Supplemental Table 1A: Manufacturer information · Web viewApproximately 50 mg of liver was...
Transcript of Supplemental Table 1A: Manufacturer information · Web viewApproximately 50 mg of liver was...
1
SUPPLEMENTAL MATERIALS
Animals
Male C57BL/6J mice were purchased from Charles River (France). Mice were anesthetized by
intraperitoneal injection of a mixture of midazolam (Dormicum®) and fluanisone/fentanyl citrate
(Hypnorm®). Liver and epididymal fat were sampled, weighed and snap-frozen for further analysis.
Detailed methods
Real-time PCR
Total RNA was isolated from approx. 50 mg tissue using the TRI REAGENT™ and further purified by
LiCl precipitation. Two μg of total RNA was transcribed into cDNA using the iScript™ cDNA-
synthesis kit. Real-time PCR was performed in the LightCycler®480 (Roche) with the corresponding
PCR-reagents (SYBR® Green I Master), using specific primers (Supplemental Table 4). 18S rRNA was
used as reference. Relative mRNA levels were quantified using linear regression on the
Log(fluorescence) with LinReg software [1]. For better visualization, the 18S-corrected values were
divided by the corresponding mean of LF/LP-group (=100%). The raw data of each gene are shown in
Supplemental Table 5.
Mitochondrial DNA copy number
mtDNA copy number was determined as described [2]. Total DNA was isolated from ~10 mg tissue
with isopropanol/chloroform. DNA was diluted to 2 ng/μL. RT-PCR was performed using Nd1 primers
for mitochondrial DNA and 18S for nuclear DNA.
2
Plasma analysis
Two days before sacrifice, mice were fasted for 4 hours to assay fasting glucose concentration in a
whole-blood sample from the saphenous vein [3] with the Ascencia Contour® glucose meter (Bayer,
Leverkusen, Germany). At sacrifice, blood glucose was measured in caval-vein blood. The remaining
blood was collected in heparin-coated tubes. Plasma was snap-frozen in liquid nitrogen and stored in
aliquots at -80°C until use. Plasma triglycerides, non-esterified fatty acids, total cholesterol, and
phospholipids were determined using commercially available kits (Supplemental Table 1). Plasma
glucagon, insulin and leptin were determined with the MENDO-75K mouse endocrine multiplex kit.
Fluorescence signals were measured with a Luminex-100™ system (Luminex, Austin, TX, USA).
Determination of plasma FGF21
Circulating FGF21 levels were determined using a sandwich enzyme-linked immunosorbent assay as
described previously [4]. Briefly, microtiter plates were coated with goat anti-mouse FGF21 antibody.
Samples and recombinant mouse FGF21 standards were diluted in phosphate-buffered saline containing
1.0% casein and 0.05% Tween-20. Captured antigen was detected with biotinylated goat anti-mouse
FGF21 antibody, streptavidin-horseradish peroxidase as a secondary detection reagent and tetramethyl-
benzidine as chromogenic substrate. The lower limit of detection of the assay was 0.02 ng/mL.
Plasma amino-acid analysis
For the determination of plasma amino acids, 50μL of plasma was added to 4 mg sulfosalicylic acid,
vortexed, snap-frozen in liquid nitrogen and stored at -80°C until use. Plasma amino-acid concentrations
were measured using a fully automated HPLC system [5].
3
Plasma acyl-carnitines
Plasma acyl-carnitines were measured as described [6]. In short, 50 µL of plasma were mixed with
internal standards and derivatized prior to quantification with electron-spray tandem mass spectrometry
(ESI-MS/MS).
Liver lipid analysis
Hepatic triglyceride, total cholesterol and free fatty-acid content were analyzed as described [7]. Briefly,
~50 mg of frozen liver tissue was homogenized with an Ultraturrax and sonicated for 30 sec in 1.0 mL
SET buffer (sucrose 250 mM, EDTA 2 mM and Tris∙HCl 10 mM, pH 7.4). Complete cell destruction
was achieved by one freeze–thaw cycle and two 15-sec cycles of sonication (amplitude: 10 μm). Liver
lipids were analyzed using the same kit as described for plasma analysis. Protein content was measured
with the bicinchoninic acid (BCA) method.
For the determination of the fatty-acid composition, liver tissue was homogenized in PBS (pH 7.4) using
a dispersion tool (Ika T10 basic). After sonication (twice at 8W output, 40J, on ice), protein
concentration (BCA method) was measured and all samples were diluted to 2 mg protein/mL. Fatty
acids from a 100 μg sample were directly trans-esterified to methylesters and analyzed by gas
chromatography with flame ionization detection [8].
