SUPPLEMENTARY INFORMATION Aline M. Santos Marin … · non-induced (NI) or induced (I) fractions of...

$: SUPPLEMENTARY INFORMATION Aline M. Santos Marin … · non-induced (NI) or induced (I) fractions of the constructions encoding the His-FERM ... Coomassie-blue of the proteins from$
SUPPLEMENTARY INFORMATION

FERM domain interaction with myosin negatively regulates FAK in

cardiomyocyte hypertrophy

Aline M. Santos1,2, Deborah Schechtman3, Alisson C. Cardoso1,2, Carolina F.M.Z. Clemente2; Júlio C. Silva2,4, Mariana Fioramonte5, Michelle B. M. Pereira1,2, Talita M. Marin1,2, Paulo S. L. Oliveira2, Ana Carolina M. Figueira2, Saulo H.P. Oliveira2, Íris L. Torriani2,4, Fábio C. Gozzo5, José Xavier Neto2 and Kleber G. Franchini1,2*. 1Department of Internal Medicine, School of Medicine, University of Campinas, Campinas, SP, Brazil; 2Brazilian National Laboratory for Biosciences, Brazilian Association for Synchrotron Light Technology, Campinas, SP, Brazil; 3Department of Biochemistry, Chemistry Institute, University of São Paulo, São Paulo, SP, Brazil. 4 Physics Institute “Gleb Wataghin”, University of Campinas, Campinas, SP, Brazil 5Chemistry Institute, University of Campinas, Campinas, SP, Brazil

*To whom correspondence should be addressed. E-mail: [email protected]

Nature Chemical Biology: doi:10.1038/nchembio.717

SUPPLEMENTARY RESULTS

Supplementary Figure 1. Identification of the cross-linked peptides on the interface of the FERM-Myosin complex. (a) Coomassie-blue stained SDS-PAGE of non-induced (NI) or induced (I) fractions of the constructions encoding the His-FERM (FAK FERM domain; 47 kDa) and the His-MYO (myosin fragment; 24 kDa) recombinant proteins expressed in BL21DE3. The arrowheads indicate the corresponding bands. (b-c) Coomassie-blue stained SDS-PAGE of FERM and myosin recombinant proteins co-purified by affinity and size exclusion chromatography, respectively. (d) Shifted band (arrowhead) in SDS-PAGE of the FERM-myosin complex obtained after addition of the cross linker reagent (DSS). (e-f) MS/MS spectrum of DSS cross-linked peptides (CLP-1 and CLP-2) from FERM-myosin complex.


Supplementary Figure 2. Electrostatic and ribbon surface representation of the FERM FAK domain. (a) Electrostatic surface representation of the FERM domain (red: negative charges, blue: positive charges, gray: neutral). The lysines of the cross-linked peptides identified by MS/MS are indicated by arrowheads (K110 and K255). (b) Ribbon representation of the FERM domain. The cross-linked peptide 1 (CLP-1) is located in the F1 subdomain and the cross-linked peptide 2 (CLP-2) in the F3 subdomain surface. The side chains of the cross-linked peptides are shown by sticks (yellow). The lysines that interacted with the DSS are indicated.


Supplementary Figure 3. Structural and molecular docking analysis of the FERM-myosin complex based on SAXS data. (a) Pair distances distribution function p(r) of the complex FERM-myosin obtained from the experimental X-ray scattering data (SAXS) using the program GNOM. (b) Experimental scattering curve of the complex FERM-myosin (open circle). The magenta solid line represents the theoretical scattering calculated from the model. (c) Evaluation of docking results using the solution scattering profile from the complex FERM-myosin presenting the three docking models (GRAMM-X) most compatible with the SAXS experimental.


