www.sciencemag.org/cgi/content/full/316/5828/1202/DC1

Supporting Online Material for

Ubiquitin-Binding Protein RAP80 Mediates BRCA1-Dependent

DNA Damage Response

Hongtae Kim, Junjie Chen,* Xiaochun Yu*

*To whom correspondence should be addressed.

E-mail: Junjie.chen@yale.edu (J.C.); xiayu@med.umich.edu (X.Y.)

Published 25 May 2007, Science 316, 1202 (2007)

DOI: 10.1126/science.1139621

This PDF file includes:

Materials and Methods

Figs. S1 to S9

References

1

Supporting Online Material

Materials and methods

Plasmids

Human RAP80 cDNA was purchased from American Type Culture Collection

(Manassas, VA). Full length and deletion mutants of human RAP80 were generated by

PCR and subcloned into a modified pIRES-EGFP mammalian expression vector to create

constructs encoding S-Flag-SBP (Streptavidin Binding Peptide)-tagged (SFB tagged)

full-length or various deletion mutants of RAP80. RAP80 was also subcloned into a

modified pcDNA3.1 vector to generate a construct encoding HA-tagged RAP80 (HA-

RAP80). The point mutants of human RAP80 were created using the QuikChange site-

directed mutagenesis kit (Stratagene). Myc-BRCA1 and Myc-BRCA1 BRCT were also

generated by PCR and subcloned into modified pcDNA3 M-1. RAP80 and RAP80 N-

terminal region were subcloned into a modified pGEX4T-1 vector to generate constructs

encoding GST-tagged RAP80 (GST-RAP80) and RAP80 N-terminal region containing

the double UIMs (GST-RAP80N). Flag-HSJ1A expression plasmid was kindly provided

by Dr. Jorg Hohfeld from the Institute for Cell Biology (Bonn, Germany), and deletion

mutants of human HSJ1A-UIM, BARD1-BRCT and BRCA1-BRCT were generated by

PCR and subcloned into a modified pIRES-EGFP mammalian expression vector. Ubi-

GST construct was kindly provided by Dr. Bruce Horazdovsky from the Mayo Clinic

(Minnesota, USA).

Cell Culture and treatment with ionizing radiation

HeLa, K562 and 293T cells were purchased from American Type Culture Collection

(Manassas, VA) and maintained in RPMI1640 medium supplemented with 10% fetal

bovine serum at 37 °C in 5% CO2 (v/v). MDC-/- and +/+ MEFs (S2), 53BP1-/- and +/+

MEFs (S3), H2AX-/- and +/+ MEFs (S2), NBS1-deficient and reconstituted cells (S4),

ATM-deficient (FT169A) and reconstituted (YZ5) cells (S5), HCC1937 and HCC1937-

BRCA1 (S1) were previously reported. FANCD2-deficient and -reconstituted cells was

kindly provided by Dr. Alan D’Andrea at the Department of Pediatric Oncology at Dana-

Farber Cancer Institute (Boston, MA) and maintained in DMEM medium supplemented

with 15% fetal bovine serum at 37 °C in 5% CO2 (v/v). Cells were irradiated using JL

Spepherd 137

Cs radiation source at indicated doses. The irradiated cells were then

returned to culture conditions and maintained for the indicated periods of time specified

in the figure legends or Methods.

SiRNA

All siRNA duplexes used in this study were purchased from Dharmacon Research

(Lafayette, CO). The sequences of RAP80 SiRNA1 and 2 are

GAAGGAUGUGGAAACUACCdTdT and GCGTAGACTTGAGGATGCAdTdT,

respectively. The sequences of control, CtIP, and BRCA1 SiRNA are

UUCAAUAAAUUCUUGAGGUUU, GCUAAAACAGGAACGAATCdTdT, and

2

UCACAGUGUCCUUUAUGUAdTdT, respectively. SiRNAs were transfected into the

cells using oligofectamine (Invitrogen) according to the manufacturer’s instructions.