4
Histology
Glutamine synthetase and Oil-red-O staining: Frozen liver sections (7 μm) were air-dried and washed in
PBS for ~2 min. Sections were fixed in 4% buffered formaldehyde for 10 min at room temperature and
then washed 2x 5 min in PBS (pH 7.4). Nonspecific binding was blocked by pre-incubation with 10%
(v/v) newborn goat serum (NGS) in Teng-T buffer (10 mM Tris∙HCl, 5 mM EDTA, 150 mM NaCl,
0.25% gelatin, 0.05% Tween-20) for 30 min. Sections were incubated with glutamine synthetase
antibody (1:1,500 dilution in Teng-T/10% NGS) for 2 h at 37°C, washed 3-times 5 min in PBS, and
incubated for 60 min with fluorescent secondary antibody (1:200 in PBS). The immunostaining was
followed by an Oil-Red-O staining to stain fat droplets, as described [9]. In short, air-dried frozen
sections were fixed with 3.7% formaldehyde for 60 min, rinsed 3 times with water for 30 sec, immersed
in Oil red O (Solvent Red 27 or Sudan Red 5B dissolved in triethylphosphate) for 30 min, rinsed 3 times
with water for 30 sec, rinsed with running tap water for 10 min and covered with a coverslip using 10%
glycerol in PBS.
Electron microscopy: Mouse livers were fixed by a semi-perfusion technique for liver wedge biopsies as
described [10]. In short, immediately after excision the liver was injected from multiple sides with 3%
glutaraldehyde in 0.9M KH2PO4 (pH 7.4) via a 25 G syringe until discoloration and hardening of the
tissue. Small pieces were prepared and further fixed in the same fixative for at least 3 days. After an
overnight rinse in 0.9M KH2PO4/0.22M sucrose the samples were further fixed in 2% OsO4 (dissolved
in veronal acetate; pH 7.4, 4°C) for 1h before embedding in epoxy resin. Ultrathin sections were stained
with uranyl acetate and lead citrate, and evaluated with a Philips CM100 electron microscope.
Citrate synthase activity
5
Citrate synthase activity was determined as described [11]. In brief, a 96-well plate was prepared with 5
μL of sample, mixed with 250 μL of reagent (25 mM Tris base, 0.1 mM DTNB (5,5'-dithiobis-(2-
nitrobenzoic acid), 50 μM acetyl-CoA and 0.01% Triton X-100). The reaction was started with 5 μL
oxaloacetic acid (25 mM). Absorption was read for 30 min at 37°C at 412 nm wavelength with 3
readings/min.
Western blotting
Approximately 50 mg of liver was homogenized in 1 mL ice-cold lysis buffer (10 mM Tris∙HCl,
100mM NaCl, 1 mM EDTA, 1 mM EGTA and 1 mM NaF, 20 mM Na4P2O7, 2 mM activated Na3VO4,
17.5 mM β-glycerophosphate, 1% sodium deoxycholate, 1% Triton X-100, 0.1% SDS, and 10%
glycerol, pH 7.4), containing Complete™ protease inhibitors cocktail (Roche), and incubated on ice for
30 min. Insoluble material was removed by centrifugation at 10,000 × g for 10 min at 4°C. The
supernatant was transferred to a fresh tube. The procedure was repeated twice to obtain a clear
supernatant. Protein concentration was determined with a BCA-assay. Proteins were resolved by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. Equal
loading was checked with Ponceau S staining of the blot. Non-specific binding was blocked with 5%
non-fat milk or 5% BSA in Tris-buffered saline (3 mM KCl, 130 mM NaCl, 25 mM Tris∙HCl, pH=7.4)
with 0.05% Tween-20. Blots were incubated overnight at 4°C with monoclonal antibody in the same
buffer, for 1 h with secondary antibody, and visualized with chemiluminescence using the Supersignal
West kit (Pierce). Primary antibodies that were used for Western blotting are listed in Supplemental
Table 2.
6
Supplemental Figures
Supplemental Figure B.1. Correlation of dietary carbohydrate (A), fat (B), or protein (C)
consumption with hepatic triglyceride (TG) concentrations in mice fed diets differing in protein
and fat content for 3 weeks. Data of mice fed a LP diet are shown as triangles and a HP diet as
diamonds. The asterisks indicate data from C57BL/6 mice from another 3-week study, in which
carbohydrates were exchanged for 15 en% triheptanoin, an odd-carbon, medium-chain triglyceride
(Comhair et al., submitted).
Supplemental Figure B.2. Hepatic polyunsaturated fatty-acid concentrations in mice fed diets
differing in protein and fat content for 3 weeks. The left column shows the main metabolites in the
so-called n-6 pathway, whereas the right column shows the n-3 pathway. Note the influence of the HF
diets on the hepatic concentration the essential linoleic acid (C18:2n-6) and α-linolenic acid (C18:3n-3) and the
influence of the HP diets on the hepatic concentration of arachidonic acid (C20:4n-6), eicosapentaenoic
acid (C20:5n-3) and docosahexaenoic acid (C22:6n-3).