Supplementary Figure 4. Analyses of the structural localization and conservation of the FAK158-166 sequence and affinity of the FP-1 peptide to myosin. (a) Localization of the FAK158-166 sequence on the surface of the FERM domain. (b) Sequence alignment of FERM F2 subdomains of distinct proteins and sequence alignment of the FAK FERM F2 subdomain of various species. The FAK158-166 sequence is indicated (c) Model of the FERM domain with the mutated amino acid residues represented by sticks. (d) Model of the FERM-Myosin complex with the mutated residues R1843 and K1844 of the myosin coiled coil represented by sticks. (e) Fluorescence polarization curve of myosin binding to fluorescence FP-1 peptide (5&6 carboxyfluorescein-EIADQVDQE). P<0.003. Data represent mean ± s.e.m. of six independent experiments. (f) Fluorescence polarization curve presenting no interaction between myosin and fluorescence FP-1-MUT peptide (5&6 carboxyfluorescein-AIADAVAQA).


Supplementary Figure 5. FAK FERM domain interacts with native myosin. (a) Dot blots of purified myosin spotted onto nitrocellulose membranes and immunoblotted as indicated. (b) Coomassie-blue of the proteins from whole extracts of adult rat ventricular myocytes that precipitated with the FAK FERM domain coupled to metal affinity beads. Myosin was scored 427 in the MS/MS analysis. (c) Anti-FAK immunoblot of NRVMs transfected with Myc-FAK wild type (pRc/CMV-FAK; 2µg; 48 hours) and myc-FAK-MUT-1 (pRc/CMV-FAK-E158A/D161A/Q162A; 2µg; 48 hours). (d). Anti-myosin immunoblot of anti-myc-tag immunoprecipitated from extracts of NRVMs transfected with myc-FAK and myc-FAK-MUT-1. (e). Anti-pY397-FAK immunoblot of anti-myc-tag immunoprecipitated from extracts of NRVMs transfected with myc-FAK and myc-FAK-MUT-1. (f) Anti-pY397-FAK and anti-FAK immunoblots of extracts from non-stretched NRVMs treated with RNAi against the indicated targets. The membranes were striped and immunoblotted with anti-FAK antibody as loading control.


Supplementary Figure 6. Myosin depletion by RNAi in NRVM. (a) Anti-FAK and anti-GAPDH immunoblots of extracts from non-stretched NRVMs control or treated with RNAi direct against GFP or Myosin. Bar graphics shows the densitrometric readings of the immunoblots as indicated. Data represent mean ± s.e.m. of six independent experiments. † p < 0.05 versus siGFP. (b) Immunofluorescence of non-stretched NRVMs treated with the RNAi direct against the indicated targets. Immunofluoresce was performed using rhodamine-conjugated phalloidin (left) or anti-myosin heavy chain primary antibody and Alexa568-conjugated goat anti-mouse secondary antibody (right). (n=6 cultures). The scale bar represents 10 µm.


Supplementary Figure 7. Activation of FAK with phenylephrine does not affect FAK-myosin association. (a) Anti-FAK and anti-pY397-FAK immunoblots of total extracts from non-treated (CT) or treated NRVMs with phenylephrine for 30 and 60 min. Bar graph shows the densitometric readings of anti-pY397-FAK immunoblots normalized to FAK. # p< 0.05 versus Control (CT). (b) Anti-myosin immunoblots of myosin imunoprecipitated with anti-FAK from NRVMs non-treated or treated with phenylephrine. Bar graph shows the densitometric readings of anti-myosin immunoblots normalized to FAK. The membranes were striped and immunoblotted with anti-FAK antibody as loading control.


Supplementary Figure 8. Detection of FP-1 peptide in NRVMs cells by MS/MS. (a). MS spectra of the purified peptides from control NRVMs. (b). MS spectra of the purified peptides from FP-1-TAT treated NRVMs. The arrow indicates the FP-1 precursor ion of m/z 558.4 (5+). (c). MS/MS spectra from the ions of m/z 558.4 (5+) of the peptides fraction from NRVMs treated with 10µM of FP-1. (d) MS/MS spectra from the ions of m/z 558.4 (5+) of the synthesized FP-1 peptide.


