Supplementary Material for:

The BLUF-EAL protein YcgF acts as a direct anti-repressor in a

blue light response of Escherichia coli

Natalia Tschowri, Susan Busse and Regine Hengge

Institut für Biologie, Mikrobiologie, Freie Universität Berlin, 14195 Berlin, Germany

Supplementary Material and Methods

Construction of plasmids and chromosomal lacZ fusions

The primers used for plasmid constructions are listed in Table S2 (see below). pYaiC, pYhjH,

pYcgZ, pYmgA, pYmgB, pYmgC and p(YcgZ+YmgAB) are derivatives of pCAB18

(Barembruch and Hengge 2007), which is a tac promoter expression plasmid based on the

low copy number vector pACYC184 (Chang and Cohen 1978). For in-vitro interaction

assays, ycgE and the ycgE regions encoding the N-terminal MerR-like domain and the C-

terminal domain of YcgE were cloned onto pET32a (Novagen), which results in the

expression of TRX-His6-S-tagged proteins that can be used for affinity chromatography on S-

protein agarose (Novagen) as previously described (Becker et al. 1999). For in-vitro

interaction experiments as well as for in-vitro determination of PDE activity, YcgF, the N-

terminal BLUF domain of YcgF, and the mutated variant YcgFI193L/Q195R were expressed from

a pQE30Xa (Qiagen) derivative, which also carried the lacIq gene inserted at the XbaI site.

The point mutations in YcgFI193L/Q195R were generated using a four-primer/two-step PCR

protocol (Germer et al. 2001). For DNA gel retardation experiments, tag-free YcgE was

obtained using pTYB12 (New England Biolabs), which is an E.coli cloning and expression

vector used in the IMPACTTM Protein Purification System, which allows overexpression of a

target protein as a fusion to a self-cleavable intein tag.

The primers used to construct lacZ fusions are also listed in Table S2. In order to construct

single copy lacZ reporter fusions to ycgF, ycgE and ycgZ, the appropriate PCR fragments

(depending on the chromosomal context of the specific genes) were cloned into the lacZ

fusion vector pJL28 as previously described (Weber et al. 2006). For ycgE (which is located

downstream of ycgF on the same DNA strand of the chromosome), two fusions were

constructed, with both containing the entire ycgF coding region upstream, but only one also

Tschowri et al. (Supplement) 2

including the entire ycgF promoter region. Both ycgE::lacZ fusions showed very similar

expression, indicating that the ycgF promoter region does not contribute to ycgE expression,

which is consistent with our identification of independent transcriptional start sites of the two

genes (located 30 and 54 nucleotides upstream of the ycgF and ycgE open reading frames,

respectively; our unpublished data). In the ycgE::lacZ expression experiments presented in

this study, the shorter fusion (not including the ycgF promoter region) is shown. All lacZ

reporter fusions were transferred to the att(λ) location of the chromosome via phage λRS45 or

λRS74 (Simons et al. 1987). Single lysogeny was tested by a PCR approach (Powell et al.

1994). The single copy csgB::lacZ fusion was constructed in the same way and was described

earlier (Weber et al. 2006).

Protein purification

N-terminally His6-tagged YcgF and YcgF-NTD (i.e. the BLUF domain) were purified from

pQE30Xa-derived plasmids. Strains were grown in LB/ampicilline at 37oC to an OD578 of 0.7,

IPTG (1 mM) was added and incubation continued overnight at 16oC. Cells were harvested

and proteins were purified according to a standard protocol (QIAexpressionist manual;

Qiagen) and dialyzed in 50 mM Tris-HCl, pH 7.5, 250 mM NaCl and 50 % glycerol. TRX-

His6-S-tagged YcgE as well as the YcgE-NTD and YcgE-CTD with the same N-terminal tag

were purified from pET32a-derived plasmids in strain BL21(DE3). For the full-size YcgE

protein, cells were grown in LB/ampicilline at 30oC to an OD578 of 0.6 and 3 % ethanol was

added. After 30 min, 0.3 mM IPTG was added and cells were further incubated at 25oC for 90

min before harvesting. For the YcgE domains, cells were grown at 37oC to an OD578 of 0.7,

0.5 mM IPTG was added and incubation was continued at 16oC for 8 hours. Purification of

the TRX-His6-S-tagged proteins was similar as for the His6-tagged proteins (see above).