Antibodies, Transfection, Immunoprecipitation and Preparation of Chromatin Fractions.

Rabbit anti-Myc and anti-RAP80 antibodies were raised by immunizing rabbits with Myc

peptide CEQKLISEEDL and GST-RAP80 (RAP80 1-354 amino acids) respectively.

These rabbit polyclonal antibodies were affinity-purified using the Sulfolink or

AminoLink Plus Immobilization and Purification Kit (Pierce). MDC1, 53BP1, Chk1,

phospo-Chk1, H2AX and -H2AX antibodies were previously described (S2). Anti-Flag

and -actin antibodies were purchased from Sigma Inc and monoclonal human BRCA1

antibody was purchased from Oncogene Science. Anti-phospho-H3 and monoclonal

ubiquitin antibodies were purchased from Upstate biotechnology Inc. Transient

transfection was performed using Fugene 6 reagent (Roche Inc) according to the

instructions provided by manufacturer. For immunoprecipitation, cells were washed with

ice-cold PBS and then lysed in NETN buffer (0.5% Nonidet P-40, 20 mM Tris [pH 8.0],

50 mM NaCl, 50 mM NaF, 100 M Na3VO4, 1 mM EDTA and 50 g/ml PMSF) at 4 °C

for 10 min. Crude lysates were cleared by centrifugation at 14,000 rpm at 4 °C for 5 min,

and supernatants were incubated with protein A-agarose-conjugated primary antibodies.

The immunocomplexes were washed three times with NETN buffer and subjected to

SDS-PAGE. Western blotting was performed using the antibodies indicated in the figure

legends. The preparation of chromatin fractions was performed as described previously

(S1).

The establishment of stable cell lines and Affinity Purification of S-Flag-SBP(SFB)-

tagged BRCA1-BRCT -containing complexes

To establish cell lines stably expressing epitope-tagged proteins, K562 cells were

transfected with plasmids encoding SFB-BRCA1-BRCT or SFB-BARD1-BRCT. Forty-

eight hours after transfection, the cells were split at the 10:1 ratio and cultured in the

medium containing antibiotics for 3 weeks. The individual antibiotics-resistant colonies

were isolated and screened by Western blotting for the expression of BRCA1-BRCT and

BARD1-BRCT proteins. K562 cells stably expressing SFB-BRCA1 BRCT domain or

SFB-BARD1 BRCT domains were lysed with 4 ml NETN buffer on ice for 10 min.

Crude lysates were cleared by centrifugation at 14,000 rpm at 4 °C for 10 min, and

supernatants were incubated with 300 µl streptavidin-conjugated beads (Amersham). The

immunocomplexes were washed three times with NETN buffer and then bead-bound

proteins were eluted with 500 µl NETN buffer containing 2 mg/ml biotin (Sigma). The

eluted supernatant was incubated with 60 µl S protein beads (Novagen). The

immunocomplexes were washed three times with NETN buffer and subjected to SDS-

PAGE. The silver staining was performed to visualize the protein bands. Specific bands

were excised, digested and the peptides were analyzed by a mass spectrometer.

GST pull-down assay

The GST fusion protein was expressed in Escherichia coli and purified as previously

described (S6). Two g of GST-fusion protein or GST was immobilized on the

glutathione-Sepharose 4B beads and incubated with lysates prepared from cells that were

transiently transfected with plasmids encoding indicated proteins in NETN buffer for 2

3

hours at 4°C. After washing with NETN buffer, the samples were analyzed by Western

blotting analysis. Polyubiquitin chains were purchased from BostonBiochem (Cambridge,

MA)

Immunofluorescence Staining

Cells grown on coverslips were fixed with 3% paraformaldehyde at room temperature for

15 min. Then, cells were permeabilized with PBS containing 0.5% Triton X-100 at room

temperature for 5 min and the coverslips were blocked with PBS containing 5% goat

serum at room temperature for 30 min. The coverslips were incubated with primary

antibodies at room temperature for 20 min. After washing with PBS, cells were incubated

with secondary antibodies, fluorescein isothio-cyanate-conjugated goat anti-mouse IgG,

rhodamine-conjugated goat anti-rabbit IgG, or rhodamine-conjugated goat anti-mouse

IgG (Jackson Immuno-Reserach Laboratories, Inc.) at room temperature for 20 min. 4, 6-

diamidino-2-phenylindole (DAPI) was used to counterstain the nuclei. After a final wash

with PBS, coverslips were mounted with glycerin containing p-phenylenediamine. All

images were obtained with a Nikon ECLIPSE E800 fluorescence microscope.