Supplementary Figure 9. Representative immunoblots of Figure 6. (a) Anti-pY397-FAK and anti-FAK immunoblots of non-stretched or stretched (10-60 min) NRVM (upper) and anti-myosin and anti-FAK immunoblots of anti-FAK immunoprecipitated from non-stretched or stretched NRVMs extracts (lower). (b) Anti-pY397-FAK and anti-FAK immunoblots of extracts from non-stretched or stretched (60 min) NRVMs treated with RGE (10µM) or RGD (10µM) (upper) and anti-myosin immunoblots of anti-FAK immunoprecipitated from extracts of non-stretched or stretched (60 min) NRVMs treated with RGE (10µM) or RGD (10µM) (lower). (c) Anti-myosin immunoblots of anti-FAK immunoprecipitated from control (CT) NRVMs or NRVMs treated for 2 hours with FP-1-TAT (1µM), FP-1-MUT-TAT (1µM) or FP-2-TAT (1µM) peptides (upper) and anti-pY397-FAK immunoblot of control (CT) NRVMs or NRVMs treated with FP-1-TAT (1µM), FP-1-MUT-TAT (1µM) or FP-2-TAT (1µM) peptides (lower). (d) Anti-pY397-FAK immunoblot of NRVMs treated with increasing concentration of FP-1-TAT (0.5, 0.75, 1.0µM). The membranes were striped and immunoblotted with anti-FAK antibody as loading control.


Supplementary Figure 10. Treatment with FP-1 does not regulate FAK association with membrane receptors in NRVMs. The upper panel shows the anti-β-Integrin, anti-EGFR, anti-MET and anti-FAK (as probe) immunoblots of anti-FAK immunoprecipitated from extracts of NRVMs control or treated for 2 hours with FP-1-TAT (1µM) or FP-1-MUT-TAT (1µM) peptides. The lower panel shows immunoblottings of the control and treated NRVMs lysates.


Supplementary Figure 11. Treatment with FP-1-TAT or FAK overexpression induces hypertrophic growth of NRVMs. (a) Non-treated (Control) or treated NRVMs with FP-1-TAT peptide (1 µM; 12 and 24 hours). (b) Treated NRVMs with siRNA against GFP, FAK and/or concomitantly with the FP-1-TAT peptide. (c) Non-treated (control) or Myc-FAK (pRc/CMV-FAK; 2µg; 48 hours) treated NRVMs. (d) Treatment with rapamycin abolished the NRVM hypertrophy induced by prolonged (24 hours) treatment with FP-1. Non-treated (Control) or treated NRVMs with FP-1-TAT peptide (1 µM; 24 hours) or FP-1-TAT peptide (1 µM; 24 hours) plus rapamycin (20nM; 24 hours). Immunofluorescence was performed using anti-myosin heavy chain primary antibody and Alexa568-conjugated goat anti-mouse secondary antibody. The scale bar represents 10 µm.


Supplementary Figure 12. Representative immunoblots of Figure 7. (a) Anti-FAK and anti-GAPDH immunoblots of extracts from non-stretched NRVMs treated with the RNAi directed against the indicated targets and/or with FP-1-TAT peptide. (b) Anti-FAK immunoblots of anti-FAK immunoprecipitated (upper) and anti-pY397-FAK and anti-FAK immunoblots (lower) of total extracts from control and transfected NRVMs with Myc-FAK (pRc/CMV-FAK; 2µg; 48 hours). (c) Anti-pY397-FAK and anti-FAK, anti-pAKT (Ser473) and anti-AKT, anti-pTSC (Thr1462) and anti-TSC and anti-pS6K (Thr389) and anti-S6K immunoblots of extracts from control (CT) NRVMs or NRVMs treated with FP-1-TAT or FP-1-TAT and rapamycn (RPM).


