www.sciencemag.org/content/344/6181/310/suppl/DC1

Supplementary Materials for

The STAT3-Binding Long Noncoding RNA lnc-DC Controls Human

Dendritic Cell Differentiation

Pin Wang, Yiquan Xue, Yanmei Han, Li Lin, Cong Wu, Sheng Xu, Zhengping Jiang,

Junfang Xu, Qiuyan Liu, Xuetao Cao*

*Corresponding author. E-mail: caoxt@immunol.org

Published 18 April 2014, Science 344, 310 (2014)

DOI: 10.1126/science.1251456

This PDF file includes:

Materials and Methods

Figs. S1 to S24

Table S1

Full Reference List

2

Materials and Methods Cell isolation and culture

In vitro differentiation of human monocytes into Mo-DC was performed as

described with brief modification (29). Human peripheral blood mononuclear cells

(PBMCs) were isolated from buffy coats from Blood Center of Shanghai Changhai

hospital (Shanghai, China) through Ficoll-Hypaque (Mediatech Cellgro) density gradient

centrifugation. All human blood samples were collected with the informed consent of

healthy donors and the experiments were approved by the Ethics Committee of the

Second Military Medical University, Shanghai, China. Monocytes were purified from

PBMCs using anti-CD14 microbeads (Miltenyi Biotech) and then cultured at 37°C in 24-

well plates (5× 105 cells per well) in 1 mL of RPMI-1640 Medium (PAA) with 10%

(vol/vol) FCS (PAA) containing 100 ng/mL human GM-CSF and 20 ng/mL human IL-4

(R&D Systems，Minneapolis, MN). Half medium was replaced by fresh medium with

GM-CSF and IL-4 at day 3 and day 5. Mo-DC were matured by 300ng/ml LPS (0111:B4,

Sigma) on day 5 and harvested on day 7 or the indicated time.

Human monocyte-derived macrophages (Mo-MΦ) were obtained from monocytes

cultured in RPMI-1640 medium with 10% (vol/vol) FCS containing 20 ng/mL human M-

CSF (R&D Systems).

Other human primary immune cell subsets were sorted by MoFlo (DACO

Cytomatix, Denmark) from PMBCs.

HEK293T and THP1 cell line were from American Type Culture Collection

(Manassas, VA) and cultured as required.

Mouse bone marrow-derived DCs were generated as following: BM cells were

purified from mouse BM and cultured in RPMI-1640 medium with 10% (vol/vol) FCS

containing 200 ng/ml mouse Flt3L (PeproTech, London, UK) for 7 days at 1×106/ml in

24-well plates unless otherwise noted.

HTA 2.0 transcriptome microarray assay

Total RNA was isolated with Trizol from cells at indicated time point in the process

of Mo-DC development from human peripheral monocytes in GM-CSF/IL-4 culture.

RNAs from three donors with equal amount were pooled together to get each time point

sample. Biotinylated cDNA were prepared according to the standard Affymetrix protocol

3

from 250 ng total RNA by using Ambion® WT Expression Kit. Following labeling, 5.5

ug of cDNA were hybridized for 16 hr at 45℃ on GeneChip Human Transcriptome

Array 2.0 in Hybridization Oven 645. GeneChips were washed and stained in the

Affymetrix Fluidics Station 450. GeneChips were scanned by using Affymetrix®

GeneChip Command Console (AGCC) which installed in GeneChip® Scanner 3000 7G.

The data were analyzed with Robust Multichip Analysis (RMA) algorithm using

Affymetrix default analysis settings and global scaling as normalization method. Values

presented are log2 RMA signal intensity.

For transcriptome assay once lnc-DC knockdown, monocytes were transfected with

lnc-DC RNAi lentivirus or the control lentivirus at MOI=100 then cultured in GM-

CSF/IL-4 medium for 7 days. RNA were collected and subjected to similar HTA 2.0

microarray detection.

For transcriptome assay with STAT3 inhibition, monocytes were cultured in GM-

CSF/IL-4 medium supplemented with STAT3 inhibitor S3I-201 (200µM) or equal

volume DMSO for 7 days. RNA components were subjected to similar HTA 2.0

microarray assay.

Heat maps representing differentially regulated genes were generated using Cluster

3.0.

These microarray data had been deposited on GEO public database under the

accession number GSE54143.

RNA-seq detection and analysis

Total RNA was isolated with Trizol from monocytes and Mo-DC (day 7). RNAs

from three donors with equal amount were pooled together to get monocytes and Mo-DC

samples. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used with 1 ug

of total RNA for the construction of sequencing libraries. RNA libraries were prepared

for sequencing using standard Illumina protocols. At the data processing step, basecalls

were performed using CASAVA and sequenced reads were trimmed for adaptor

sequence, and masked for low-complexity or low-quality sequence. Reads Per Kilobase

of exon per Megabase of library size (RPKM) were calculated using a protocol from

Chepelev et al., Nucleic Acids Research, 2009. In short, exons from all isoforms of a

gene were merged to create one meta-transcript. The number of reads falling in the exons

4

of this meta-transcript were counted and normalized by the size of the meta-transcript and

by the size of the library.

These RNA-seq data had been deposited on GEO public database under the

accession number GSE54401.

Quantitative real time PCR (RT-PCR) assay

SYBR RT-PCR kit (Takara) and LightCycler (Roche) were used for quantitative

RT-PCR analysis as described (30). Data were normalized to β-actin expression or to IgG

control. Primer sequences are available upon request.

Flow cytometric analysis

Cells were stained using indicated Abs with the Cytofix/Cytoperm kit (eBioscience)

according to the manufacturer’s instructions (31). Flow cytometry analysis was carried

out on FACSVerse flow cytometry (BD Biosciences). Fluorescent Abs were from R&D

Systems.

Plasmid constructions

Recombinant vectors encoding human STAT3 (NM_139276.2), Jak2

(NM_004972.3) or PU.1 (NM_001080547.1; GenBank accession numbers in

parentheses) and mutants thereof were constructed by PCR-based amplification from

cDNA of human PBMCs and then subcloned into the pcDNA3.1 eukaryotic expression

vector (Invitrogen) as described (30). STAT3 luciferase reporter plasmid was constructed

by inserting STAT3 response elements (5′- TGC TTC CCG AAC GTT GCT TCC CGA

ACG TTG CTT CCC GAA CGT TGC TTC CGA ACG T -3′) before the luciferase

sequence of pGL-basic (Promega). Luciferase reporter plasmid for NF-κB had been

described previously (32). lnc-DC expression vector was constructed by PCR-based

amplification from cDNA of human PBMC and then subcloned into pCDF1 cDNA

Cloning and Expression Lentivectors (System Biosciences). All constructs were

confirmed by DNA sequencing.

Knockdown and Overexpression

The target sequences of lnc-DC, shared by both transcript variants, were 5′- GAG

TTA TCT TAA GGA TCA T -3′ for RNAi-1 and 5′- GGA GTT CCT TGA CTA GG -3′

for RNAi-2 (bolded and underlined in the following lnc-DC sequences); the scrambled

control sequence was 5′- TTC TCC GAA CGT GTC ACG T-3′. And these sequences

5

were clone into lentivirual shRNA expression vector pSIF-H1. For overexpression assay,

lnc-DC variant-1 sequence cloned into lentivirual expression vector pCDF1. Then

lentiviruses were generated with Lentivector Expression Systems (System Biosciences).

Transduction efficiency (MOI=100) was determined by GFP expression to be over 80%

and knockdown efficiency was measured by qPCR to be about 70% down.