Supplemental Figure B.3. Correlation of dietary carbohydrate consumption with hepatic ACACα
and ACACβ protein content in mice fed diets differing in protein and fat content for 3 weeks. The
asterisks indicate data from C57BL/6 mice in another 3-week study, in which carbohydrates were
exchanged with 15 en% triheptanoin (TH), an odd-carbon, medium-chain triglyceride (Comhair et al.,
submitted).
Supplemental Figure B.4. Western blot analysis of hepatic AMPK, AKT, NFκB, 4EBP1 and
P70S6K phosphorylation in mice fed diets differing in protein and fat content for 3 weeks. Bars
7
show mean ± SEM, with n=8-10 animals per group. The coding of the bars is shown at the bottom of the
Figure.
Supplemental Figure B.5. The regulation of Pgc1α expression in mice fed diets differing in protein
and fat content for 3 weeks. Panel A shows Pgc1α mRNA abundance in liver, muscle and epididymal
fat pad of mice fed diets differing in protein and fat content for 3 weeks; panel B shows the mRNA
abundance of transcriptionally regulated genes which were previously shown to be involved in the
regulation of Pgc1α and Fgf21 expression in the liver [12]. Panels C and D show quantification of
Western blots of COMPLEX I-V of the respiratory chain, mtDNA copy number (Nd1/18S) and citrate
synthase activity. Bars show mean ± SEM, with n=6 animals per group. The coding of the bars is shown
at the bottom of the Figure.
Supplemental Figure B.6. Mitochondrial ultrastructure of the liver of mice fed a HF/LP or a
HF/HP diet for 3 weeks. Panels A and B show electron-microscopy images of hepatocytes exposed to a
HF/LP or HF/HP diet for 3 weeks. Panel A: HF/LP diet; panel B: HF/HP diet. Note larger and darker
mitochondria in the liver of HF/HP-treated mice. Asterisk: bile canaliculus; M: mitochondrion; G:
glycogen; white globules: fat.
Supplemental Figure B.7. Expression of ER-stress markers in mice fed a HF/LP or HF/HP diet for
3 weeks. For comparison, data from a mouse treated with the ER stress-inducing agent tunicamycin
(TM; 1 µg/g body weight for 8 h) are also shown. Panel A: Hepatic mRNA levels of the indicated ER-
stress markers in C57BL/6J mice and a TM-treated mouse. Panel B: Splicing of Xbp1 mRNA. Panels C-
E: Hepatic protein content of the ER-stress markers ATF6, ATF4, and DDIT3 (CHOP). Note that the
concentration of intact ATF6 (90 kDa; panel C) is lower and that of a ~45 kDa band (panel D) is higher
8
in HF/HP- than in HF/LP-fed mice. Further note that spliced (= active) species of ATF6, sXbp1, and
DDIT3 are only detectable in the liver of the TM-treated mouse. Bars show mean ± SEM (n=8-10
animals per group for HF/LP- or HF/HP-fed mice). Unmarked lanes: mice fed a HF/LP diet; *: mice fed
a HF/HP diet.
Supplemental Figure B.8. Hepatic monomethyl branched-chain fatty-acid concentrations in mice
fed diets differing in protein and fat content for 3 weeks. Panel A: correlation of the plasma
concentration of BCAAs and the hepatic concentration of their mmBCFA metabolites. Panel B:
correlation of liver triglyceride concentration and mmBCFAs. In panel C a correlation matrix is shown.
Blue-colored boxes indicate a negative correlation and red-colored boxes a positive correlation. The
different color tones refer to the P-values as shown next to the matrix. Note that plasma leucine
correlates very well with 15-methylhexanoic acid (15-MHDA) and plasma valine reasonably with 14-
methylpentanoic acid (14-MPDA), but the correlations of these mmBCFAs with hepatic TG are poor.
Supplemental Figure B.9. Hepatic lipid content in mice fed a HF/LP diet for 3 weeks and either a
HF/LP or a HF/HP diet for the 4th week. Sections were stained with Oil-Red O. Panel A: liver of
mouse fed HF/LP diet for 4 weeks; Panel B: liver of mouse fed HF/LPres diet.