G2/M cell cycle checkpoint assay

HeLa cells in 35-mm plate were transfected twice with control or RAP80 SiRNAs at the

24 hours time interval. Twenty-four hours after second transfection, the transfected cells

were transferred into 100 mm dishes. The transferred cells were incubated for 24 hours

and then the cells were mock treated or irradiated using a JL Spepherd 137

Cs radiation

source at indicated doses. One hour after irradiation, cells were fixed with 70% ethanol at

-20oC for 24 hours and stained with rabbit anti-phospho-histone H3

antibody (pH3),

followed by incubation with fluorescein isothiocyanate-conjugated

goat anti-rabbit

immunoglobulin secondary antibody. The stained cells were treated with RNaseA,

incubated with propidium iodide, and then analyzed by flow cytometry.

Cell survival assays

HeLa cells in 35-mm plate were transfected twice with control and RAP80 SiRNAs at the

24 hours time intervals. Twenty-four hours after second transfection, cells were splited

and transferred into 60 mm dishes. Cells were incubated for 24 hours before they were

irradiated using a JL Spepherd 137

Cs radiation source at various doses. Eleven days after

irradiation, cells were washed with PBS, fixed and stained with 2% methylene blue, and

the numbers of colonies were determined.

4

Figures

fig. S1. Exogenous RAP80 and BRCA1 associate with each other in vivo. (A) 293T cells

are transfected with plasmids encoding Myc-BRCA1 and HA-RAP80. Cell lysates were

subjected to immunoprecipitation with anti-Myc or control anti-Flag antibodies and

immunoblotting with the indicated antibodies (left panels). The amounts of HA-tagged

RAP80 and Myc-tagged BRCA1 in these lysates were analyzed by immunoblotting and

shown in the right panels.

5

fig. S1. (B) 293T cells are transfected with plasmids encoding Myc-BRCA1 or Myc-

BRCA1 BRCT with those encoding SFB-RAP80. Cell lysates were subjected to

immunoprecipitation with anti-Myc and immunoblotting with the indicated antibodies

(upper panels). The amounts of SFB-tagged RAP80 and Myc-tagged BRCA1 in these

lysates were analyzed by immunoblotting and shown in the lower panels. (C) Binding of

GST-RAP80 fusion protein to endogenous BRCA1 in vitro. GST or GST-RAP80 protein

was incubated with 293T cell lysates. After extensive washing, the proteins bound to the

beads were separated by SDS-PAGE and analyzed by immunoblotting with anti-BRCA1

antibody. The amounts of GST and GST-RAP80 were shown in the lower panel.

6

fig. S2. Ionizing radiation-induced phosphorylation of RAP80. SFB-RAP80 stable cells

were exposed to 0 or 10 Gy of ionizing radiation. One hour after irradiation, cell lysates

were subjected to pull-down with S-beads and immunoblotting with the antibodies to

phospho-Ser101 of RAP80 (upper panel) or RAP80 (lower panel).

7

fig. S3. (A) Effect of Wortmannin and caffeine on RAP80 phosphorylation. HeLa cells

were treated with wortmannin (20 µM) or caffeine (100 µM) for 1 hour before

irradiation. Immunoprecipitation and immunoblotting were done as described in Fig. 2D.