Supplementary Figure 13. Uncropped immunoblots. (a) Figure 1. (b) Figure 3. (c) Figure 4. (d) Figure 5. (e) Figure 6. (f) Figure 7.


Supplementary Figure 13 continued.


SUPPLEMENTARY METHODS

Pull-down assay. GST-MYO was incubated with full length recombinant human FAK

(FL-FAK) (Biosource, USA), phosphorylated FL-FAK with ATP (purity > 95%,

Sigma-Aldrich), FL-FAK with ATP and PF 573228 (purity > 95%, Sigma-Aldrich) His-

FERM-WT or His-FERM mutants as indicated (see results). GST-FERM, GST-

KINASE or GST-cTERM was incubated with the myosin fragment or total extracts

from NRVMs. GST-FERM was also incubated with the mutant of the myosin sequence

(MYO-MUT). The precipitated pellets from the various assays were resolved on SDS-

PAGE and the membranes immunoblotted with anti-myosin heavy chain (Abcam), anti-

FAK-c-20 (Santa Cruz Biotechnology), anti-FAK-A17 (Santa Cruz Biotechnology) or

anti-6his-tag antibodies (Abcam) antibodies. His-pull-down was performed with His-

FERM previously purified linked by affinity in nickel-nitrilotriacetic acid-agarose

(Qiagen) metal affinity beads and then incubated with extract from adult

cardiomyocytes. The proteins that remained linked to the pellet were identified by liquid

chromatography tandem mass spectrometry (LC-MS/MS) analysis as previously

described1.

In vitro kinase assay. Experiments were performed with FL-FAK (3 µg) incubated with

recombinant GST-MYO (1:1, 2:1 or 4: 1 molar ratios) or GST (1:1 molar ratio) at 37oC

for 4 hours. Kinase buffer (4.5 µL) and ATP (100 µM) were added to the mixture. The

protein was applied on a nitrocellulose membrane that was incubated with an anti-

pFAK-Try 397 antibody (Invitrogen) and [I125] Protein A.

Myosin binding assay. Purified myosin was resuspended in buffer I (50mM KCl, 5mM

NaH2PO4, pH 7.0) and 0.5-2.0µg of this solution was spotted onto nitrocellulose


membrane strips. The individual strips were incubated with distinct constructs

(GST-FERM, GST-KINASE, GST-cTERM) or GST. The strips were incubated with

monoclonal anti-GST, anti-FAK N-terminal or anti-FAK C-terminal antibodies (Santa

Cruz Biotechnology) and with 5µCi [I125] Protein A (30µCi/µg).

Myosin purification. Cardiac myosin was extracted and purified from neonatal rat

ventricles, according to a previously described protocol2.

SAXS analysis. The measurements were performed with a monochromatic X-ray beam

with a wavelength of λ=1.488A. The X-ray patterns were recorded using a two-

dimensional position-sensitive MARCCD detector. Two sample-to-detector distances

were used: 1661.38 mm and 446.53 mm, which cover a scattering vector range of

0.008Å-1<q <0.40 A-1, where q is the magnitude of the qr -vector defined by

( ) θλπ sin4=q (where 2θ is the scattering angle). Three measurements were carried

out using two different sample concentrations in buffer (20 mM sodium phosphate pH

7,4; 150 mM NaCl, 1mM DTT) 0.4 mg/mL and 0.1 mg/mL. The radius of gyration (Rg)

was calculated from the Guinier approximation (valid for qRg < 1.3)3-5 and also from the

pair distance distribution function, p(r), which was obtained using the program GNOM6.

The maximum dimension (Dmax) of the molecule was obtained from the p(r) function.