9
Supplemental Table 1: Manufacturer information of chemicals
Product ManufacturerAnesthesia Dormicum® Roche, Almere, The Netherlands
Hypnorm® VetaPharma, Leeds, UKDiets LF/LP; LF/HP; HF/LP; HF/HP Research Diets Inc., New Brunswick, NJ, USAImmunohistochemistry Avidin D / Biotin D Vector Laboratories, Burlingame, CA, USA
Mouse-α-Glutamine Synthetase (610517) BD Transduction Laboratories, Lexington, KY, USARat-α-CD68 (HM1070) Hycult Biotechnology, Uden, The NetherlandsRat-α-CD11b (MAB1124) R&D Systems, McKinley, MN, USASIGMAFAST™ (DAB) Sigma-Aldrich, St. Louis, MO, USAGoat-α-mouse- Alexa fluor 488 Invitrogen, Breda, The NetherlandsRabbit-α-Rat (biotinylated) (ED0468) DAKO, Glostrup, Denmark
Kits for plasma parameters TrigGB Roche Diagnostics, Almere, The NetherlandsNEFA-HR WAKO Chemicals, Neuss, Germanyphospholipid B WAKO Chemicals, Neuss, GermanyTotal cholesterol bioMérieux, Marcy I’Etoile, FranceMENDO-75K Millipore, Billerica, MA, USA
In-house FGF21 ELISA Goat anti-Mouse FGF21 (AF3057) R&D Systems, McKinley, MN, USArecombinant Mouse FGF21 standards Phoenix Pharmaceuticals Inc., Burlingame, CA, USAMouse-α-FGF21 (biotinylated) (BAF3057) R&D Systems, McKinley, MN, USA
Western Blotting Complete™ Roche, Almere, The NetherlandsBCA-assay Thermo Scientific, Rockford, IL, USAnitrocellulose membrane Bio-Rad Laboratories, Veenendaal, The Netherlandsnon-fat dry milk Campina, The NetherlandsSupersignal west Thermo Scientific, Rockford, IL, USA
RT-qPCR TRI REAGENT™ Sigma-Aldrich, St. Louis, MO, USAiScript™ Bio-Rad Laboratories, Veenendaal, The NetherlandsSYBR® Green I Master Roche, Almere, The Netherlandsall primers Sigma-Aldrich, St. Louis, MO, USA
Citrate synthase activity 5,5′-Dithio bis(2-nitrobenzoic acid) Sigma-Aldrich, St. Louis, MO, USAAcetyl-CoA Sigma-Aldrich, St. Louis, MO, USAOxaloacetic acid Sigma-Aldrich, St. Louis, MO, USA
10
Supplemental Table 2: Details of antibodies used in Western blot analysis
primary Antibody Manufacturer
Product nr Dilution
Dilution of 2nd antibody
% SDS-PAGE
protein loading [ug] Blocking
CHOP Santa Cruz, LaJolla (CA), USA sc-7351 1:800 1:10 000 12% 50 5% milk/TBS-T
ATF6 LifeSpan Biosciences (WA), USA LS-C3480 1:500 1:5000 10% 60 5% milk/TBS-T
PEPCK
gift from Dr. Bruno Christ, First Department of Medicine, Martin Luther University of Halle–Wittenberg,Halle/Saale, Germany
1:1000 1:10 000 10-12% 20 5% milk/TBS-T
ATF4 Santa Cruz, LaJolla (CA), USA sc-200 1:800 1:10 000 12% 70 5% milk/TBS-T
AMPK Cell Signaling Technology, Inc., Danvers (MA), USA 2532 1:1000 1:10 000 12% 50 5% milk/TBS-T
p-AMPK [Thr172]
Cell Signaling Technology, Inc., Danvers (MA), USA 2531S 1:1000 1:10 000 12% 50 5% milk/TBS-T
eIF2α Invitrogen, Breda, The Netherlands AH00802 1:1000 1:10 000 10% 50 5% BSA/TBS-T
p-eIF2α [Ser52]
Invitrogen, Breda, The Netherlands 44-728G 1:1000 1:10 000 10% 50 5% BSA/TBS-T
P70S6K Cell Signaling Technology, Inc., Danvers (MA), USA 9202 1:1000 1:2500 12% 50 5% milk/TBS-T
p-P70S6K [Thr389]
Cell Signaling Technology, Inc., Danvers (MA), USA 9206S 1:1000 1:2500 12% 50 5% milk/TBS-T
4EBP1 Cell Signaling Technology, Inc., Danvers (MA), USA 9452 1:1000 1:2500 12% 50 5% milk/TBS-T
p-4EBP1 [Ser65]
Cell Signaling Technology, Inc., Danvers (MA), USA 9451S 1:1000 1:2500 12% 50 5% milk/TBS-T
ACAC Cell Signaling Technology, Inc., Danvers (MA), USA 3676 1:1000 1:2500 6% 25 5% milk/TBS-T
p-ACAC [S79]
Cell Signaling Technology, Inc., Danvers (MA), USA 3661L 1:1000 1:2500 6% 25 5% milk/TBS-T
AKT Cell Signaling Technology, Inc., Danvers (MA), USA 4685 1:1000 1:2500 7.5% 50 5% milk/TBS-T