>human lnc-DC variant-1 transcript (GenBank accession number: KJ020271)

GTGTTTTTCCAAAGCCTTCCAACAGCAACATGAAGTTGGCAGCCTTCCTC

CTCCTGTGATCCTCATCATCTTCAGCCTAGAGGTACAAGAGCTTCAGGCTGCA

GGAGACCGGCTTGGTACCTGCGTCGAGCTCTGCACAGGTGACTGGGACTGCA

ACCCCGGAGACCACTGTGTCAGCAATGGGTGTGGCCATGAGTGTGTTGCAGG

GTAAGGACAGATGAAGAGTTATCTTAAGGATCATCTTTCCCTAAGATCGTCAT

CCCTTCCTGGAGTTCCTATCTTCCAAGATGTGACTGTCTGGAGTTCCTTGACTA

GGAAGATGGATGAAAACAGCAAGCCTGTGGATGGAGACTACAGGGGATATG

GGAGGCAGGGAAGAGGGGTTGTTTCTTTTAATAAATCATCATTGTTAAAAGC

>human lnc-DC variant-2 transcript (GenBank accession number: KJ020272)

AAGAAAAATGTAGAACTGACTTCTTAATCAAGGGCTGTTCTCCCTAGCAT

CTGTCCCAAAAGTACGGTGGTTTTCAGCACATCCGTTCTTCCATAGGTACCTG

CGTCGAGCTCTGCACAGGTGACTGGGACTGCAACCCCGGAGACCACTGTGTC

AGCAATGGGTGTGGCCATGAGTGTGTTGCAGGGTAAGGACAGATGAAGAGTT

ATCTTAAGGATCATCTTTCCCTAAGATCGTCATCCCTTCCTGGAGTTCCTATCT

TCCAAGATGTGACTGTCTGGAGTTCCTTGACTAGGAAGATGGATGAAAACAG

CAAGCCTGTGGATGGAGACTACAGGGGATATGGGAGGCAGGGAAGAGGGGT

TGTTTCTTTTAATAAATCATCATTGTTAAAAGC

Mouse lnc-DC ortholog (Gene symbol 1100001G20Rik) knockdown was also

mediated through lentivirus shRNA system from Lift Technology. Target sequence of

RNAi-1 was 5′-CAG TCA CAT CTG TAC TAC AAA -3′ and targeting sequence of

RNAi-2 was 5′- GAG GAA CAA TGT GTC AGT ATT -3′ (both were bolded and

underlined in the following sequences).

>mouse linc-DC ortholog 1100001G20Rik

TTGCTGCCTAGCTCAGTGGGTGAAGAGGTTTAAATTCTGGCAGCTCTTGG

CCCTGCTGCGTATTGGCTAACATCCTTCAGCAGCAGCATGAAGCTAGGAGCC

6

TTCCTTCTGTTGGTGTCCCTCATCACCCTCAGCCTAGAGGTACAGGAGCTGCA

GGCTGCAGTGAGACCTCTGCAGCTTTTAGGCACCTGTGCTGAGCTCTGCCGTG

GTGACTGGGACTGTGGGCCAGAGGAACAATGTGTCAGTATTGGATGCAGTCAC

ATCTGTACTACAAACTAAAAACAGCTTCTACCTGGAAAAAAAAATGTGTCTGT

TTGGAGCTCTGTGACCAAGAAAACAGTTGAAAATGGAGGCCATGTATGGAGA

TTACAAGCAGCACAGTGGAGTGGGACAAGGAGTTGTTTCTTTTAATAAATCA

TTAATGTAAAAGTCTCAACAAAAAAAAAAAAAAA

Cytokine detection

Human IL-2, IL-10, IL-12p70 and IFN-γ in supernatants were measured with

ELISA kits (R&D Systems).

Cell nucleus/cytoplasm fraction isolation

For cytoplasmic fraction, cells were washed with ice-cold PBS for two times then

lysed in 0.1% NP40 ice-cold PBS with protease inhibitor cocktail (Calbiochem, La Jolla,

CA) and Ribonucleoside Vanadyl Complex (10mM) (New England BioLabs), and after

short centrifugation, the supernatant was collected as cytoplasmic fraction and the

remainder with additional washing were considered as nuclear pellets.

Immunoblot and immunoprecipitation (IP/RIP)

Cells were lysed with cell lysis buffer (Cell Signaling Technology) supplemented

with protease inhibitor cocktail (Calbiochem, La Jolla, CA). Protein concentrations of the

extracts were measured by bicinchoninic acid assay (Pierce). Forty micrograms of the

protein was used for immunoprecipitation or was loaded per lane, subjected to SDS-

PAGE, transferred onto nitrocellulose membranes, and then blotted. For

immunoprecipitation (RIP) assay and RNA pull-down assay (33), SUPERase•In™ RNase

Inhibitor (1000U/ml, Ambion) and protease inhibitor were added into cell lysis buffer,

and Ribonucleoside Vanadyl Complex (10mM, New England BioLabs) was added into

washing buffer. Abs specific to human STAT1, phosphrilated-STAT1(Y701), STAT3,

phosphrilated-STAT3(Y705), STAT5 and HRP-coupled secondary Abs were from Cell

Signaling Technology (Beverly, MA), SHP1 Ab was from Santa Cruz Biotechnology

(Santa Cruz, CA), and phosphrilated-STAT5 and β-actin Abs were from Bioworld

Technology (St. Louis, MO).

RNA pull-down assay

7

In vitro, biotin-labeled RNAs were transcribed with the Biotin RNA Labeling Mix

(Roche) and T7 RNA polymerase (Promega), treated with RNase-free DNase I

(Promega) and purified with RNeasy Mini Kit (QIAGEN). 3 µg of biotinylated RNA in

RNA structure buffer (10 mM Tris pH 7, 0.1 M KCl, 10 mM MgCl2) was heated to 95°C

for 2 min, put on ice for 3 min, and then left at room temperature (RT) for 30 min to

allow proper secondary structure formation. Folded RNA was then mixed with human

Mo-DC cytoplasm extract (containing 1 mg proteins) in 500 µl RIP buffer and then

incubated at RT for one hour. 50 µl washed Streptavidin agarose beads (Invitrogen) were

added to each binding reaction and further incubated at RT for another one hour. Beads

were washed briefly with RIP buffer for five times and boiled in SDS buffer. Then the

retrieved proteins were detected by Western blot or resolved in gradient gel

electrophoresis followed by mass spectrometry (MS) identification.

Northern blot assay and rapid amplification of cloned cDNA ends (RACE)

Total RNA extracted from human mature DC was subjected to Northern Blot assay

(Ambion, Austin, TX) and RACR PCR (Ambion, Austin, TX) according to

manufacturer’s specifications. Biotin-labeled blots were detected with the

Chemiluminescent Nucleic Acid Detection Module (Thermo).

Chromatin immunoprecipitation combined with quantitative PCR (ChIP-

qPCR) or sequencing (ChIP-seq) and chromatin accessibility analysis

ChIP analyses were performed on chromatin extracts from monocytes, Mo-DC (day

7) and other indicated cells according to manufacturer’s standard protocol (Beyotime

Institute of Biotechnology) with the following antibodies: RNA Polymerase II (Pol II),

acetyl-Histone H3 (Lys27), trimethyl-Histone H3 (Lys4), and PU.1 (Cell Signaling

Technology). A standard curve was generated for each primer pair testing 5 fold dilutions

of input samples. Fold enrichment was quantified using quantitative RT-PCR and

calculated as a percentage of Input chromatin (% Inp). For ChIP-seq experiments,

sequence reads were mapped to the current human reference sequence (GRCh37/hg19)

with Bowtiewith default parameters, and clonal reads were removed from further

analysis. ChIPseeqer (Giannopoulou and Elemento, 2011) was used for peak detection,

annotation, comparison between different lists of peaks, pathway analysis, and peak

8

clustering. Data in wig format were viewed in UCSC custom track. ChIP-seq data were

deposited in the GEO database with accession number GSE43036.

For chromatin accessibility analysis (DNase I sensitivity assays), nucleus of

monocytes, Mo-DCs (day 7) or other indicated cells were treated with DNase I (0.1U/µl,

Promega) at 37℃ for 30 min stopped by adding EDTA (50mM). Genome DNA were

extracted and subjected to Quantitative RT-PCR assay. Fold change for lnc-DC gene loci

are concluded using 2ΔCt with respect to monocytes that are set to a value of 1 and fold

change for CD300E gene are concluded using 2ΔCt with respect to Mo-DC that are set to a

value of 1. Primer sequences are available upon request.

