(2), 695-711.
48. Lee, J. H., Yoon, H. J., Terzaghi, W., Martinez, C., Dai, M., Li, J., & Deng, X. W.
(2010). DWA1 and DWA2, two Arabidopsis DWD protein components of CUL4-
based E3 ligases, act together as negative regulators in ABA signal transduction.
The Plant Cell, 22(6) 1716-1732.
49. Irigoyen, M. L., Iniesto, E., Rodriguez, L., Puga, M. I., Yanagawa, Y., Pick, E.,&
Rodriguez, P. L. (2014). Targeted degradation of abscisic acid receptors is
mediated by the ubiquitin ligase substrate adaptor DDA1 in Arabidopsis. The
Plant Cell, 26(2), 712-728.
107
Texas Tech University, Sayani Mallick, July 2016
50. Jaglo-Ottosen, K. R., Gilmour, S. J., Zarka, D. G., Schabenberger, O.,
&Thomashow, M. F. (1998). Arabidopsis CBF1 overexpression induces COR
genes and enhances freezing tolerance. Science, 280(5360), 104-106.
51. Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K., & Shinozaki, K.
(1999). Improving plant drought, salt, and freezing tolerance by gene transfer of a
single stress-inducible transcription factor. Nature biotechnology, 17(3), 287-291.
52. Sheen, J. (2001). Signal transduction in maize and Arabidopsis mesophyll
protoplasts. Plant Physiology, 127(4), 1466-1475.
53. Marcotte, W. R., Russell, S. H., & Quatrano, R. S. (1989). Abscisic acid-responsive
sequences from the Em gene of wheat. The Plant Cell, 1(10), 969-976.
54. Yamada, K., Lim, J., Dale, J. M., Chen, H., Shinn, P., Palm, C. & Ishida, J.
(2003). Empirical analysis of transcriptional activity in the Arabidopsis
genome. Science, 302(5646), 842-846.
55. Jia, F., Gampala, S. S. L., Mittal, A., Luo, Q., & Rock, C. D. (2009). Cre-lox
Univector acceptor vectors for functional screening in protoplasts: analysis of
Arabidopsis donor cDNAs encoding Abscisic acid insensitive1-Like protein
phosphatases. Plant Molecular Biology, 70(6), 693–708.
56. Yoshida, Y., Kuroiwa, H., Misumi, O., Nishida, K., Yagisawa, F., Fujiwara,
T &Kuroiwa, T. (2006). Isolated chloroplast division machinery can actively
constrict after stretching. Science, 313(5792), 1435-1438.
108
Texas Tech University, Sayani Mallick, July 2016
57. Sheen, J. (1998). Mutational analysis of protein phosphatase 2C involved in
abscisic acid signal transduction in higher plants. Proceedings of the
National Academy of Sciences, 95(3), 975-980.
58. Guo, H., & Ecker, J. R. (2003). Plant responses to ethylene gas are mediated
by SCF EBF1/EBF2-dependent proteolysis of EIN3 transcription factor. Cell,
115(6), 667-677.
59. Mittal, A., Gampala, S. S., Ritchie, G. L., Payton, P., Burke, J. J., & Rock, C.
D. (2014). Related to ABA‐Insensitive3 (ABI3)/Viviparous1 and AtABI5 transcription factor coexpression in cotton enhances drought stress adaptation.Plant biotechnology journal, 12(5), 578-589.
60. Finkelstein, R., Gampala, S. S., Lynch, T. J., Thomas, T. L., & Rock, C. D.
(2005). Redundant and distinct functions of the ABA response loci ABA-
insensitive (ABI) 5 and ABRE-binding factor (ABF) 3. Plant molecular
biology, 59(2), 253-267.
61. Llave, C., Kasschau, K. D., & Carrington, J. C. (2000). Virus-encoded suppressor
of posttranscriptional gene silencing targets a maintenance step in the silencing
pathway. Proceedings of the National Academy of Sciences, 97(24), 13401-
13406.