p-AKT [S473]
Cell Signaling Technology, Inc., Danvers (MA), USA 9271S 1:1000 1:2500 7.5% 50 5% milk/TBS-T
NF-κB p65 Cell Signaling Technology, Inc., Danvers (MA), USA 3034 1:500 1:2500 7.5% 50 5% milk/TBS-T
p-NF-κB p65 Cell Signaling Technology, 3031S 1:500 1:2500 7.5% 50 5% milk/TBS-T
11
[Ser536] Inc., Danvers (MA), USA
OXPHOS Mitoscience, Eugene, OR, USA MS604 1:500 1:5000 10% 50 5% milk/TBS-T
Horse anti-mouse HRP
Vector Laboratories, Burlingame, CA,USA PI-2000 See right
(only for ATF6, OXPHOS and CHOP)
Goat anti-rabbit HRP
Vector Laboratories, Burlingame, CA,USA PI-1000 See right
12
Supplemental Table 3: Composition of the LF/LP, LF/HP, HF/LP, and HF/HP diets
LF/LP LF/HP HF/LP HF/HPper 100g
Protein 10 33 12 40Fat 4 4 21 21Carbohydrate 77 54 55 27MJ/kg 15.9 15.9 19.3 19.3
%energyProtein 11 35 11 35Fat 8 8 42 42Carbohydrate 81 57 48 24
g/kgCasein, 80 Mesh 122 325 122 325L-Cystein 1.8 4.8 1.8 4.8Sucrose 252 176 173 87Maltodextrin 10 71 33 115 115Corn starch 437 323 249 59Olive oil 35 35 213 213Cellulose 48 48 58 58Mineral mix 12 12 12 12Vitamin mix 12 12 12 12Dicalcium phosphate 15 15 15 15Calcium carbonate 6 6 6 6Potassium citrate 18 18 18 18Choline bitartrate 2 2 2 2Cholesterol 2 2 2 2
LF/LP: low fat/low protein; LF/HP: low fat/high proteinHF/LP: high fat/low protein; HF/HP: high fat/high protein
13
Supplemental Table 4: RT-PCR primers used
gene abbr. group NCIB accession nr.
Forward primer 5’-3’ (F)Reverse primer 5’-3’ (R)
amplicon size
notes
Peroxisome proliferator-activated receptor gamma
Pparg lipogenesis NM_001127330.1 F: CACAATGCCATCAGGTTTGGR: GCTCGCAGATCAGCAGACTCT
110
Sterol regulatory element binding transcription factor 1
Srebf1, Srebp1c
lipogenesis NM_011480.3 F: CCTGGTGGTGGGCACTGAAGCR: GCGTCTGAGGGTGGAGGGGT
249
MLX interacting protein-like Mlxipl, Chrebp
lipogenesis NM_021455.3 F: ACTCAGGGAATACACGCCTACAGR: TCTTGGTCTTAGGGTCTTCAGGAA
108
AcetylCoenzyme A-carboxylase alpha Acc1, Acaca
lipogenesis NM_133360.2 F: AGGCAGCTGAGGAAGTTGGCTR: CGCTGCACAGAGCAGTCACG
250
Fatty acid synthase Fasn lipogenesis NM_007988.3 F: GATATTGTCGCTCTGAGGCTGTTGR: GGAATGTTACACCTTGCTCCTTGC
129
Stearoyl-CoA desaturase 1 Scd1 lipogenesis NM_009127.4 F: GGCCTGTACGGGATCATACTGR: GGTCATGTAGTAGAAAATCCCGAAGA
75
Adipose differentiation-related protein, adipophilin
Adrp, Adfp
lipogenesis NM_007408.3 F: GATGGAGGAAAGACTGCCTATTCTR: TGGTAGTCGTCACCACATCCTT
101
Apolipoprotein B Apob VLDL synthesis NM_009693.2 F: GCGAGTGGCCCTGAAGGCTGR: CCGTGGAGCTGGCGTTGGAG
224
Microsomal triglyceride transfer protein Mttp VLDL synthesis NM_001163457.1 F: CATTCAGCACCTCCGGACTTR: GATACTGCTGTCACTTTTGAAATCCA
166
Patatin-like phospholipase domain containing 2
Pnpla2, Atgl
lipolysis NM_001163689.1 F: CAACACCAGCATCCAGTTCAAR: TTGGTTCAGTAGGCCATTCCTC
148
Lipase, hepatic Lipc lipolysis NM_008280.2 F: GCCACTTCCTGGAACTCTACAAACR: GCTCATGGGCACATTTGAT
81
Peroxisome proliferator-activated receptor alpha
Ppara fatty acid oxidation
NM_001113418.1 F: GCAGTGCCCTGAACATCGAR: TCGCCGAAAGAAGCCCTTA
101
peroxisome proliferative activated receptor gamma coactivator 1 alpha
Ppargc1a, Pgc1a
fatty acid oxidation
NM_008904.2 F: GCACGAGAAGCGGGAGTCTR: TCACACGGCGCTCTTCAAT
77
Acyl-Coenzyme A oxidase 1 Acox fatty acid oxidation
NM_015729.2 F: TGTGACCCTTGGCTCTGTTCTR: TGTAGTAAGATTCGTGGACCTCTG
113
Carnitine palmitoyl transferase alpha (liver isoform)
Cpt1a fatty acid oxidation
NM_013495.2 F: ACCCCACAACAACGGCAGAG: GCCAGCGCCCGTCAT
95
Sirtuin1 Sirt1 fatty acid oxidation
NM_001159590.1 F: TGGAGCTGGGGTTTCTGTCTCCTGR: ACGGCTGGAACTGTCCGGGA
191