Assay of luciferase reporter gene expression

HEK293T cells were transfected with a mixture of the appropriate luciferase

reporter plasmid as indicated, pRL-TK-renilla-luciferase plasmid and the appropriate

additional constructs. The total amount of transfected DNA plasmids were made equal by

the addition of empty control vector. After 24 hours, cells were collected. Luciferase

activity was measured using Dual-Luciferase Reporter Assay System according to the

manufacturer’s instructions (Promega). Data were normalized for transfection efficiency

by the division of firefly luciferase activity with that of renilla luciferase (32).

RNA fluorescence in situ hybridization (FISH) and immunofluorescence

microscopy

To detect lnc-DC RNA, cells were rinsed briefly in PBS and then fixed in 3.6%

formaldehyde plus 10% acetic acid in PBS (pH 7.4) for 15 min at room temperature.

Cells were permeabilized in PBS containing 0.2%–0.5% Triton X-100 and 5 mM vanadyl

ribonucleoside complex (10mM) (New England BioLabs) on ice for 5 min, washed in

PBS 3× 10 min and rinsed once in 2× SSC buffer. Hybridization was carried out using

DNA probe sets (Biosearch Technologies) in a moist chamber at 37℃ for 12–16 hours

according to the protocol for adherent mammalian cell lines from Biosearch

Technologies. For co-localization studies, after RNA-FISH, cells were again fixed for 5

min in 2% formaldehyde, and subjected to immunofluorescence. Imaging were

performed as described (32). Cells were observed with a Leica TCS SP2 confocal laser

microscopy.

Mixed lymphocyte reactions (MLR)

9

CD4+ T lymphocytes were purified from PBMCs using anti-CD4 microbeads

(Miltenyi Biotech). For allogeneic DC-T cell MLR assay, T cells (1× 105) were cultured

with allogeneic Mo-DC pretreated as described at 10:1 or 50:1 ratio, and 5 days later

proliferation was assessed by measuring CD4+ T cell number with CountBright™

absolute counting beads (Invitrogen) using flow cytometry, and the supernatants were

used for detection of activated T cell related cytokines IFN-γ and IL-2 by ELISA.

Bioinformatics analysis

Examination of ALU element in the sequence of lnc-DC was performed on

bioinformatics website (http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker).

Microarray data of human periphery immune cell subsets were downloaded from

Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) under accession

number GSE28490 (34). Raw data were analyzed with MAS5 in Expression Console and

then logarithmic transformed. The probe sets used in the cluster map of fig S3 were as

following: 229566_at for lnc-DC; 201743_at for CD14; 206398_s_at for CD19;

210895_s_at for CD86; 215332_s_at for CD8B; 204440_at for CD83; 206120_at for

CD33; 209795_at for CD69; 206337_at for CCR7; 210164_at for GZMB; 202859_x_at

for IL8; 214032_at for ZAP70; 205456_at for CD3E; 221491_x_at for HLA-DR;

205786_s_at for CD11B; 210184_at for CD11C; 205987_at for CD1C.

Normalized probe-level expression data of human monocyte/DC subsets from blood

and skin were downloaded from GEO Series Matrix Files under accession number

GSE35457 (23) and probe set for lnc-DC was ILMN_3200140, HEATR6 was

ILMN_1791106, CA4 was ILMN_1695157.

In vivo DC development in BM-reconstituted mice

Lin- BM cells were purified from CD45.2+ or CD45.1+ mouse BM cells using

MACS Lineage Cell Depletion Kit (Miltenyi Biotech) according to the manufacture’s

instruction and then cultured with lnc-DC RNAi lentivirus or its control lentivirus at

MOI=100 for 6 hour. After washed with PBS for three times, CD45.1+ Lin- BM cells

with lnc-DC RNAi lentivirus and CD45.2 cells with control lentivirus, or vice versa, were

mixed at a ratio of 1:1 and then transferred via caudal vein into lethally X ray- irradiated

mice. 3 weeks after reconstitution, these bone marrow chimeric mice were euthanized,

10

spleens were extracted and the ratio of CD45.1+ / CD45.2+ cDC were analyzed with flow

cytometry in spleen.

Nanospray liquid chromatography–tandem mass spectrometry (MS)

Biotinylated lnc-DC or antisense RNA in vitro transcribed with T7 RNA polymerase

(Promega) were incubated with human Mo-DC cytoplasm extract, targeted by

streptavidin agarose beads (Invitrogen), and washed with 1 ml RIP buffer (150 mM KCl,

25 mM Tris pH 7.4, 0.5 mM DTT, 0.5% NP40, 1 mM PMSF and protease Inhibitor

(Roche Complete Protease Inhibitor Cocktail Tablets)) 4× 10 min, and associated

proteins were resolved in gradient gel electrophoresis (35). Different bands were cutout.

Proteins were eluted and digested. Digests were analyzed by nano-ultra-performance

liquid chromatography–electrospray ionization tandem mass spectrometry (MS). Data

from liquid chromatography–tandem mass spectrometry (MS) were processed through

the use of ProteinLynx Global Serverversion 2.4 (PLGS 2.4); the resulting peak lists were

used for searching the NCBI protein database with the Mascot search engine.

SILAC-based MS analysis of STAT3 post translational modification

Basically, it was carried out according to manufacturer’s protocol (Pierce® SILAC

Protein Quantitation Kits, Thermo SCIENTIFIC) with a few modifications. HEK293T

cells were grown in light isotope-containing medium (293T-L) or in heavy isotope-

containing medium (293T-H) for 20 days. Then these cells were co-transfected with

STAT3-Flag and JAK2 expression vectors along with lnc-DC expression vector for

293T-H or the control vector pCDF1 for 293T-L. 36 hours later, cells were lysed and

Flag-tagged STAT3 were immunoprecipitated with Flag-specific antibody from 293T-L

and 293T-H. These STAT3-H and STAT3-L protein samples were mixed and, after

stringently washing, were subjected to PAGE gel electrophoresis. STAT3 band were cut

and analyzed with MS for post translational modification. Phosphorylated peptides and

phosphorylation sites were identified and quantified for the ratio of H/L. So, in the result

(fig. S20 and Table S1), H is for STAT3 with lnc-DC and L is for STAT3 with no lnc-DC.

In vitro assay of STAT3 dephosphorylation

Phosphorylated human STAT3 were immunoprecipitated with anti-Flag gel beads

(Sigma) from HEK293T lysates after 24 hours cotransfection with STAT3 and Jak2

expression vectors. After stringently washing, immunoprecipitated STAT3 was incubated

11

with recombined human SHP1 (R&D Systems) according to manufactures instruction in

the present of indicated RNA or not.

Statistical analysis

The statistical significance of comparisons between two groups was determined with

Student’s t-test. P values of less than 0.05 were considered statistically significant.

Pearson correlation analysis was performed with GraphPad Prism 5.

12

Supplementary Figures:

Fig S1. lnc-DC gene is moderately conserved among placental mammals compared with

highly conserved coding genes. Placental mammal conservation of lnc-DC and its nearby

coding gene HEATR6 by PhastCons, UCSC (http://genome.ucsc.edu/).

13

Fig S2. lnc-DC expression data from ENCODE RNA-seq project (24). Data are shown as

reads density around lnc-DC gene loci from UCSC gnome browser. H1-hESC, human

embryonic stem cells; LHCN-M2, skeletal myoblast cell line; CD14 cells, monocytes;

CD20 cells, B cells; CD34 cells, mobilized hematopoietic progenitor cells in human

periphery blood.

14

Fig S3. lnc-DC is more exclusively expressed in human cDC than other DC markers.

Shown is the cluster map of indicated gene levels in blood immune cells using data from

GEO database under the accession number of GSE28490 (34). Red means high

expression level.