Cell culture. Primary cultures of neonatal rat ventricular myocytes (NRVMs, 1- to 2-

day-old Wistar rats) were prepared as previously described7. The animals were handled

in compliance with the principles of laboratory of animal care formulated by the

university’s Animal Care and Use Committee. The NRVMs were plated in Bioflex

plates for stretch or in Petri plates (25 mm). NRVMs cultured in Bioflex plates were


stretched in a Flexercell FX-3000 strain unit to 10% of their resting length at a

frequency of 1 Hz (0.5-s stretch/0.5-s relaxation) for variable periods of time (10, 30

and 60 minutes)7.

siRNA synthesis and transfection protocol. siRNAs targeted to rat FAK, rat Myosin

or to GFP were designed, synthesized, and transfected into NRVMs as previously

reported30. The primers used to synthesis of the siRNAs sequences were displayed in

Supplementary Table 1.

Cell size analyses. For the analyses of cell surface area, NRVMs cultures were fixed

and immunostained with phalloidin and the nuclei were identified using DAPI. Cell

surface area was obtained by the analyses of individual cardiomyocytes with the Leica

Q Win software as previously described30.

Immunoprecipitation. NRVMs homogenized in lysis buffer were normalized and

incubated with anti-FAK-c20 polyclonal (Invitrogen) or with anti-Myc-tag antibodies

(Abcam) and proteins collected after addition of 20 µL of protein A-Sepharose beads

(GE Healthcare). Western blots of the immunoprecipitates were performed with the

primary anti-cardiac myosin heavy chain (Abcam), anti-FAK-c20, anti-β3 (c-20)

Integrin (Santa Cruz Biotechnology), anti-EGFR (Santa Cruz Biotechnology) or anti-

MET (Santa Cruz Biotechnology) antibodies. Band intensities were quantified by

optical densitometry.

Western blotting. Cells were washed in cold PBS and scraped into lysis buffer (1%

Triton, 10 mM sodium pyrophosphate, 100 mM NaF, 10 µg/ml aprotinin, 1 mM PMSF,


and 0.25 mM Na3VO4). The samples were centrifuged for 20 min at 11,000 g and the

soluble fraction was resuspended in Laemmli loading buffer (2% SDS, 20% glycerol,

0.04 mg/ml bromophenol blue, 0.12 M Tris·HCl, pH 6.8, and 0.28 M β-

mercaptoethanol). Equal amounts of protein (50 µg) from cell lysates were separated by

SDS-PAGE and blotted onto transfer membranes. The membranes were blocked for 1h

using 5% BSA in TBST buffer (10mM Tris, 0.1M NaCl, 0.1% Tween 20, pH 7.4).

Blots were incubated with the primary antibodies in 3% BSA in TBST buffer overnight

at 4 °C with gentle agitation. Following incubation with primary antibody, blots were

washed three times for 5 min each with TBST buffer and incubated with appropriate

horseradish peroxidase-labeled secondary antibodies in 3% BSA in TBST buffer for 1h

at 37°C. Proteins were detected using ECL. Quantification of bands was performed

using ImageJ (Image Processing and Analysis in JAVA-program/ National Institutes of

Health NIH). Signals from phosphoproteins were normalized to the total protein

obtained from blots with specific antibody.

Fluorescence microscopy analysis. Cells were fixed with 4% paraformaldehyde plus

4% sucrose blocked with 3% BSA plus 0.6% Triton-X 100 at room temperature. Cells

were then incubated with anti-FAK c-20 primary and subsequently with anti-myosin

antibodies and with Alexa488-conjugated goat anti-rabbit and Alexa568-conjugated

goat anti-mouse secondary antibodies (Invitrogen) at room temperature. Alternatively to

myosin stained, NRVMs were incubated with rhodamine-conjugated phalloidin

(Molecular Probes) at room temperature. Slides were then mounted with Vectashield.

Images were obtained with a Zeiss LSM510 laser confocal or a LEICA A4000

fluorescence microscope.