Protein Tyrosine Phosphatase 1 beta Ptp1b insulin signaling NM_011201.3 F: GACACAGGTTTGAAGTTGACACTAATCR: GGTGTAGTGGAAATGCAGGATCT
123
Sterol regulatory element binding transcription factor 2
Srebp2 cholesterol NM_011480.3 F: GTGCGCTCTCGTTTTACTGAAGTR: GTATAGAAGACGGCCTTCACCAA
86
3-Hydroxy-3-methylglutaryl-Coenzyme A reductase
Hmgcr cholesterol NM_008255.2 F: TGACCTTTCTAGAGCGAGTGCATR: CACGAGCTATATTTTCCCTTACTTCA
83
Cluster of Differentiation 36 Cd36 scavenger receptor
NM_001159558.1 F: GCCAAGCTATTGCGACATGAR: AAAAGAATCTCAATGTCCGAGACTTT
86
14
Glucose-6-phosphatase, catalytic G6pase, G6pc
gluconeogenesis NM_008061.3 F: TCTTAAAGAGACTGTGGGCATCAAR: AATACGGGCGTTGTCCAAAC
101
Phosphoenolpyruvate carboxykinase 1 Pepck gluconeogenesis NM_011044.2 F: TGTGTGGGCGATGACATTGR: TGAGGTGCCAGGAGCAACTC
102
3-Hydroxy-3-methylglutaryl-Coenzyme A synthase 2
Hmgcs2 ketogenesis NM_008256.4 F: ACCACCAACGCCTGTTATGGR: GGCGTTACCACTCGGGTAGA
132
Fibroblast growth factor 21 Fgf21 Gluconeogenesis, energy metabolism
NM_020013.3 F: GGTCATTCAAATCCTGGGTGR: CTGGTTTGGGGAGTCCTTCT
196
Delta-aminolevulinate synthase 1 Alas1 heme-synthesis NM_020559.2 F: GCCAGGCTGTGAAATTTACTR: CTGTTGCGAATCCCTTGGAT
66 [13]
Aryl hydrocarbon receptor nuclear translocator protein
Arntl, Bmal1
diurnal cycle NM_007489.3 F: TCAAGACGACATAGGACACCTR: GGACATTGGCTAAAACAACAGTG
203 [13]
Nuclear factor, interleukin 3 regulated Nfil3, E4bp4
suppression Fgf21 expression
NM_017373.3 F: CCAGGGAGCAGAACCACGAR: GTTGTCCGGCACAGGGTAAA
64 [13]
Argininosuccinate synthetase 1 Ass1 urea cycle NM_007494.3 F: GGGACCTGTACCTATAATCCAAR: CAGCCACACGAGGATGCA
100
Arginase 1 Arg1 urea cycle NM_007482.3 F: AACACGGCAGTGGCTTTAACCR: GGTTTTCATGTGGCGCATTC
117
Aconitase, mitochondrial mAco, Aco2
TCA-cycle NM_080633.2 F: GGAACTTCACAGGCCGTAATGR: CTTGCCTGTTAAGAAGTCAGTTTC
132
DNA damage-inducible transcript 3 Chop, Ddit3
ER-stress NM_007837.3 F: GAACCTGAGGAGAGAGTGTTCCR: AGGGACTCAGCTGCCATGAC
101
Growth Arrest and DNA Damage-Inducible Protein
Gadd34, Myd116
ER-stress NM_008654 F: GGCGGCTCAGATTGTTCAAAR: AAGGAAATGGACTGTGACTTTCTCA
104
Asparagine synthetase Asns ER-stress NM_012055.3 F: GGAGGCCCAAGTTCAGTATCCR: TCATGATGCTCGCTTCCAATAT
111
C-type lectin domain family 2, member h Clec2h ER-stress NM_053165.4 F: CATCAACACAGCACCCTTGGAR: CTCACACATGCCTTGGTACACTTC
201
X-box binding protein 1 Xbp1 ER-stress NM_013842.2 F: AAGAACACGCTTGGGAATGGR: ACTCCCCTTGGCCTCCAC
67 [14]
X-box binding protein 1, spliced sXbp1 ER-stress NM_013842.2 F: GAGTCCGCAGCAGGTGR: GTGTCAGAGTCCATGGGA
65 [14]
Integrin alpha M Itgam, Mac-1, Cd11b
inflammation NM_001082960.1; NM_008401.2
F: ACTTTCAGAAGATGAAGGAGTTTGTCTR: TGTGATCTTGGGCTAGGGTTTC
148
Cluster of Differentiation 68 Cd68 inflammation NM_009853.1 F: TGACCTGCTCTCTCTAAGGCTACAR: TCACGGTTGCAAGAGAAACATG
81
Tumor necrosis factor alpha Tnf-alpha inflammation NM_013696.2 F: CATCTTCTCAAAATTCGAGTGACAAR: TGGGAGTAGACAAGGTACAACCC
175
Chemokine (C-C motif) ligand 2 Ccl2, Mcp-1
inflammation NM_011333.3 F: GCTGGAGAGCTACAAGAGGATCAR: ACAGACCTCTCTCTTGAGCTTGGT
85
Toll-like receptor 4 Tlr4 inflammation NM_021297.2 F: CCTACCAATGCATGGATCAGAAR: AATTGTTTCAATTTCACACCTGGAT
170
18S ribosomal RNA 18S reference gene NR_003278.1 F: AGTTAGCATGCCAGAGTCTCG 76
15
R: TGCATGGCCGTTCTTAGTTGmitochondrially encoded NADH dehydrogenase 1
Nd1 mitochondrial DNA marker
NC_005089.1 F: CAGGATGAGCCTCAAACTCCR: GGTCAGGCTGGCAGAAGTAA
184
16
Supplemental Table 5: Calculated N0-values using LinReg methodology for calculation of mRNA abundance in the liver of male mice fed a LF/LP diet for 3 weeks. The average of N0-values of the LF/LP (or HF/LP-4w) of each mRNA was expressed as 100%.