15

Fig S4. Identification of the transcriptional starting site (TSS) and ending site of lnc-DC

in Mo-DC and its two transcript variants in Mo-DC. (A) TSS identified with 5′ cap

structures using two sets of primers, transcriptional ending site identified with 3′ poly (A)

using three sets of primers in RACE assay and illustration of the full-length lnc-DC

transcripts cloned from human Mo-DC. The GenBank accession numbers of lnc-DC

variant-1 and lnc-DC variant-2 are KJ020271 and KJ020272, respectively. Primers 1-5

indicated the primers used in RACE assay. (B) Quantitative RT-PCR (left) and northern

blot (right) analysis of the two variants of lnc-DC in Mo-DC. U6 serves as a loading

control. Primers and probes to distinguish these two variants were indicated in (A). Data

are from three independent experiments (mean ± SD).

16

Fig S5. lnc-DC RNA has poly A tail and 5’ cap structure and has no coding capability.

(A) Left: lnc-DC is examined in RT-PCR assay with polyA+ RNA fraction and polyA-

RNA fraction from Mo-DC. Right: total RNA from Mo-DC were treated whit Calf

Intestine Alkaline Phosphatase (CIP) to remove free 5’-P then treated with Tobacco Acid

Pyrophosphatase (TAP) to remove the cap structure and then a RNA adapter

oligonucleotide was ligated to the RNA population using T4 RNA ligase (FistChoice

RLM-RACE Kit, Ambion). Finally RT-PCR with gene specific primers was used to

detect lnc-DC. (B) Full-length lnc-DC was cloned into the eukaryotic expression vector

pcDNA3.1 with N-terminal start codon ATG and C-terminal Flag tag in all three coding

patterns and these plasmids subsequently transfected into HEK293T cells separately.

After 48 hours, immunoblotting was used to detect the Flag-tagged protein. HDAC11

with Flag tag severs as a positive control. Data are representative of three independent

experiments. Bioinformatics analysis also confirmed lnc-DC had no coding capability

(36) (http://cpc.cbi.pku.edu.cn/programs/run_cpc.jsp).

17

Fig S6. H3K4me3 and H3K27ac modifications and chromatin accessibility of lnc-DC

gene remain at low levels during the differentiation and activation of Mo-MΦ. Nine

regions (capital letters A-I) across lnc-DC gene locus were analyzed in ChIP-qPCR

analyses for H3K4me3 and H3K27ac histone modification in human monocytes, Mo-MΦ

(day 5) and LPS-activated Mo-MΦ (300ng/ml, 24 hours). Values derived from three

independent experiments were normalized by background signals (IgG) and presented as

percentage of Input chromatin (% Inp). And chromatin accessibility or DNase I

sensitivity was revealed by DNA sequence integrality (Ct values in quantitative RT-PCR)

after DNase I treatment of chromatin. Changed fold were concluded using 2ΔCt with

respect to monocytes set to a value of 1. Statistical significance is calculated with respect

to monocytes. *P < 0.05 and **P < 0.01 (Student’s t-test). Data are from three

independent experiments (mean ± SD).

18

19

Fig S7. DNase I hypersensitivity (DNase I HS) data (A) and histone modification data (B)

on lnc-DC gene loci from ENCODE project (37, 38). Data are shown as reads density

mapping on lnc-DC gene loci from UCSC gnome browser. H1-hESC, human embryonic

stem cells; LHCN-M2, skeletal myoblast cell line; CD14 cells, monocytes; CD20 cells, B

cells; CD34 cells, mobilized hematopoietic progenitor cells.

20

Fig S8. lnc-DC knockdown leads to markedly changes on genome expression profile.

Shown is the cluster heat map of 664 coding genes with significantly altered expression

when lnc-DC was knockdown (log 2 fold >1，P <0.05) in cells after 7 days’ DC culture.

21

Fig S9. lnc-DC knockdown in Mo-DC attenuates CD4+ T cell activation in allogeneic

MLR assay. (A) Quantitative RT-PCR (qPCR) of lnc-DC in cells after 7 days’ DC

culture from monocytes with lnc-DC knockdown or not. (B) ELISA of human IFN-γ and

IL-2 in the supernatant of allogeneic MLR assays as in Fig. 3D. *P < 0.05, **P < 0.01

(Student’s t-test). Data are shown as mean ± SD from five donors.

22

Fig S10. Exogenous expression of lnc-DC promotes Mo-DC differentiation and DC

function. (A) Quantitative RT-PCR detection of lnc-DC in Mo-DC (day 5) derived from

monocytes with lentivirus-mediated lnc-DC overexpression or the control. (B) Flow

cytometry assay of indicated surface markers of Mo-DC (day 5) with lnc-DC

overexpression or not. Data shows the MFI value ± s.d. of five samples. (C) CD4+ cell

proliferation was presented by cell numbers 5 days after cultured at a ratio of 10:1 or 50:1

with allogeneic Mo-DC without transfection, or LV transfected with control or lnc-DC

overexpression. (D) ELISA of human IFN-γ and IL-2 in the supernatant of (C). *P < 0.05

(two-tailed Student’s t-test). Data are shown as mean ± SD of five samples.

23

Fig S11. lnc-DC knockdown attenuates IL-12 secretion while has no effect on IL-10

production in Mo-DC. (A) ELISA of human IL12p70 in the supernatant of cells

stimulated with LPS (300ng/ml) for 24 hours, after 5 days in DC culture development

from monocytes with lnc-DC knockdown or not. (B) Quantitative RT-PCR assay (left)

and ELISA (right) of human IL10 in cells stimulated with LPS (300ng/ml) for 24 hours,

after 5 days in DC culture differentiated from monocytes with lnc-DC knockdown or not.

**P < 0.01 (Student’s t-test). Data are shown as mean ± SD from five donors.

24

Fig S12. lnc-DC knockdown has no effect on human DC apoptosis. (A) Flow cytometry

of Mo-DC (day 7) transfected with lnc-DC RNAi at day 3 or not and then analyzed for

apoptosis. (B) Immunoblot detection of apoptosis-related proteins in DCs transfected

with lnc-DC RNAi at day 3 or not, then stimulated with LPS (300ng/ml) at day 5 for

indicated time. Data are representative of three independent experiments.

25

Fig S13. Knockdown of lnc-DC ortholog in mouse bone marrow cells impairs Flt3L-

triggered STAT3 phosphorylation and mouse DC development in vitro and in vivo. (A)

qPCR detection of lnc-DC ortholog in bone marrow cells transfected with lentivirus

RNAi-1, RNAi-2, or control lentivirus at MOI=100 for 5 days. (B) Flow cytometry of

mouse bone marrow cells transfected with lnc-DC RNAi lentivirus or the control

lentivirus cultured for 5 days culture in vitro with mouse Flt3L (200ng/ml) and then

analyzed for the expression of CD11c and CD11b. Data are representative of three

independent experiments. Data are representative of three independent experiments. (C)

Lin- BM cells from CD45.1 or CD45.2 mice were transduced with lnc-DC RNAi

lentivirus or the control lentivirus separately, and then mixed at 1:1 ratio and i.v.

transferred into lethally irradiated mice. 3 weeks after reconstitution, splenocytes of these

BM chimeric mice were analyzed for CD11c+ MHC-II+ DC by flow cytometry. Data are

representative for 6 transfers. (D) Immunoblot detection of pSTAT3 in mouse BM cells

in Flt3L culture for 5 days with lentivirus-mediated mouse lnc-DC ortholog RNAi or its

26

control. Data are representative of three independent experiments. Data are representative

of three independent experiments.

27

Fig S14. lnc-DC expression has no relationship with its nearby coding genes. (A) qPCR

detection of indicated genes in monocyte-derived cells with lnc-DC knockdown or not.

(B) qPCR detection of lnc-DC and its nearby coding genes’ mRNA levels in the process

of Mo-DC development. Relative expression levels were calculated with respect to lnc-

DC level in monocytes. Data are shown as mean ± SD from five donors. (C, D) Pearson

correlation analysis of lnc-DC expression level (ILMN_3200140) with its nearby genes

HEATR6 (ILMN_1791106) (C) or CA4 (ILMN_1695157) (D) using gene expression

data from 49 samples of mono/DC subsets in human (GSE35457).