Peptide synthesis. All peptides were synthesized, purified by liquid chromatography-

mass spectroscopy to >95% purity by Peptide Protein Research Ltd (Fareham, United

Kingdom). The peptides FP-1 (EIADQVDQE), FP-1-MUT (AIADAVAQA) and FP-2

(QTIQYSNSEDK) were covalently binding in HiTrap NHS-activated HP column or

used in pull-down assays. For in vivo experiments, cultured cardiomyocytes were

treated with the above peptides conjugated to TAT47-57 carrier through a dissociable

disulfide bond. Fluorescent FP-1 (FLU-FP-1: 5&6 carboxyfluorescein-EIADQVDQE)

and FP-1-TAT (FLU-FP-1-TAT: 5&6 carboxyfluorescein-EIADQVDQEC-SS-

CYGRKKRRQRRR) were used in in vivo experiments to test cell uptake and FLU-FP-1

in in vitro affinity experiments.


Supplementary Figure 14. HPLC traces and MS data of synthesizes peptides.


Supplementary Figure 14 continued.


Peptide affinity columns. Affinity columns were obtained through covalent binding of

the FP-1, FP-1-MUT and control FP-2 peptides through their N-terminal to the gel of a

HiTrap NHS-activated HP column (1 ml) like previously described8. Extracts from

adult rat left ventricle were incubated with individual peptide columns for 1.5 h at 4 °C.

Columns were washed with phosphate buffered saline (PBS) and then with 0.1M

glycine, pH 2.7. Proteins that remained attached were eluted with 0.1 M glycine, pH

2.7, concentrated in centrifugal filter devices (Amicon Ultra; Millipore), and separated

by SDS-PAGE and used for western blotting.

Extraction and detection of intracellular FP-1. Peptide cellular fractions were

obtained by adaptation of a previously described protocol 9. Briefly, NRVMs were

scraped with a Lysis buffer (8 M urea, 75 mM NaCl, 50 mM Tris, pH 8.2, protease

inhibitors cocktail (Roche) and 1 mM PMSF), sonicated 3× 60 s at 4 °C, centrifuged at

2,500g for 10 min at 4 °C. The supernatant was transferred into new tubes and the

proteins were precipitated with cold acetone (1:3). The supernatant was dry by vacuum

centrifugation and resuspended in 0.1% trifluoroacetic acid. Peptides were desalted by

reversed phase chromatography using solid-phase extraction cartridges (50 mg of tC18

SepPaks - Waters). The samples (1µM of TAT-FP-1 standard, peptide fraction from

control NRVMs lysates and peptide fraction from TAT-FP-1 treated NRVMs lysates)

were then subjected to MS/MS experiments. UPLC/MS/MS analysis was performed in

a Synapt HDMS instrument (Waters Co.) like described in pull-down assays.


Fluorescence Polarization. The FP-1 and FP-1-Mut peptides were synthesized, labeled

and HPLC-purified by Peptide Protein Research Ltd (Fareham, United Kingdom). In

order to analyze myosin-peptide binding affinity, we performed isotherms binding assay

by incubating 5 nM of fluorescein-labeled peptides with unlabeled myosin at

concentrations ranging from 10 nM to 15 µM (concentrations expressed as monomers).

Assay was performed at 20°C in 200 mM NaCl, 50 mM tris pH 8.0, 3 mM

dithiothreitol, 5% glycerol. Myosin-FP-1 binding assays were analyzed assuming

simple two-state reversible equilibrium between two species. The polarization binding

assay of Myosin with the FP-1 peptide was performed in PekinElmer EnVision

multilabel reader (PekinElmer). Excitation was set to 480 nm and emission at 535 nm,

according to equipment filters. Polarization values (P) were calculated according to the

equation:

P= 1000*(Is – G *Ip)/(Is + G * Ip) (1)

Where I refers to the measured fluorescence intensity, and indices s and p are the

position of the different excitation polarizers, and G is a correction factor, which takes

into account differences in sensitivity in the two directions Is and Ip according to:

G = Is/ Ip (2)

All fluorescence polarization data shown in this study are an average of at least

three independent experiments, performed with different protein batches and on

different days. For each sample, polarization was measured until absolute errors were

less than 0.002. As specificity control, FP-1-MUT peptide was incubated with myosin

in the same condition, and no binding was observed.

