Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda...
-
Upload
cathleen-ross -
Category
Documents
-
view
219 -
download
1
Transcript of Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda...
![Page 1: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/1.jpg)
Tecniche per l’analisi di mutazioni
Vincenzo Nigro
Dipartimento di Patologia Generale, Seconda Università
degli Studi di Napoli
Telethon Institute of Genetics and Telethon Institute of Genetics and Medicine (TIGEM)Medicine (TIGEM)
![Page 2: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/2.jpg)
What is a mutation?
a variation of the DNA sequence….
..that is only found in affected individuals
..that is never found in non affected individuals
..that accounts for the pathological process/status
..that, when corrected in time, disease is rescued
![Page 3: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/3.jpg)
..that is only found in affected and that is never found in non affected
incomplete penetrance
that is more often found in affectedthan in non affected...
![Page 4: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/4.jpg)
50.000 private variants = innocuous differences belonging to one family
CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC
CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC
![Page 5: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/5.jpg)
1-allele diseases
monoallelic mutations may be responsible for dominant or X-linked disorders
new random mutations are the rule with an unpredictable pattern of distribution
![Page 6: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/6.jpg)
gender effect in mutations
For mutations other than point mutations, sex biases in the mutation rate are very variable
Small deletions are more frequent in females Germline base substitution mutations occur
more frequently in males than in females, especially in older males
Point mutations at some loci occur almost exclusively in males, whereas others occur ten times more than in females
![Page 7: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/7.jpg)
relative frequency of de novo achondroplasia for different paternal
ages
![Page 8: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/8.jpg)
Relative frequency of de novo neurofibromatosis for different paternal
ages
![Page 9: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/9.jpg)
the number of male germ-cell divisions
![Page 10: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/10.jpg)
![Page 11: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/11.jpg)
2-allele diseases
novel mutations are rare, usually mutations have a long history (100-1000 generations)
mutations have an ethnical signature with a predictable pattern of distribution and frequency
biallelic mutations may be responsible for autosomal recessive disorders
polymorphisms and private variants are more easily discriminated vs true mutations
![Page 12: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/12.jpg)
2-allele diseases
consanguineity is a risk factor for homozygosity high carrier frequency is a risk factor for
compound heterozygosity
![Page 13: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/13.jpg)
The effect of an allele
null or amorph = no product
hypomorph = reduced amount / activity
hypermorph = increased amount / activity
neomorph = novel product / activity
antimorph = antagonistic product / activity
![Page 14: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/14.jpg)
Mutation detection
mutation scanning or resequencing methods for identifying
previously unknown mutations genotyping
methods for scoring previously known mutations or single nucleotide polymorphisms (SNPs)
![Page 15: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/15.jpg)
Key questions for mutation detection strategy
expected mutations are monoallelic or biallelic? is the gene well recognized for that disease? is the mutation pattern known? (deletion, dup, small
mutations, etc.) which is the complexity of the gene? how many patients must be examined? how many controls should be examined? how many mutations and how many variations have
already been identified in this gene? are there more members of the same gene family (or
pseudogenes) in the genome?
![Page 16: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/16.jpg)
Gene size
Number ofpatients
XXNumber ofcontrols
Dimension of the mutation detection study
![Page 17: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/17.jpg)
frequent mutations
are known?
mutationscanning
SEQUENCINGSEQUENCING
screeningof recurrent mutations YESYES
NONO
mutationsare identified?
YESYES
NONO
General strategy for mutation detection
![Page 18: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/18.jpg)
DMDDMDAA BB
BMDBMDCC DD
Log-PCR = 4 multiplex-PCR (2x20+2x18) with uniform spacing and gel position according to chromosomal
position
1 2 3 4 5 6
1: del ex 432: del ex 11, 17, 19, 213: del ex 17, 19, 214: del ex 50, 525: del ex 7, 11, 17, 196: del ex 61
1: no del 2: del ex 8, 12, 18, 20, 223: del ex 12, 18, 20, 224: del ex 46, 515: del ex 6, 8, 12, 186: del ex 62
![Page 19: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/19.jpg)
MLPA ligation
Probes are ligated by a thermostable ligase
![Page 20: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/20.jpg)
PCR amplification
A universal primer pair is used to amplify all ligated probesThe PCR product of each probe has a unique length (130 480 bp)
![Page 21: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/21.jpg)
Separation and quantification by capillary electrophoresis
Each peak is the amplification product of a specific probe.
Samples are compared to a control sample.
A difference in relative peak height or peak area indicates a copy number change of the probe target sequence
![Page 22: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/22.jpg)
MLPA can be used to detect known mutations
Mismatch Perfect match
Ligation of the two probe oligonucleotides Amplification product
Mismatch at the probe ligation site No ligation, no amplification product
![Page 23: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/23.jpg)
MRC-Holland b.v.