28

Fig S15. The cytoplasmic location of lnc-DC in human DC. (A) RNA FISH assay of lnc-

DC in Mo-DC (7 day). The white scale bar represents 10µm. More than fifty cells have

been examined and got similar results. (B) RT-PCR detection of lnc-DC or its transcript

variant-2 in the cytoplasmic (cyt.) and nuclear (nu.) fractions of Mo-DC (day 5 and day

7). ACTB and U6 serve as cytoplasmic and nuclear localization control, respectively.

Data are representative of three independent experiments.

29

Fig S16. lnc-DC dose not associate with AGO2 protein. Quantitative RT-PCR detection

of lnc-DC and SOCS1 mRNA in the immunoprecipitation by IgG or AGO2 specific

antibody from human Mo-DC lysates. SOCS1 mRNA, a validated target of miR-155,

serves as a positive control. Data are presented with respect to IgG that is set to a value of

1. **P < 0.01 (Student’s t-test). Data are shown as mean ± SD from three donors.

30

Fig S17. 3′-end structure of lnc-DC may be responsible for its interaction with STAT3.

(A) Immunoblot detection of STAT3 pull-downed by antisense, sense or truncated lnc-

DC from Mo-DC cytoplasmic lysates. Data are representative of three independent

experiments. (B) 3′-end segment of lnc-DC (265~417nt) is predicted to have a stable

stem-loop structure. Prediction of lnc-DC structure of a 265~417nt region and its

antisense sequence control based on minimum free energy (MFE) and partition function

(26). Color scale indicates the confidence for the prediction for each base with shades of

red indicating strong confidence. (http://rna.tbi.univie.ac.at/)

31

Fig S18. lnc-DC binds to the C-terminus of STAT3 protein. (A) qPCR detection of lnc-

DC retrieved by full-length or domain truncated STAT3-Flag using Flag antibody in the

RIP assay within HEK293T cells transfected with indicated vectors. Int, protein

interaction domain; CC, coiled-coil domain; DB, DNA binding domain; C-end, C-

terminus. (B) Immunoblot of Flag antibody to detect full-length or domain truncated

STAT3-Flag in the input lysates of HEK293T (input) transfected with their vectors, or in

the retrieved proteins by biotinylated lnc-DC (Lnc-DC retrieved) in RNA pull-down

assay. (C) RNA FISH assay of lnc-DC followed by immunofluorescence detection of

Flag tag in HEK293T transfected with STAT3-Flag, STAT3 ΔC-end Flag or STAT3 C-

end Flag expression vector together with lnc-DC expression vector. The white scale bar,

32

10µm. Int, protein interaction domain; CC, coiled-coil domain; DB, DNA binding

domain; C-end, C-terminal domain. Data are representative of three independent

experiments. Data are representative of three independent experiments or are shown as

mean ± SD from three experiments.

33

Fig S19. lnc-DC promotes STAT3 signaling. (A) Immunofluorescence detection of

STAT3 nuclear translocation in Mo-DC, 3 days after transfection with lnc-DC RNAi or

control RNAi. Scale bar, 10µm. (B) Luciferase activity in lysates of HEK293T cells

transfected with STAT3 response elements luciferase reporter plasmid (STAT3 RE luc)

or NF-κB luciferase reporter plasmid (NF-κB luc), together with increasing

concentrations (wedge) of lnc-DC expression vector, after 24 hours stimulation with

rhIL-6 (50ng/ml), Data are normalized by renilla luciferase activity and presented with

respect to no lnc-DC samples. NF-κB luciferase reporter serves as a negative control. (C)

Immunoblot detection of pSTAT3 in THP-1 transfected with lnc-DC or its 3’ segment

expression vector, or the control vector for 24 hours. **P < 0.01 (two-tailed Student’s t-

test). Data are representative of three independent experiments (B, mean ± SD from 6

samples).

34

Fig S20. Phosphorylation analysis of STAT3 with (H) or without (L) lnc-DC through

SILAC-assisted MS reveals that Y705 phosphorylation is enhanced by lnc-DC. The

peptides detected by MS are indicated above the graphs.

YCRPESQEHPEADPGSAAPY(ph)IK peptide (ph, phosphorylation) is near the C

terminus of STAT3 protein. The lysine residue at position 705 was identified in its

phosphorylation form in both the heavy isotope peptide (H) and the light isotope peptide

(L) (upper). The observed ion ratio is roughly 1.32 (H/L, lnc-DC vs. no lnc-DC).

Peptides without phosphorylation covering Y705 were also identified in both heavy

isotope (H) and light isotope (L) form (down). The observed ion ratio is roughly 0.89

(H/L, lnc-DC vs. no lnc-DC). These data suggest Y705 phosphorylation of STAT3 is

enhanced by lnc-DC.

35

Fig S21. STAT3 target genes are affected by lnc-DC knockdown and STAT3 inhibition.

Heat map representation of the mean fold change in gene expression, as determined by

transcriptome analysis of monocyte-derived cells with lentivirus mediated lnc-DC

knockdown or STAT3 inhibition (S3I-201) after 7 days DC culture (n=2).

36

Fig S22. Inhibition of STAT3 signaling impairs Mo-DC differentiation, resembling the

effect of lnc-DC knockdown. (A) Flow cytometry of Mo-DC pretreated with DMSO,

S3I-201 (200µM) or Stattic (10µM) and then stimulated with LPS (300ng/ml) for 12

hours. (B) Supernatant ELISA of indicated human cytokines in Mo-DC treated as in (A).

(C) ELISA of human IFN-γ and IL-2 in the supernatant of allogeneic MLR assays using

DCs pretreated as in (A). (D) CD4+ T cell proliferation was presented by cell numbers in

the 5-day allogeneic MLR as in (C). *P < 0.05 and **P < 0.01 (Student’s t-test). Data are

shown as mean ± SD from three donors (B-D) or are representative of three independent

experiments (A).

37

Fig S23. lnc-DC impairs the interaction between STAT3 and SHP1. (A) PAGE gel

resolution of immunoprecipitated STAT3 and its associated proteins from monocyte-

derived cells in GM-CSF/IL-4 culture for 5 days after transfection with lnc-DC RNAi or

control RNAi. Different bands were analyzed by MS. (B, C) Immunoblot detection of

indicated proteins in STAT3-immunoprecipitated complex (B) or in SHP1-

immunoprecipitated complex (C) from lysates of Mo-DC with lnc-DC knockdown or not.

(D, E) Immunoblot detection of STAT3-immunoprecipitated SHP1 (D) or SHP1-

immunoprecipitated STAT3 (E) in HEK293T co-transfected their expression vectors and

lnc-DC expression vectors or control vectors. Data are representative of three

independent experiments.

38

Fig S24. Proposed model for lnc-DC in human DC differentiation. During the process of

DC differentiation from monocytes, histone modifications of H3K4me3 and H3K27ac on

lnc-DC loci are increased, accompanied by chromatin structure opening, which allows

transcription factor PU.1 binding to the promoter of lnc-DC to induce its transcription.

Once exclusively expressed in DC, lnc-DC is translocated into cytoplasm, where it

directly interacts with C-terminus of STAT3 probably through its 3′-end stem-loop

structure. The binding of lnc-DC to STAT3 preserves the Y305 phosphorylation of

STAT3 from dephosphorylation by tyrosine phosphatase SHP1, finally strengthening

STAT3 signaling to promote DC differentiation.

39

Table S1. SILAC-based MS analysis of STAT3 for post translational modification

(PTM): phosphorylation.

H is for heavy isotope STAT3 from cells with lnc-DC, L is for light isotope STAT3 from

cells with no lnc-DC. Normalized Ratio H/L is shown. To see more details, please refer

to Materials and Methods.