Quantitative analysis of binding equilibrium. Myosin-FP-1 interaction isotherms

were analyzed by Model-independent binding assuming a simple two-state reversible


equilibrium. The dissociation constant Kd of the above reaction can be described

according to:

Kd = (D*M)/MD (3),

where D is the molar concentration of the FP-1, M is the molar concentration of the free

Myosin, and MD is the molar concentration of the complex formed between FP-1 and

Myosin. The complex is related to the polarization measurements by:

MD = Dt*α (4),

and

α = (Pobs - Pi)/(Pf - Pi) (5),

where α is the fraction of bound myosin, Pobs is the observed polarization at total

monomeric protein concentration M, and Pi and Pf are, respectively, the lower and upper

asymptotic limits for polarization values obtained by fitting the curves. Then, it follows

that:

Pobs = Pi + (Pf - Pi)*{[(M + n)/(k n)]/ [1+(Mn/kn)]} (6),

where n is the Hill cooperativity coefficient. No corrections were applied to quantum

yields since no significant changes in fluorescence intensity occurred (fluorescence

intensity near 600,000). The data were fitted using nonlinear least-squares regression

analysis contained within SigmaPlot 2006 (Version 10.0, Jandel Scientific Co.).

Quantification of mRNAs. Total RNA was isolated from extracts of NRVMs as

previously described10. For mRNA quantification, target genes expression was analyzed

by Sybr Green qRT-PCR (Stratagene). The reactions were performed using the SYBR

Green (with Dissociation Curve) program on the Mx3000TM Comparative Quantitative

PCR System (Stratagene). The oligonucleotides used were FAK sense: 5’-


GACAAAGACAGGAAAGGAATGC -3’; FAK antisense: 5’-

GTCAGCCATGTTCTCTGCAA-3’; ANP sense: 5’- CTTCCTCTTCCTGGCCTT

TT-3’; ANP antisense: 5’-TCCAGGTGGTCTAGCAGGTT-3’; GAPDH sense: 5’-

GGCATTGCTCTCATGACAA-3’ and GAPDH antisense: 5’-

ATGTAGGCCATGAGGTCCAC-3’. All reactions were performed with reference dye

normalization. The median cycle threshold value was used for analysis, and all cycle

threshold values were normalized to the GAPDH mRNA expression level.


CLONING PRIMERS

FERM_S 5’CGCGGATCCCATATGGGTGCAATGGAACGAGTATTAAAGG 3’

FERM_AS 5’CGCAAGCTTGGATCCTCAGTCTTCCTCATCGATGATCTCTGC 3’

Myh6_S 5’ GGCCGGGGATCCATGGCTGAGGAGCTGAAGAAG 3’

Myh6_AS 5’ GGCCGGAAGCTTTTATTCCTCGTCGTGCATCTTC 3’

MYO (1767-1861)-AS 5’GGC CGG AAG CTT TCA CTT CTT GTC TTC CTC TGT C3’

MYO (1862-1938)-S 5’GGC CGG GGA TCC AAC TTA ATG CGG CTG CAG 3’

MUTAGENIC PRIMERS

FERM-MUT-1_S 5` GTGACTACATGCAAGCAATAGCTGCTGCAGTAGACCAAG 3`

FERM-MUT-1_AS 5` CTTGGTCTACTGCAGCAGCTATTGCTTGCATGTAGTCAC 3`

FERM-MUT-2_S: 5` GCTGCAGTAGACGCAGAAATAGCTTTGAAGTTGG 3`

FERM-MUT-2_AS 5` CCAACTTCAAAGCTATTTCTGCGTCTACTGCAGC 3`

FERM-MUT-3_S 5’ GCTGCTGCAGTAGCCGCAGCAATAGC 3’