Unmethylated Target
M
M
Methylated Target
Denaturation and Multiplex probe
hybridizationM
Only undigested (methylated) and ligated probes are exponentially amplified
Ligation and Digestion with
methylation sensitive
endonucleasesM
MS-MLPA
![Page 24: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/24.jpg)
Molecular inversion probe (MIP) genotyping
•MIP genotyping uses circularizable probes with 5′ and 3′ ends that anneal upstream and downstream of the SNP site leaving a 1 bp gap
•Polymerase extension with dNTPs and a non-strand-displacing polymerase is used to fill in the gap
![Page 25: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/25.jpg)
Ligation seals the nick, and exonuclease I is used to remove excess unannealed and unligated circular probes
•The resultant product is PCR-amplified and the orientation of the primers ensures that only circularized probes will be amplified
•The resultant product is hybridized and read out on an array of universal-capture probes
![Page 26: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/26.jpg)
GoldenGate uses extension ligation between annealed locus-specific oligos (LSOs) and allele-specific oligos (ASOs)
An allele-specific primer extension step is used to preferentially extend the correctly matched ASO (at the 3′ end) up to the 5′ end of the LSO primer
Ligation then closes the nick
GoldenGate genotyping assay
![Page 27: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/27.jpg)
A subsequent PCR amplification step is used to amplify the appropriate product using common primers to ‘built-in’ universal PCR sites in the ASO and LSO sequences
The resultant PCR products are hybridized and read out on an array of universal-capture probes
GoldenGate genotyping assay
![Page 28: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/28.jpg)
PTTprotein truncation test
Sensitivity 1000-bp fragment > 85%
Detects only nonsense mutations Post PCR time: 48-72 hours
(translation/trascription, gel preparation, loading and run, analysis of results)
Use of 35S radioactivity No special equipment required mRNA as starting template
![Page 29: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/29.jpg)
![Page 30: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/30.jpg)
![Page 31: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/31.jpg)
Applications of PTT(% of truncating mutations)
Polycystic Kidney Disease PKD1 95% Familial Adenomatous Polyposis APC 95% Ataxia telangiectasia ATM 90% Hereditary breast and ovarian cancer BRCA1-2 90% Duchenne Muscular Dystrophy DMD 90% Fanconi anemia FAA 80% Hereditary non-polyposis colorectal cancer hMSH1-2 70%-80% Neurofibromatosis type 2 NF2 65% Hunter Syndrome IDS 50% Neurofibromatosis type 1 NF1 50% Cystic Fibrosis CFTR 15%
![Page 32: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/32.jpg)
SSCP
![Page 33: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/33.jpg)
Mutation detection by
heteroduplex analysis: the
mutant DNA must first be
hybridized with the wild-type
DNA
to form a mixture of two
homoduplexes and two
heteroduplexes
![Page 34: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/34.jpg)
Heteroduplex analysis
![Page 35: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/35.jpg)
DHPLCdenaturing HPLC from
Transgenomic
![Page 36: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/36.jpg)
DHPLC analysis at different
temperatures of the column
![Page 37: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/37.jpg)
DHPLC analysis of the CAPN3 gene (exon 11)
UV
UV
00
22
FL
UO
FL
UO
00
100100
1:2 1:4 1:6 1:8 1:10
![Page 38: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/38.jpg)
Sequencing artifacts
FALSE POSITIVE (specificity)when searching for heterozygous DNA differences there are a number of potential mutations, together with sequence artifacts, compressions and differences in peak intensities that must be re-checked with additional primers and costs
FALSE NEGATIVE (sensitivity)loss of information farther away or closer to the primer
does not detect a minority of mutant molecules in a wild-type environment
![Page 39: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/39.jpg)
Sanger DNA sequencing
![Page 40: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/40.jpg)
![Page 41: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/41.jpg)
Massive parallel DNA sequencing
![Page 42: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/42.jpg)
454 technology:a water-in-oil emulsion is
created:a single molecule of DNA with a
single bead
![Page 43: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/43.jpg)
454 technology:Beads with clones are selected
and assembled onto a planar substrate
![Page 44: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/44.jpg)
![Page 45: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/45.jpg)
454 technology:Sequencing by synthesis
pyrosequencing
Up to 100 Million bpin 8 hours can be readAmbiguities arise for homopolymeric tracts
![Page 46: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/46.jpg)
Emulsion PCR or Bridge PCR?
![Page 47: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/47.jpg)
![Page 48: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/48.jpg)
![Page 49: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/49.jpg)
7.4 x coverage
234 runs
24.5 billions bp
![Page 50: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/50.jpg)
NimbleGen sequence capture
![Page 51: Tecniche per l’analisi di mutazioni Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics.](https://reader035.fdocuments.in/reader035/viewer/2022062408/56649f285503460f94c40914/html5/thumbnails/51.jpg)
11 genetic diseases !!