Gene 100% =
ER-stress Reversion experimentGadd34 0.00156 Acacα 0.001669
Chop 0.00125 Fasn 0.005208Asns 0.00042 Fgf21 0.000057
Clec2 0.00107 Pck1 0.017119Xbp1 0.02716 G6pase 0.003311
Spliced Xbp1 0.00152 Pgc1α 0.000060Fgf21 0.00095 Pparα 0.002119
Pparγ 0.000208Fat metabolism Scd1 0.096847
Ppara 0.005678 Srebf1 0.006351Acox 0.138873Cpt1 0.010449Ucp2 0.000062
Acadm 0.035441Acadl 0.024568Pgc1a 0.000140Pparg 0.000840Srebf1 0.028756
Fasn 0.046089Scd1 1.014248
Acaca 0.020457Mixipl 0.029593mAco 0.017695
GluconeogenesisPck1 0.036408
G6pase 0.024008
17
Supplemental Table 6: Hepatic fatty-acid composition of mice fed a LF/LP, LF/HP, HF/LP or HF/HP diet for 3 weeks. Different letters indicate statistically significant differences between groups. Values are expressed as mean ± SEM (n=6 per group). P-values < 0.10 from the two-way ANOVA are shown on the right. n.s.: not significant (P>0.05).
LF/LP LF/HP HF/LP HF/HP 2-way ANOVAmmol/g protein HP HF HPxHF
C14:0 5.6±1.4 3.7±1.1 5.4±0.6 1.9±0.3 0.043 ns nsC15:0 0.9±0.1 0.8±0.2 1.3±0.2 0.6±0.1 0.045 ns 0.016C16:0 224.6±15.8 187.5±21.2 262.2±23.3 130.0±13.0 0.001 ns 0.015C17:0 1.40.1 1.1±0.2 2.0±0.2 1.3±0.1 0.045 0.018 nsC18:0 58.1±1.9 51.8±2.7 74.2±3.3 53.8±5.2 0.001 0.010 0.049C20:0 2.7±0.2 1.5±0.1 4.1±0.4 1.9±0.2 <0.001 0.001 0.015C22:0 2.8±0.1 2.0±0.1 3.6±0.2 2.2±0.3 <0.001 0.008 nsC24:0 3.2±0.7 3.9±1.3 2.2±0.7 4.5±1.2 ns ns ns
C18:3n3 0.6±0.1 0.7±0.2 2.5±0.4 0.6±0.0 0.002 0.001 <0.001C20:5n3 2.3±0.1 1.1±0.3 3.3±0.4 1.2±0.2 0.002 ns nsC22:5n3 0.9±0.3 0.8±0.3 1.2±0.1 3.5±2.6 ns ns nsC22:6n3 13.6±1.5 19.1±2.2 22.2±1.3 19.1±2.0 ns 0.043 0.014
C14:2n6 1.7±0.0 1.6±0.1 1.5±0.1 1.6±0.1 ns ns nsC18:2n6 48.1±4.6 43.4±4.4 134.6±15.4 67.0±5.3 0.002 <0.001 0.001C18:3n6 1.0±0.1 1.1±0.1 3.1±0.5 1.6±0.2 0.034 <0.001 0.017C20:2n6 0.5±0.0 0.5±0.1 1.5±0.1 0.8±0.1 0.001 <0.001 0.001C20:3n6 9.3±0.6 9.6±0.7 16.1±0.9 10.5±0.9 0.005 <0.001 0.001C20:4n6 40.2±4.0 52.0±3.6 66.5±2.4 61.3±5.7 ns 0.001 nsC22:4n6 0.8±0.1 1.0±0.2 1.3±0.1 1.1±0.1 ns ns nsC22:5n6 1.6±0.1 3.5±1.1 1.7±0.1 2.1±0.3 ns ns ns
C16:1n7 79.3±14.5 53.5±9.5 35.3±3.7 12.2±2.2 ns <0.001 nsC18:1n7 78.1±8.1 55.1±9.2 30.4±2.7 16.4±2.2 ns <0.001 ns