YcgE with a free N-terminus could not be purified from a standard overexpression vector

(pQE60) without picking up point mutations at least in the N-terminal DNA-binding helix.

Therefore, YcgE was purified from pTYB12 as a fusion to self-cleavable intein. For

overproduction, strain ER2566 (New England Biolabs) carrying the YcgE/intein-encoding

plasmid was grown in LB/ampicilline at 37oC to an OD578 of 0.7, IPTG (0.3 mM) was added

and cells were further incubated at 16oC for 16 hours. The fusion protein was purified

according to the manufacturer´s protocol (New England Biolabs) in the presence of protease

inhibitors (protease-inhibitor cocktail tablets; Roche). Autoproteolysis of the fusion protein

followed by elution of YcgE was triggered by adding 50 mM DTT to the purification column.

The protein was dialyzed as YcgF (see above).

Tschowri et al. (Supplement) 3

References

Barembruch, C. and Hengge, R. 2007. Cellular levels and activity of the flagellar sigma factorFliA of Escherichia coli are controlled by FlgM-modulated proteolysis. Mol.Microbiol. 65: 76-89.

Becker, G., Klauck, E., and Hengge-Aronis, R. 1999. Regulation of RpoS proteolysis inEscherichia coli: The response regulator RssB is a recognition factor that interactswith the turnover element in RpoS. Proc. Natl. Acad. Sci. USA 96: 6439-6444.

Chang, A.C.Y. and Cohen, S.N. 1978. Construction and characterization of amplifiablemulticopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J.Bacteriol. 134: 1141-1156.

Germer, J., Becker, G., Metzner, M., and Hengge-Aronis, R. 2001. Role of activator siteposition and a distal UP-element half-site for sigma factor selectivity at a CRP/H-NSactivated σS-dependent promoter in Escherichia coli. Mol. Microbiol. 41: 705-716.

Powell, B.S., Court, D.L., Nakamura, Y., Rivas, M.P., and Turnbough Jr., C.L. 1994. Rapidconfirmation of single copy lambda prophage integration by PCR. Nucl. Acids Res.22: 5765-5766.

Simons, R.W., Houman, F., and Kleckner, N. 1987. Improved single and multicopy lac-basedcloning vectors for protein and operon fusions. Gene 53: 85-96.

Weber, H., Pesavento, C., Possling, A., Tischendorf, G., and Hengge, R. 2006. Cyclic-di-GMP-mediated signaling within the σS network of Escherichia coli. Mol. Microbiol.62: 1014-1034.

Tschowri et al. (Supplement) 4

Supplementary Tables

Table S1. YcgE-controlled genes.

Genome-wide transcriptional profiling on microarrays was performed for strain MC4100 incomparison to its otherwise isogenic ycgE::cat derivative. Strains were grown in LB at 28oCand cells were harvested at an OD578 of 4.0. Experimental details were exactly as previouslydescribed in the supplementary material to Pesavento, C., Becker, G., Sommerfeldt, N.,Possling, A., Tschowri, N., Mehlis, A., and Hengge, R. 2008. Genes Dev. 22: 2434-2446. Fordata analysis, see Materials and Methods. Genes affected are listed according to their b-numbers (reflecting position on the E.coli chromosome) and a short description of themolecular or physiological functions of the gene products is added.

Gene b-number protein function YcgE dependenceratio: ycgE-/ycgE+

_________________________________________________________________________

yliL b0816 unknown 6.61ycgZ b1164 unknown 22.54ymgA b1165 unknown 12.61ymgB b1166 biofilm/acid tolerance modulator 10.72ymgC b1167 unknown 11.22ynaK b1365 unknown 6.08gadB b1493 glutamate decarboxylase B 3.29hdeB b3509 periplasmic acid stress chaperone 3.62

Table S2. Oligonucleotide primers used in the present study.