Gene names Position Localization

prob Score diff Score

Phospho Amino

acid M/Z Mass_error

[ppm] Ratio H/L

normalized

GALNT2 392 0.99977 36.378 38.178 Y 932.90603 2.1136 0.0012936

FAM13C1 446 1 48.7963 48.796 Y 606.31284 1.327 0.0016774

STAT3 705 1 67.4033 133.26 Y 861.3721 0.72873 1.4177

RFT1 537 0.999984 48.0611 49.5 T 675.84811 -0.97445 1.1552

DPEP3 270 0.841605 12.5943 25.824 S 952.40586 0.05233 1.0579

ADORA2 213 1 32.3406 32.341 S 631.63979 -2.7219 0.019216

TAS2R10 212 0.803541 3.20172 6.6639 T 906.36689 -0.41742 0.00032091

TAS2R10 217 0.803541 3.20172 6.6639 S 906.36689 -0.41742 0.00032091

TAS2R10 219 0.803541 3.20172 6.6639 T 906.36689 -0.41742 0.00032091 SELM; SEPM 44 1 35.7567 35.757 T 614.62186 -0.31661 1.0247

TJP1 758 0.999983 47.7549 50.607 S 641.32681 2.2784 0.67659

WBP2 49 0.9996 38.75 42.395 T 679.30129 -0.1859 16.699

WBP2 51 0.999597 38.6319 42.395 Y 679.30129 -0.1859 16.699

ACAP3 109 1 66.2625 66.262 S 770.36379 -0.72591 0.043121

KIAA1984 255 0.766888 7.89448 45.915 T 811.41348 0.14434 13.483

PRKD1 280 0.833333 0 0.89892 T 844.60703 -3.7261 0.2912

PRKD1 285 0.833333 0 0.89892 S 844.60703 -3.7261 0.2912

PRKD1 286 0.833333 0 0.89892 Y 844.60703 -3.7261 0.2912

PRKD1 287 0.833333 0 0.89892 T 844.60703 -3.7261 0.2912

PRKD1 290 0.833333 0 0.89892 T 844.60703 -3.7261 0.2912

PRKD1 294 0.833333 0 0.89892 Y 844.60703 -3.7261 0.2912

CCDC121 209 0.324239 0 0.91935 T 1035.116 1.2385 NaN

CCDC121 213 0.324239 0 0.91935 T 1035.116 1.2385 NaN

CCDC121 222 0.324239 0 0.91935 S 1035.116 1.2385 NaN

CCDC121 227 0.352211 0.0204299 0.91935 S 1035.116 1.2385 NaN

FIGF; VEGFD 15 0.5 0 11.517 Y 1252.9204 -0.039321 0.085882

FIGF; VEGFD 2 0.5 0 11.517 Y 1252.9204 -0.039321 0.085882

FIGF; VEGFD 22 0.5 0 11.517 S 1252.9204 -0.039321 0.085882

FIGF; VEGFD 23 0.5 0 11.517 S 1252.9204 -0.039321 0.085882

CGI-124; CYPL1; PPIL1;

UNQ2425/ PRO4984

68 0.5 0 37.092 T 634.63241 1.3692 1.1021

CGI-124; CYPL1; 70 0.5 0 37.092 T 634.63241 1.3692 1.1021

40

PPIL1; UNQ2425/ PRO4984

CYP12 78 0.368905 0 3.7053 T 1265.9287 -3.1894 NaN

CYP12 85 0.368905 0 3.7053 S 1265.9287 -3.1894 NaN

CYP12 88 0.368905 0 3.7053 S 1265.9287 -3.1894 NaN APXL;SHROOM2 695 1 15.1508 15.151 T 619.29634 2.3929 NaN

APXL;SHROOM2 696 1 15.1508 15.151 S 619.29634 2.3929 NaN

CCNA1 340 0.264321 0 0.4981 T 945.26588 0.44741 NaN

CCNA1 343 0.264321 0 0.4981 T 945.26588 0.44741 NaN BSN;

KIAA0434;ZNF231

2984 0.999809 37.1912 37.191 T 434.22688 -3.2069 NaN

DLAT 644 0.999999 60.9729 60.973 T 650.83476 -0.73491 NaN

SRCASM 243 0.682079 7.55627 8.6425 Y 1238.9241 2.3538 17.493

RYR2 4543 0.561249 0 3.3983 T 930.00706 -0.57775 NaN

RYR2 4545 0.561249 0 3.3983 S 930.00706 -0.57775 NaN

RYR2 4546 0.561249 0 3.3983 S 930.00706 -0.57775 NaN

RYR2 4554 0.572589 0 3.3983 S 930.00706 -0.57775 NaN

RYR2 4557 0.572589 0 3.3983 S 930.00706 -0.57775 NaN

RYR2 4558 0.572589 0 3.3983 S 930.00706 -0.57775 NaN

RYR2 4559 0.572589 0 3.3983 S 930.00706 -0.57775 NaN

CDH6 703 0.666667 0 36.982 T 781.32963 -1.5925 NaN

CDH6 705 0.666667 0 36.982 T 781.32963 -1.5925 NaN

CDH6 710 0.666667 0 36.982 T 781.32963 -1.5925 NaN

IK1 407 0.652086 3.76678 10.511 T 1253.6067 -2.429 NaN

IK1 411 0.652086 3.76678 10.511 S 1253.6067 -2.429 NaN

IK1 412 0.652086 3.76678 10.511 T 1253.6067 -2.429 NaN

CACH6 583 1 14.5615 14.561 T 883.39761 -3.7834 NaN

CACH6 585 1 14.5615 14.561 Y 883.39761 -3.7834 NaN

CACH6 588 1 14.5615 14.561 S 883.39761 -3.7834 NaN

LDHA 103 1 15.8814 15.881 T 495.22706 4.6197 NaN

LDHA 108 1 15.8814 15.881 S 495.22706 4.6197 NaN

CPAMD8 1196 1 4.98047 4.9805 S 480.46997 -3.088 NaN

CPAMD8 1197 1 4.98047 4.9805 Y 480.46997 -3.088 NaN

CPAMD8 1198 1 4.98047 4.9805 S 480.46997 -3.088 NaN

KIAA0397 398 0.602753 0 3.5275 S 1422.0164 2.1399 NaN

KIAA0397 399 0.602753 0 3.5275 S 1422.0164 2.1399 NaN

KIAA0397 402 0.602753 0 3.5275 S 1422.0164 2.1399 NaN

KIAA0397 410 0.701844 2.44977 3.5275 T 1422.0164 2.1399 NaN

KIAA0397 414 0.744948 3.5275 3.5275 T 1422.0164 2.1399 NaN

KIAA0397 416 0.744948 3.5275 3.5275 Y 1422.0164 2.1399 NaN RP6-

29D12.1-003;

SMC1A

32 0.487217 0 29.687 S 660.33593 0.66736 NaN

RP6-29D12.1- 35 0.487217 0 29.687 T 660.33593 0.66736 NaN

41

003; SMC1A STAT3 727 1 69.7527 181.41 S 1195.5331 -0.17341 NaN

ANKRD28 6 0.93199 11.3684 11.368 T 496.73538 -3.2932 NaN

References and Notes

1. P. Johnsson, L. Lipovich, D. Grandér, K. V. Morris, Evolutionary conservation of long non-

coding RNAs; sequence, structure, function. Biochim. Biophys. Acta 1840, 1063–1071

(2014). Medline doi:10.1016/j.bbagen.2013.10.035

2. O. Wapinski, H. Y. Chang, Long noncoding RNAs and human disease. Trends Cell Biol. 21,

354–361 (2011). Medline doi:10.1016/j.tcb.2011.04.001

3. M. Sauvageau, L. A. Goff, S. Lodato, B. Bonev, A. F. Groff, C. Gerhardinger, D. B. Sanchez-

Gomez, E. Hacisuleyman, E. Li, M. Spence, S. C. Liapis, W. Mallard, M. Morse, M. R.

Swerdel, M. F. D’Ecclessis, J. C. Moore, V. Lai, G. Gong, G. D. Yancopoulos, D.