62. Mittal, A., Jiang, Y., Ritchie, G. L., Burke, J. J., & Rock, C. D. (2015). AtRAV1 and
AtRAV2 overexpression in cotton increases fiber length differentially under drought
stress and delays flowering. Plant Science, 241, 78-95.
109
Texas Tech University, Sayani Mallick, July 2016
63. Pêra, F. F., Mutepfa, D. L., Khan, A. M., Els, J. H., Mbewana, S., van Dijk, A.
A., ... & Hitzeroth, I. I. (2015). Engineering and expression of a human
rotavirus candidate vaccine in Nicotiana benthamiana. Virology journal, 12(1),
1.64. Jefferson, R. A. (1987). Assaying chimeric genes in plants: the GUS gene
fusion system. Plant molecular biology reporter, 5(4), 387-405.65. Cervera, M.
(2004). Histochemical and fluorometric assays for uidA (GUS) gene detection.
In Transgenic plants: Methods and protocols (pp. 203-213). Humana Press.
65. Cervera, M. (2004). Histochemical and fluorometric assays for uidA (GUS) gene
detection. Transgenic plants: Methods and protocols, 203-213.
66. Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., & Parrott, W. A. (2015).
Targeted genome modifications in soybean with CRISPR/Cas9. BMC
biotechnology, 15(1), 16.
67. Kasuga, M., Miura, S., Shinozaki, K., & Yamaguchi-Shinozaki, K. (2004). A
combination of the Arabidopsis DREB1A gene and stress-inducible rd29A
promoter improved drought-and low-temperature stress tolerance in tobacco
by gene transfer. Plant and Cell Physiology, 45(3), 346-350.
68. Choi, H. W., Kim, Y. J., & Hwang, B. K. (2011). The hypersensitive induced
reaction and leucine-rich repeat proteins regulate plant cell death associated with
disease and plant immunity. Molecular plant-microbe interactions, 24(1), 68-78.
69. Heschel, M. S., & Riginos, C. (2005). Mechanisms of selection for drought stress
tolerance and avoidance in Impatiens capensis (Balsaminaceae).American Journal
of Botany, 92(1), 37-44.
110
Texas Tech University, Sayani Mallick, July 2016
70. McCann, S. E., & Huang, B. (2008). Drought responses of Kentucky bluegrass
and creeping bentgrass as affected by abscisic acid and trinexapac-ethyl.
Journal of the American Society for Horticultural Science,133(1), 20-26.
71. Sinclair, T. R. (2011). Challenges in breeding for yield increase for drought.
Trends in plant science, 16(6), 289-293.
72. Miflin, B. (2000). Crop improvement in the 21st century. Journal of
experimental botany, 51(342), 1-8.
73. Fiorani, F., & Schurr, U. (2013). Future scenarios for plant phenotyping.Annual
review of plant biology, 64, 267-291.
74. Brocard, I. M., Lynch, T. J., & Finkelstein, R. R. (2002). Regulation and role of
the Arabidopsis abscisic acid-insensitive 5 gene in abscisic acid, sugar, and stress
response. Plant Physiology, 129(4), 1533-1543.
75. Chater, C. C., Oliver, J., Casson, S., & Gray, J. E. (2014). Putting the brakes on:
abscisic acid as a central environmental regulator of stomatal development. New
Phytologist, 202(2), 376-391.
76. Pantin, F., Monnet, F., Jannaud, D., Costa, J. M., Renaud, J., Muller, B., &
Genty, B. (2013). The dual effect of abscisic acid on stomata. New Phytologist,
197(1), 65-72.
77. Serna, L. (2014). The role of brassinosteroids and abscisic acid in stomatal
development. Plant Science, 225, 95-101.
111
Texas Tech University, Sayani Mallick, July 2016
78. Tanaka, Y., Nose, T., Jikumaru, Y., & Kamiya, Y. (2013). ABA inhibits entry
into stomatal‐lineage development in Arabidopsis leaves. The Plant Journal,74(3), 448-457.