I. Primers used for generating knockout mutations by one-step inactivation:

ycgF::kan 5´-GATATGTCTGTTACCGTCTTACTCTCGCCTCACCCATTACCCTGGATTGGTGTAGGCTGGAGCTGCTTC-3´5´-CCTGCGCCAAAATGATCAATTGCTACACTGATACCAGCAGCCTTTAGCGCATATGAATATCCTCCTTAG-3´

ycgE::cat 5´- ATTGTACAAAGTATTATTGGGTCGTGTACAGGCGACGGAGATTTGTGACCGTGTAGGCTGGAGCTGCTTC-3´5´- TGTGGGTTCAGATTATAACATTCTGTCTAAGGGGCGGGATAAAGGTGAACATATGAATATCCTCCTTAG-3

Δ(ycgZ-ymgAB)::cat

5´-CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGGTGTAGGCTGGAGCTGCTTC-3’5´-GAAGTTACATATCATCAGCTGTGTATCGCAACACGATTTCCAGTGTTTTTCCATATGAATATCCTCCTTAG-3’

ymgB::kan 5´-CCATGCTTGAAGATACTACAATTCATAATGCAATAACTGATGAAGCGTTAGTGTAGGCTGGAGCTGCTTC-35´-AAGTTACATATCATCAGCTGTGTATCGCAACACGATTTCCAGTGTTTTTCATTCCGGGGATCCGTCGACC-3´

Tschowri et al. (Supplement) 5

TTTCATTCCGGGGATCCGTCGACC-3´rcsB::kan 5´-CAGTTATGTCAAGAGCTTGCTTAGCAAGGTAGCCTATTACGTGTA

GGCTGGAGCTGCTTC-3´5´-GCCAGATAAGACACTAACGCGTCTTATCTGGCCTACAGGTGACATATGAATATCCTCCTTAG-3´

II. Primers used for generating lacZ gene fusions on pJL28:

ycgF-EcoRI 5’-CGGAATTCGTAACGAGTGATTGCTCCCGCAGAATC-3’ycgF-HindIII 5’-CGTGACAAGCTTCAGGTTCGTCGTCACGTATATGGC-3’ycgE-EcoRI 5’-CGGAATTCCGTAGCCATATACGTGACGACGAAC-3’ycgE-HindIII 5’-CGTGACAAGCTTCGCAACGTTCAGCAACATCACC-3’ycgZ-EcoRI1 5’-CGGAATTCGACAGGTTCGTCGTCACGTATATGGC-3’ycgZ-HindIII2 5’-CGTGACAAGCTTGAGTGATTGCTCCCGCAGAATC-3’bdm-EcoRI 5´-CGGAATTCCGCCTTCCCAGTGTGCCTG-3bdm-HindIII 5´-CGTGACAAGCTTCCAGAGCGGGTTCTGCTGTTG-3

III. Primers used for cloning into pCAB18:

yaiC-EcoRI 5’- CGGAATTCTAAGGAGGTTCTGAATGTTCCCAAAAATA -3’yaiC-HindIII 5’- CGTAAGCTTTCAGGCCGCCACTTCGGTG -3’yhjH-EcoRI 5’-CGGAATTCAAGGAGGACTGAGATGATAAGGCAGG-3’yhjH-HindIII 5’-GCAGAAGCTTTCTGGTTGATAGTCGGTTTGAGTC-3’ycgZ-EcoRI 5’-CGGAATTCAGGAGGTACTGAGATGCATCAAAATTCAGTGACT

TTAG-3’ycgZ-HindIII 5’-CGTAAGCTTTCATTCAAAAAGCAACCCAATTAGTGC-3’ymgA-EcoRI 5’-CGGAATTCAGGAGGTACTGAGATGAAGACATCTGATAATGAACG-3’ymgA-HindIII 5’-CGTAAGCTTTCAATGTATTCTGTTTATTTTCTTACCATTG-3’ymgB-EcoRI 5’-CGGAATTCAGGAGGTACTGAGATGCTTGAAGATACTACAATTC-3’ymgB-HindIII 5’-CGTAAGCTTTCACATATCATCAGCTGTGTATCGC-3’ymgC- EcoRI 5’-CGGAATTCAGGAGGTACTGAGATGAATAATTCAATCCCAGAGAG-3’ymgC-HindIII 5’-CGTAAGCTTTCACTAAGAGAGCACGGATTCCCTG-3’ycgZymgAB-EcoRI

5’-CGGAATTCAGGAGGTACTGAGATGCATCAAAATTCAGTGACTTTAG-3’(identical to ycgZ-EcoRI)

ycgZymgAB-HindIII

5’-CGTAAGCTTTCACATATCATCAGCTGTGTATCGC-3’(identical to ymgB-HindIII)