Frendewey, M. Kellis, R. P. Hart, D. M. Valenzuela, P. Arlotta, J. L. Rinn, Multiple

knockout mouse models reveal lincRNAs are required for life and brain development.

eLife 2, e01749 (2013). Medline doi:10.7554/eLife.01749

4. J. L. Rinn, H. Y. Chang, Genome regulation by long noncoding RNAs. Annu. Rev. Biochem.

81, 145–166 (2012). Medline doi:10.1146/annurev-biochem-051410-092902

5. Z. Li, T. C. Chao, K. Y. Chang, N. Lin, V. S. Patil, C. Shimizu, S. R. Head, J. C. Burns, T. M.

Rana, The long noncoding RNA THRIL regulates TNFα expression through its

interaction with hnRNPL. Proc. Natl. Acad. Sci. U.S.A. 111, 1002–1007 (2014). Medline

doi:10.1073/pnas.1313768111

6. S. Carpenter, D. Aiello, M. K. Atianand, E. P. Ricci, P. Gandhi, L. L. Hall, M. Byron, B.

Monks, M. Henry-Bezy, J. B. Lawrence, L. A. O’Neill, M. J. Moore, D. R. Caffrey, K.

A. Fitzgerald, A long noncoding RNA mediates both activation and repression of

immune response genes. Science 341, 789–792 (2013). doi:10.1126/science.1240925

7. G. Hu, Q. Tang, S. Sharma, F. Yu, T. M. Escobar, S. A. Muljo, J. Zhu, K. Zhao, Expression

and regulation of intergenic long noncoding RNAs during T cell development and

differentiation. Nat. Immunol. 14, 1190–1198 (2013). Medline doi:10.1038/ni.2712

8. P. Guermonprez, J. Helft, C. Claser, S. Deroubaix, H. Karanje, A. Gazumyan, G. Darasse-

Jèze, S. B. Telerman, G. Breton, H. A. Schreiber, N. Frias-Staheli, E. Billerbeck, M.

Dorner, C. M. Rice, A. Ploss, F. Klein, M. Swiecki, M. Colonna, A. O. Kamphorst, M.

Meredith, R. Niec, C. Takacs, F. Mikhail, A. Hari, D. Bosque, T. Eisenreich, M. Merad,

Y. Shi, F. Ginhoux, L. Rénia, B. C. Urban, M. C. Nussenzweig, Inflammatory Flt3l is

essential to mobilize dendritic cells and for T cell responses during Plasmodium

infection. Nat. Med. 19, 730–738 (2013). Medline doi:10.1038/nm.3197

9. Y. Laouar, T. Welte, X. Y. Fu, R. A. Flavell, STAT3 is required for Flt3L-dependent dendritic

cell differentiation. Immunity 19, 903–912 (2003). Medline doi:10.1016/S1074-

7613(03)00332-7

10. S. Carotta, A. Dakic, A. D’Amico, S. H. Pang, K. T. Greig, S. L. Nutt, L. Wu, The

transcription factor PU.1 controls dendritic cell development and Flt3 cytokine receptor

expression in a dose-dependent manner. Immunity 32, 628–641 (2010). Medline

doi:10.1016/j.immuni.2010.05.005

11. M. Merad, P. Sathe, J. Helft, J. Miller, A. Mortha, The dendritic cell lineage: Ontogeny and

function of dendritic cells and their subsets in the steady state and the inflamed setting.

Annu. Rev. Immunol. 31, 563–604 (2013). Medline doi:10.1146/annurev-immunol-

020711-074950

12. L. A. O’Neill, F. J. Sheedy, C. E. McCoy, MicroRNAs: The fine-tuners of Toll-like receptor

signalling. Nat. Rev. Immunol. 11, 163–175 (2011). Medline doi:10.1038/nri2957

13. M. S. Ebert, P. A. Sharp, Roles for microRNAs in conferring robustness to biological

processes. Cell 149, 515–524 (2012). Medline doi:10.1016/j.cell.2012.04.005

14. T. R. Mercer, J. S. Mattick, Structure and function of long noncoding RNAs in epigenetic

regulation. Nat. Struct. Mol. Biol. 20, 300–307 (2013). Medline doi:10.1038/nsmb.2480

15. K. V. Morris, S. Santoso, A. M. Turner, C. Pastori, P. G. Hawkins, Bidirectional

transcription directs both transcriptional gene activation and suppression in human cells.

PLOS Genet. 4, e1000258 (2008). Medline doi:10.1371/journal.pgen.1000258

16. P. Johnsson, A. Ackley, L. Vidarsdottir, W. O. Lui, M. Corcoran, D. Grandér, K. V. Morris,

A pseudogene long-noncoding-RNA network regulates PTEN transcription and

translation in human cells. Nat. Struct. Mol. Biol. 20, 440–446 (2013). Medline

doi:10.1038/nsmb.2516

17. M. Huarte, M. Guttman, D. Feldser, M. Garber, M. J. Koziol, D. Kenzelmann-Broz, A. M.

Khalil, O. Zuk, I. Amit, M. Rabani, L. D. Attardi, A. Regev, E. S. Lander, T. Jacks, J. L.

Rinn, A large intergenic noncoding RNA induced by p53 mediates global gene repression

in the p53 response. Cell 142, 409–419 (2010). Medline doi:10.1016/j.cell.2010.06.040

18. U. A. Ørom, T. Derrien, M. Beringer, K. Gumireddy, A. Gardini, G. Bussotti, F. Lai, M.

Zytnicki, C. Notredame, Q. Huang, R. Guigo, R. Shiekhattar, Long noncoding RNAs

with enhancer-like function in human cells. Cell 143, 46–58 (2010). Medline

doi:10.1016/j.cell.2010.09.001

19. M. Cesana, D. Cacchiarelli, I. Legnini, T. Santini, O. Sthandier, M. Chinappi, A.

Tramontano, I. Bozzoni, A long noncoding RNA controls muscle differentiation by

functioning as a competing endogenous RNA. Cell 147, 358–369 (2011). Medline

doi:10.1016/j.cell.2011.09.028

20. Y. Tay, L. Kats, L. Salmena, D. Weiss, S. M. Tan, U. Ala, F. Karreth, L. Poliseno, P.

Provero, F. Di Cunto, J. Lieberman, I. Rigoutsos, P. P. Pandolfi, Coding-independent

regulation of the tumor suppressor PTEN by competing endogenous mRNAs. Cell 147,

344–357 (2011). Medline doi:10.1016/j.cell.2011.09.029

21. C. Gong, L. E. Maquat, lncRNAs transactivate STAU1-mediated mRNA decay by duplexing

with 3′ UTRs via Alu elements. Nature 470, 284–288 (2011). Medline

doi:10.1038/nature09701

22. See supplementary materials and methods on Science Online.

23. M. Haniffa, A. Shin, V. Bigley, N. McGovern, P. Teo, P. See, P. S. Wasan, X. N. Wang, F.

Malinarich, B. Malleret, A. Larbi, P. Tan, H. Zhao, M. Poidinger, S. Pagan, S. Cookson,

R. Dickinson, I. Dimmick, R. F. Jarrett, L. Renia, J. Tam, C. Song, J. Connolly, J. K.

Chan, A. Gehring, A. Bertoletti, M. Collin, F. Ginhoux, Human tissues contain CD141hi

cross-presenting dendritic cells with functional homology to mouse CD103+

nonlymphoid dendritic cells. Immunity 37, 60–73 (2012). Medline

doi:10.1016/j.immuni.2012.04.012

24. S. Djebali, C. A. Davis, A. Merkel, A. Dobin, T. Lassmann, A. Mortazavi, A. Tanzer, J.

Lagarde, W. Lin, F. Schlesinger, C. Xue, G. K. Marinov, J. Khatun, B. A. Williams, C.

Zaleski, J. Rozowsky, M. Röder, F. Kokocinski, R. F. Abdelhamid, T. Alioto, I.

Antoshechkin, M. T. Baer, N. S. Bar, P. Batut, K. Bell, I. Bell, S. Chakrabortty, X. Chen,

J. Chrast, J. Curado, T. Derrien, J. Drenkow, E. Dumais, J. Dumais, R. Duttagupta, E.

Falconnet, M. Fastuca, K. Fejes-Toth, P. Ferreira, S. Foissac, M. J. Fullwood, H. Gao, D.