FERM-MUT-3_AS 5’ GCTATTGCTGCGGCTACTGCAGCAGC 3’

FERM-MUT-4_S 5’ CCTGCGATCGGCGGCGGTGCACTGGC 3’

FERM-MUT-4_AS 5’ GGACGCTAGCCGCCGCCACGTGACCG 3’

FERM-MUT-5_S 5’CCTGACAGACGCAGGCTGCAATCCC 3’

FERM-MUT-5_AS 5’ GGACTGTCTGCGTCCGACGTTAGGG 3’

MYO_R77A,K78A_S 5’ CGGTGAAGGGCATGGCGGCGAGTGAGCGGCG 3’

MYO_R77A,K78A_AS 5’GCCACTTCCCGTACCGCCGCTCACTCGCCGC 3’

siRNA PRIMERS

T7 5’ GGTAATACGACTCACTATAG 3’

siFAK236_S 5’GCGAAATCCATAGCAGGCCACTATAGTGAGTCGTATTACC 3’

siFAK236_AS 5’ACGTGGCCTGCTATGGATTTCTATAGTGAGTCGTATTACC 3’

siMyh6_S 5’GATCTTGTCGAATTTCGGAGGTATAGTGAGTCGTATTACC3’

si Myh6_AS 5’ACCCTCCGAAATTCGACAAGATATAGTGAG TCGTATTACC 3’

siGFP_S 5’GTGTCTTGTAGTTCCCGTCTATAGTGAGTCGTATTACC 3’

siGFP_AS 5’ATGACGGGAACTACAAGACACCTATAGTGAGTCGTATTACC3’

Supplementary Table 1: Primes used to cloning, mutagenesis and siRNA approaches.


REFERENCES

1. Iglesias, A.H., Santos, L.F. & Gozzo, F.C. Identification of cross-linked peptides by high-resolution precursor ion scan. Anal Chem 82, 909-16.

2. Tyska, M.J. et al. Single-molecule mechanics of R403Q cardiac myosin isolated from the mouse model of familial hypertrophic cardiomyopathy. Circ Res 86, 737-44 (2000).

3. Guinier, A., Fournet, G. Small angle scattering of X-rays, (John Wiley and Sons, Inc., New York, 1955).

4. Glatter, O., Kratky, O. Small angle X-ray scattering, (Academic Press New York, 1982).

5. Feigin, L.A., Svergun, D.I. Structure analysis by small angle X-ray and neutron scattering, (Plenum Press New York, 1987).

6. Svergun, D.I. Determination of the regularization parameter in indirect-transform methods using perceptual criteria. J. Appl. Crystallogr 25, 495-503 (1992).

7. Torsoni, A.S., Constancio, S.S., Nadruz, W., Jr., Hanks, S.K. & Franchini, K.G. Focal adhesion kinase is activated and mediates the early hypertrophic response to stretch in cardiac myocytes. Circ Res 93, 140-7 (2003).

8. Cunha, F.M. et al. Intracellular peptides as natural regulators of cell signaling. J Biol Chem 283, 24448-59 (2008).

9. Villen, J. & Gygi, S.P. The SCX/IMAC enrichment approach for global phosphorylation analysis by mass spectrometry. Nat Protoc 3, 1630-8 (2008).

10. Marin, T.M. et al. Shp2 negatively regulates growth in cardiomyocytes by controlling focal adhesion kinase/Src and mTOR pathways. Circ Res 103, 813-24 (2008).


SUPPLEMENTARY INFORMATION Aline M. Santos Marin … · non-induced (NI) or induced (I) fractions of...

Documents

Transcript of SUPPLEMENTARY INFORMATION Aline M. Santos Marin … · non-induced (NI) or induced (I) fractions of...