IV. Primers used for cloning into pET32a:

ycgE-NcoI 5’-CGGCCATGGCTTATTACAGCATTGGTG-3’ycgE-EcoRI 5’-CGGAATTCTCAGGGGGCATGAAAGATG-3’ycgE-NcoI(NTD)

5’-CGGCCATGGCTTATTACAGCATTGGTG-3’(identical to ycgE-NcoI)

ycgE-EcoRI(NTD)

5’-CGGAATTCTCAGCGGGAGGTGTTGTGATCAAG-3’

1 Also used to generate the PCR fragment carrying the ycgZ promoter region used for the gel retardation assaywith purified YcgE/YcgF (Figs. 3 and S3).2 Also used to generate the PCR fragment carrying the ycgZ promoter region used for the gel retardation assaywith purified YcgE/YcgF (Figs. 3 and S3).

Tschowri et al. (Supplement) 6

(NTD)ycgE-NcoI(CTD)

5’-CGGCCATGGATACGGAAGATGACTGGAGCCGC-3’

ycgE-EcoRI(CTD)

5’-CGGAATTCTCAGGGGGCATGAAAGATG-3’(identical to ycgE-EcoRI)

V. Primers used for cloning into pQE30Xa-LacIq:

ycgF-Phos 5’-Phos-ATGCTTACCACCCTTATTTATC-3’ycgF-HindIII 5’-GACAAGCTTTTATTTTTTCTCTGGCCACGCTATG-3’ycgF-Phos(NTD)

5’-Phos-ATGCTTACCACCCTTATTTATC-3’(identical to ycgF-Phos)

ycgF-HindIII(NTD)

5’-CGTGACAAGCTTGGTTGATTGTTCGGTTGCAAG-3’

VI. Primers used for mutagenesis of ycgF:

ycgF-I193L/Q195R-forward

5’-GAAGCCCTGGTGCGTAAAAATG-3’

ycgF-I193L/Q195R-reverse

5’-CATTTTTACGCACCAGGGCTTC-3’

VII. Primers used for cloning ycgE into the intein vector pTYB12:

ycgE-NdeI 5’-GGTGGTCATATGGTGGCTTATTACAGCATTGG-3’ycgE-EcoRI 5’-CGGAATTCTCAGGGGGCATGAAAGATG-3’

(identical to ycgE-EcoRI used for cloning into pET32a)

VIII. Primers used for generating ycgZ probes (for Northern blot analysis and the ycgZcoding region DNA fragment used for gel retardation assays):

ycgZ-forward 5’-GCATACTCAGCAGGAAACTCTC -3’ycgZ -reverse 5’-TTATTCAAAAAGCAACCCAATTAG -3’

Tschowri et al. (Supplement) 7

Supplementary Figures

Figure S1. Sequence alignment of EAL domains and degeneration of key amino acidpositions in the YcgF EAL domain.RocR from Pseudomonas aeruginosa (Rao et al. 2008. J. Bacteriol. 190: 3622-3631) and thethree E.coli proteins Dos (Takahashi and Shimizu. 2006. Chem. Lett. 35: 970-971), YahA(Schmidt et al. 2005. J. Bacteriol. 187: 4774-4781), and YciR (Weber et al. 2006. Mol.Microbiol. 62 : 1014-1034) are experimentally demonstrated c-di-GMP-specificphosphodiesterases. Specific roles in c-di-GMP and Mg2+ binding as well as in catalysis havebeen assigned to conserved amino acids using RocR as a model system (Rao et al. 2008. J.Bacteriol. 190: 3622-3631). YcgF is characterized by a BLUF domain preceeding the EALdomain and YcgF sequences are available for Bordetella avium, Alteromonas macleodii,Klebsiella pneumoniae, Enterobacter sakazakii and E.coli.Consistent with our finding that the E.coli YcgF is unable to bind or cleave c-di-GMP (seeFig. S2 below), it lacks all four amino acids involved in c-di-GMP binding, 2/8 amino acidsinvolved in Mg2+ binding and an essential catalytic glutamate residue. By contrast, in the EALdomain of YcgF in B. avium and A. macleodii, all but one of these key residues in YcgF areconserved suggesting that in these bacteria, which actually do not have YcgE, YcgF is activeas a blue light-regulated PDE. The YcgF proteins of K. pneumoniae and E. sakazakii (whichdo possess YcgE) represent the intermediate situation between the two extremes. Whetherthese YcgF variants still have PDE activity, will have to be shown by future experiments.Interestingly, K. pneumoniae does not have the ycgZ-ymgABC genes at all, whereas E.sakazakii features ycgZ-ymgBA, but not ymgC at the same chromosomal position as E.coli.