Gonzalez, A. Gordon, H. Gunawardena, C. Howald, S. Jha, R. Johnson, P. Kapranov, B.

King, C. Kingswood, O. J. Luo, E. Park, K. Persaud, J. B. Preall, P. Ribeca, B. Risk, D.

Robyr, M. Sammeth, L. Schaffer, L. H. See, A. Shahab, J. Skancke, A. M. Suzuki, H.

Takahashi, H. Tilgner, D. Trout, N. Walters, H. Wang, J. Wrobel, Y. Yu, X. Ruan, Y.

Hayashizaki, J. Harrow, M. Gerstein, T. Hubbard, A. Reymond, S. E. Antonarakis, G.

Hannon, M. C. Giddings, Y. Ruan, B. Wold, P. Carninci, R. Guigó, T. R. Gingeras,

Landscape of transcription in human cells. Nature 489, 101–108 (2012). Medline

doi:10.1038/nature11233

25. A. Guerriero, P. B. Langmuir, L. M. Spain, E. W. Scott, PU.1 is required for myeloid-derived

but not lymphoid-derived dendritic cells. Blood 95, 879–885 (2000). Medline

26. A. R. Gruber, R. Lorenz, S. H. Bernhart, R. Neuböck, I. L. Hofacker, The Vienna RNA

Websuite. Nucleic Acids Res. 36 (suppl. 2), W70–W74 (2008). Medline

doi:10.1093/nar/gkn188

27. J. J. O’Shea, R. Plenge, JAK and STAT signaling molecules in immunoregulation and

immune-mediated disease. Immunity 36, 542–550 (2012). Medline

doi:10.1016/j.immuni.2012.03.014

28. K. Siddiquee, S. Zhang, W. C. Guida, M. A. Blaskovich, B. Greedy, H. R. Lawrence, M. L.

Yip, R. Jove, M. M. McLaughlin, N. J. Lawrence, S. M. Sebti, J. Turkson, Selective

chemical probe inhibitor of Stat3, identified through structure-based virtual screening,

induces antitumor activity. Proc. Natl. Acad. Sci. U.S.A. 104, 7391–7396 (2007). Medline

doi:10.1073/pnas.0609757104

29. S. Liu, Y. Yu, M. Zhang, W. Wang, X. Cao, The involvement of TNF-α-related apoptosis-

inducing ligand in the enhanced cytotoxicity of IFN-β-stimulated human dendritic cells to

tumor cells. J. Immunol. 166, 5407–5415 (2001). Medline

30. W. Chen, C. Han, B. Xie, X. Hu, Q. Yu, L. Shi, Q. Wang, D. Li, J. Wang, P. Zheng, Y. Liu,

X. Cao, Induction of Siglec-G by RNA viruses inhibits the innate immune response by

promoting RIG-I degradation. Cell 152, 467–478 (2013). Medline

doi:10.1016/j.cell.2013.01.011

31. P. Wang, Y. Gu, Q. Zhang, Y. Han, J. Hou, L. Lin, C. Wu, Y. Bao, X. Su, M. Jiang, Q.

Wang, N. Li, X. Cao, Identification of resting and type I IFN-activated human NK cell

miRNomes reveals microRNA-378 and microRNA-30e as negative regulators of NK cell

cytotoxicity. J. Immunol. 189, 211–221 (2012). Medline doi:10.4049/jimmunol.1200609

32. S. Xu, X. Liu, Y. Bao, X. Zhu, C. Han, P. Zhang, X. Zhang, W. Li, X. Cao, Constitutive

MHC class I molecules negatively regulate TLR-triggered inflammatory responses via

the Fps-SHP-2 pathway. Nat. Immunol. 13, 551–559 (2012). Medline

doi:10.1038/ni.2283

33. J. D. Keene, J. M. Komisarow, M. B. Friedersdorf, RIP-Chip: The isolation and identification

of mRNAs, microRNAs and protein components of ribonucleoprotein complexes from

cell extracts. Nat. Protoc. 1, 302–307 (2006). Medline doi:10.1038/nprot.2006.47

34. F. Allantaz, D. T. Cheng, T. Bergauer, P. Ravindran, M. F. Rossier, M. Ebeling, L. Badi, B.

Reis, H. Bitter, M. D’Asaro, A. Chiappe, S. Sridhar, G. D. Pacheco, M. E. Burczynski, D.

Hochstrasser, J. Vonderscher, T. Matthes, Expression profiling of human immune cell

subsets identifies miRNA-mRNA regulatory relationships correlated with cell type

specific expression. PLOS ONE 7, e29979 (2012). Medline

doi:10.1371/journal.pone.0029979

35. M. C. Tsai, O. Manor, Y. Wan, N. Mosammaparast, J. K. Wang, F. Lan, Y. Shi, E. Segal, H.

Y. Chang, Long noncoding RNA as modular scaffold of histone modification complexes.

Science 329, 689–693 (2010). doi:10.1126/science.1192002

36. L. Kong, Y. Zhang, Z.-Q. Ye, X.-Q. Liu, S.-Q. Zhao, L. Wei, G. Gao, CPC: Assess the

protein-coding potential of transcripts using sequence features and support vector

machine. Nucleic Acids Res. 35 (suppl. 2), W345–W349 (2007). Medline

doi:10.1093/nar/gkm391

37. R. E. Thurman, E. Rynes, R. Humbert, J. Vierstra, M. T. Maurano, E. Haugen, N. C.

Sheffield, A. B. Stergachis, H. Wang, B. Vernot, K. Garg, S. John, R. Sandstrom, D.

Bates, L. Boatman, T. K. Canfield, M. Diegel, D. Dunn, A. K. Ebersol, T. Frum, E. Giste,

A. K. Johnson, E. M. Johnson, T. Kutyavin, B. Lajoie, B. K. Lee, K. Lee, D. London, D.

Lotakis, S. Neph, F. Neri, E. D. Nguyen, H. Qu, A. P. Reynolds, V. Roach, A. Safi, M. E.

Sanchez, A. Sanyal, A. Shafer, J. M. Simon, L. Song, S. Vong, M. Weaver, Y. Yan, Z.

Zhang, Z. Zhang, B. Lenhard, M. Tewari, M. O. Dorschner, R. S. Hansen, P. A. Navas,

G. Stamatoyannopoulos, V. R. Iyer, J. D. Lieb, S. R. Sunyaev, J. M. Akey, P. J. Sabo, R.

Kaul, T. S. Furey, J. Dekker, G. E. Crawford, J. A. Stamatoyannopoulos, The accessible

chromatin landscape of the human genome. Nature 489, 75–82 (2012). Medline

doi:10.1038/nature11232

38. M. B. Gerstein, A. Kundaje, M. Hariharan, S. G. Landt, K. K. Yan, C. Cheng, X. J. Mu, E.

Khurana, J. Rozowsky, R. Alexander, R. Min, P. Alves, A. Abyzov, N. Addleman, N.

Bhardwaj, A. P. Boyle, P. Cayting, A. Charos, D. Z. Chen, Y. Cheng, D. Clarke, C.

Eastman, G. Euskirchen, S. Frietze, Y. Fu, J. Gertz, F. Grubert, A. Harmanci, P. Jain, M.

Kasowski, P. Lacroute, J. Leng, J. Lian, H. Monahan, H. O’Geen, Z. Ouyang, E. C.

Partridge, D. Patacsil, F. Pauli, D. Raha, L. Ramirez, T. E. Reddy, B. Reed, M. Shi, T.

Slifer, J. Wang, L. Wu, X. Yang, K. Y. Yip, G. Zilberman-Schapira, S. Batzoglou, A.

Sidow, P. J. Farnham, R. M. Myers, S. M. Weissman, M. Snyder, Architecture of the

human regulatory network derived from ENCODE data. Nature 489, 91–100 (2012).

Medline doi:10.1038/nature11245