79. Kagale, S., Uzuhashi, S., Wigness, M., Bender, T., Yang, W., Borhan, M. H.,
&Rozwadowski, K. (2012). TMV-Gate vectors: Gateway compatible
tobacco mosaic virus based expression vectors for functional analysis of
proteins.Scientific Reports, 2, 874.
80. Geng, C., Cong, Q. Q., Li, X. D., Mou, A. L., Gao, R., Liu, J. L., & Tian, Y.
P. (2015). Developmentally regulated plasma membrane protein of Nicotiana
benthamiana Contributes to Potyvirus Movement and Transports to
Plasmodesmata via the Early Secretory Pathway and the Actomyosin System.
Plant physiology, 167(2), 394-410.
81. Orsini, F., Cascone, P., De Pascale, S., Barbieri, G., Corrado, G., Rao, R., &
Maggio, A. (2010). Systemin‐dependent salinity tolerance in tomato: evidence of specific convergence of abiotic and biotic stress responses. Physiologia plantarum, 138(1), 10-21.
82. Munoz-Mayor, A., Pineda, B., Garcia-Abellán, J. O., Antón, T., Garcia-Sogo, B.,
Sanchez-Bel, & Bolarin, M. C. (2012). Overexpression of dehydrin tas14 gene
improves the osmotic stress imposed by drought and salinity in tomato. Journal
of plant physiology, 169(5), 459-468.
112
Texas Tech University, Sayani Mallick, July 2016
83. Dammann, C., Rojo, E., & Sánchez‐Serrano, J. J. (1997). Abscisic acid and jasmonic acid activate wound‐inducible
genes in potato through separate, organ‐ specific signal transduction pathways. The Plant Journal, 11(4), 773-782.
84. Huo, H., Dahal, P., Kunusoth, K., McCallum, C. M., & Bradford, K. J. (2013).
Expression of 9-cis-epoxycarotenoid dioxygenase4 is essential for
thermoinhibition of lettuce seed germination but not for seed development or
stress tolerance. The Plant Cell, 25(3), 884-900.
85. Chen, P. Y., Wang, C. K., Soong, S. C., & To, K. Y. (2003). Complete sequence
of the binary vector pBI121 and its application in cloning T-DNA insertion from
transgenic plants. Molecular breeding, 11(4), 287-293.
113
Texas Tech University, Sayani Mallick, July 2016
86. Gosti, F., Beaudoin, N., Serizet, C., Webb, A. A., Vartanian, N., &Giraudat, J.
(1999). ABI1 protein phosphatase 2C is a negative regulator of abscisic acid
signaling. The Plant Cell, 11(10), 1897-1909.
87. Leung, J., Merlot, S., &Giraudat, J. (1997). The Arabidopsis Abscisic acid-
insensitive2 (ABI2) and abi1 genes encode homologous protein phosphatases 2C
involved in abscisic acid signal transduction. The Plant Cell,9(5), 759-771. 88.
Robert, N., Merlot, S., N’Guyen, V., Boisson-Dernier, A., & Schroeder, J. I.
(2006). A hypermorphic mutation in the protein phosphatase 2C HAB1 strongly
affects ABA signaling in Arabidopsis. Febs letters, 580(19), 4691-4696.
89. Melcher, K., Ng, L. M., Zhou, X. E., Soon, F. F., Xu, Y., Suino-Powell, K. M.,&
Kovach, A. (2009). A gate–latch–lock mechanism for hormone signalling by
abscisic acid receptors. Nature, 462(7273), 602-608.
90. Yin, P., Fan, H., Hao, Q., Yuan, X., Wu, D., Pang, Y., & Yan, N. (2009).
Structural insights into the mechanism of abscisic acid signaling by PYL proteins.
Nature structural & molecular biology, 16(12), 1230-1236.
114