Tschowri et al. (Supplement) 8

Figure S2. Purified YcgF protein does not degrade or bind c-di-GMP.A: Phosphodiesterase assay with radiolabeled c-di-GMP. YcgF, the mutant variant YcgFI193L/Q195R and the known c-di-GMP phosphodiesterase YhjH were purified as describedabove. Radiolabeled c-di-GMP was prepared and the phosphodiesterase assay was performedexactly as described by Pesavento, C., Becker, G., Sommerfeldt, N., Possling, A., Tschowri,N., Mehlis, A., and Hengge, R. 2008. Genes Dev. (in press). The reaction was allowed toproceed for 60 min either in the presence of blue light irradiation or in the dark. Co, protein-free control.B: Detection of c-di-GMP binding by UV-crosslinking. The same purified proteins as in (A)as well as the mutationally activated diguanylate cyclase PleD* were incubated withradiolabeled c-di-GMP and UV-crosslinked exactly as described previously (Christen, M.,Christen, B., Allan, M.G., Folcher, M., Jenö, P., Grzesiek, S., and Jenal, U. 2007. Proc. Natl.Acad. Sci. USA 104: 4112-4117). Note that PleD* binds c-di-GMP via its allosterically actingI-site (Christen, B., Christen, M., Paul, R., Schmid, F., Folcher, M., Jenoe, P., Meuwly, M.,and Jenal, U. 2006. J. Biol. Chem. 281: 32015-32024). YhjH, which binds c-di-GMP at itsenzymatically active center, corresponds to the lower strongly labeled band. Neither wildtypeYcgF nor the “improved EAL“-variant of YcgF show any cross-linking to c-di-GMP (yet, thesame preparation of YcgF interacted with YcgE, i.e. is biologically active in vivo; see Figs. 2and 3).

Tschowri et al. (Supplement) 9

Figure S3. Strong induction of an active diguanylate cyclase, YaiC, or an active c-di-GMPphosphodiesterase, YhjH, does not affect the expression of ycgZ.MC4100 containing the single copy ycgZ::lacZ fusion was transformed with derivatives ofthe tac promoter expression plasmid pCAB18 (see above) carrying either yaiC (A) or yhjH(B). Strains were grown in LB/ampicilline at 28oC and 1 mM IPTG was added at an OD578 of0.6. OD578 (open symbols) and specific β-galactosidase activities (closed symbols) weredetermined along the growth curve.Note that YaiC and YhjH expressed from these plasmids are biologically active, as thepresence of pCAB18-yaiC interferes with motility, and pCAB18-yhjH restores motility of ayhjH mutant (data not shown).

Tschowri et al. (Supplement) 10

Figure S4. Purified YcgE directly and specifically binds to the ycgZ promoter region.For electrophoretic mobility shift experiments, DNA fragments containing either the ycgZpromoter region (ycgZp, 407 bp) or the ycgZ coding region (ycgZcod, 237 bp) were prepared byPCR, incubated with purified YcgE protein at the concentrations indicated and run on anagarose gel (for details, see Material and Methods). BSA, bovine serum albumin.

Figure S5. At low temperature, blue light irradiation can reduce the growth rate of E.coli.Strain MC4100 was grown in LB at the temperatures indicated. The cultures were either bluelight irradiated or kept in the dark and the OD578 was monitored along the entire growthcurves.

Tschowri et al. (Supplement) 11

Figure S6. Blue light irradiation at 16oC reduces growth but is not bactericidal.Strain MC4100 as well as its rpoS and rcsB mutant derivatives were grown in LB to an OD578

of 0.7, where the cultures were shifted to 16oC and split in two aliquots, that were either bluelight irradiated or kept in the dark. Survival of blue light-irradiated cells after the timesindicated was monitored by determining colony forming units (per ml) and is expressed as afraction of cells surviving in the dark. Reduced colony forming units after long-term exposureto blue light (21 hours) reflects slower growth rate, i.e. lower optical density in the irradiatedculture.