Wort and Caff indicate wortmannin and caffeine, respectively. (B-D) Independence of

DNA damage-induced RAP80 foci formation on NBS1, 53BP1, and BRCA1. NBS1-

deficient and -reconstituted cells (B), 53BP1+/+ and -/- MEFS cells (C), BRCA1-

deficient HCC1937 cells and reconstituted HCC1937-BRCA1 cells (D) were exposed to

0 or 10 Gy of ionizing radiation. Sixteen hours after irradiation, cells were fixed and

stained with polyclonal antibody to RAP80 and monoclonal antibody to -H2AX. DAPI

staining was included to indicate the positions of the nuclei.

8

fig. S4. (A) Diagrams of the SFB-tagged wild type and internal serial deletion mutants or

point mutants of RAP80. (B) Alignment of RAP80 UIMs and other UIM regions. UIMs

is an ubiquitin interacting motif which contains many acidic residues followed by highly

conserved PXXAXXXSXXAc core, in which P, X and Ac represent the hydrophobic,

any, and acidic residues, respectively. Identical residues are highlighted in sky blue and

homologous residues are highlighted in blue. (C) HeLa cells were transiently transfected

with Flag-tagged wild type RAP80, HSJ1A, RAP80 UIMs or HSJ1A UIMs. Twenty-four

hours after transfection, cells were exposed to 10 Gy of ionizing radiation. Cells were

fixed 8 hours later and stained with monoclonal antibody to Flag and polyclonal antibody

to -H2AX.

9

fig. S5. Direct binding of RAP80 to lysine 63-linked polyubiquitin chains in vitro. GST

or GST-RAP80 N-terminal fusion proteins (GST-RAP80N) were incubated with lysine

48-linked polyubiquitin chains (Lys-48 Ubs) or lysine 63-linked polyubiquitin chains

(Lys-63 Ubs). After extensive washing, the bound polyubiquitin chains were analyzed by

immunoblotting with monoclonal antibody to ubiquitin. The amounts of GST and GST-

RAP80N were shown in the lower panel.

10

fig. S6. G2/M checkpoint control in RAP80, BRCA1 and CtIP knockdown cells. HeLa

cells transfected with indicated SiRNAs were exposed to 0, 2 or 4 Gy of ionizing

radiation. Cells were incubated for 1 hour before fixation and subjected to staining with

anti-phospho-H3 histone antibody and propidium iodide. The percentages of mitotic cells

were determined by FACS analysis.

11

fig. S7. Independence of DNA damage-induced RAP80 foci formation on FANCD2.

FANCD2-deficient and -reconstituted cells were exposed to 0 or 10 Gy of ionizing

radiation. Sixteen hours after irradiation, cells were fixed and stained with polyclonal

antibody to RAP80 and monoclonal antibody to -H2AX. DAPI staining was included to

indicate the positions of the nuclei.

.

12

fig. S8. Effect of RAP80 knockdown on CtIP ubiquitination following DNA damage.

HeLa cells transfected with control SiRNA or RAP80 SiRNA were exposed to 0 or 20

Gy of ionizing radiation. Insoluble and soluble fractions of cell lysates were analyzed by

immunoprecipitation and immunoblotting with indicated antibodies

13

fig. S9. Expanded blots including molecular weight size markers from the indicated

selected figures.

14

References

S1. X. Yu, S. Fu, M. Lai, R. Baer, J. Chen, Genes Dev 20, 1721 (Jul 1, 2006).

S2. Z. Lou et al., Mol Cell 21, 187 (Jan 20, 2006).

S3. I. M. Ward, K. Minn, J. van Deursen, J. Chen, Mol Cell Biol 23, 2556 (Apr,

2003).

S4. R. S. Maser, R. Zinkel, J. H. Petrini, Nat Genet 27, 417 (Apr, 2001).

S5. I. Rappold, K. Iwabuchi, T. Date, J. Chen, J Cell Biol 153, 613 (Apr 30, 2001).

S6. B. Hofer, S. Backhaus, K. N. Timmis, Gene 144, 9 (Jun 24, 1994).

Supporting Online Material

www.sciencemag.org

Materials and Methods

Figs. S1 to S9

References