C16:1n9 12.5±2.3 7.7±1.3 28.2±3.9 8.2±1.1 <0.001 0.003 0.004C17:1 3.4±0.4 2.4±0.3 3.5±0.3 1.4±0.2 0.002 ns 0.031C18:1n9 514.6±35.6 330.4±64.5 852.0±99.7 302.5±31.5 <0.001 0.031 0.007C20:3n9 11.3±1.3 13.4±1.8 5.6±0.4 4.5±0.9 ns <0.001 nsC20:1n9 15.1±1.2 8.9±2.0 22.2±2.2 8.4±0.9 <0.001 ns 0.020C24:1n9 2.0±0.3 3.1±0.8 2.7±0.4 2.5±0.7 ns ns ns
total FA 1183.5±55.4 875.6±118.6 1605.6±154.6 735.6±65.3 <0.001 ns 0.011
15-MHDA 10.3±2.2 8.0±1.2 10.3±0.7 10.8±0.8 ns ns ns17-MODA 1.3±0.1 1.1±0.1 2.6±0.3 1.2±0.1 0.001 0.001 0.00214-MPDA 0.6±0.1 0.8±0.2 0.7±0.1 0.4±0.0 ns ns 0.03314-MHDA 0.8 0.7±0.3 0.4±0.1 0.5±0.1 ns ns ns
SFA 294±22 252±24 355±27 196±23 0.003 ns 0.019 MUFA 705±58 461±86 974±110 351±38 <0.001 ns 0.016 PUFA 141±4 149±12 259±19 173±15 0.019 <0.001 0.006 VLC-PUFA 22.5±1.6 28.7±3.9 32.4±2.0 29.4±4.6 ns ns ns
18
n6 PUFA 101±9 113±10 224±17 144±12 0.016 <0.001 0.002 n3 PUFA 18.7±1.2 21.7±2.3 29.2±1.9 24.3±3.9 ns 0.022 0.092
[n6]/ Σ [n3] ratio 5.9±0.3 5.2±0.5 7.7±0.2 6.3±0.6 0.027 0.005 ns[C16:1/C16:0] ratio 0.39±0.05 0.32±0.02 0.23±0.01 0.15±0.02 ns <0.001 ns[C18:1/C18:0] ratio 10.2±0.8 7.4±1.3 11.9±1.1 6.1±0.7 0.007 ns 0.076
[C16:1n7]/[C16:0] ratio 0.34±0.05 0.28±0.02 0.13±0.01 0.09±0.1 ns <0.001 ns[C18:1n9]/[C18:0] ratio 8.9±0.6 6.4±1.1 11.4±1.1 5.8±0.7 0.005 ns 0.053[C18:1]/[C16:1] ratio 7.5±1.5 6.3±0.3 14.0±0.6 16.5±1.6 ns <0.001 0.069[C22:4n6]/[C18:2n6] ratio 0.018±0.001 0.024±0.004 0.010±0.006 0.016±0.001 0.004 0.002 0.039[C20:4n6]/C20:3n6] ratio 4.2±0.2 5.4±0.2 4.1±0.2 5.8±0.8 <0.001 ns 0.046[C18:3n6]/[C18:2n6] ratio 0.023±0.004 0.024±0.002 0.023±0.002 0.024±0.001 ns ns ns
Definitions:SFA; n=0MUFA: n=1PUFA: n>2 VLC-PUFA: C>22 and n>2
19
Supplemental Table 7: Summary of effects of the LF/LP, LF/HP, HF/LP, and HF/HP diets on all measured parameters in mice. Colors indicate statistical significance (red: P<0.01; orange: 0.01<P<0.05; yellow: 0.05<P<0.09). Numbers indicate log2-fold change (e.g. 1 = 2-fold more; -1 = 2-fold less) of HP/LP (= HP effect) or HF/LF (= HF effect). n.d.: not detectable, italic: mRNA. The amino acids are identified by their 3-letter code.
log2 (ratio) effects (P-value)Biometric HP HF HP HF HPxHF
body weight (start) 0.01 0.03 0.995 0.208 0.18body weight (end) -0.06 0.03 0.024 0.179 0.888epididymal fat (g) -0.41 0.35 0.06 0.004 0.142energy intake (kcal/d) -0.15 0.06 0.001 0.164 0.006liver weight (% body weight) 0.04 -0.10 0.902 0.007 0.366weight loss (g) -3.76 -0.15 0.013 0.941 0.132
Plasmametabolites fasting glucose (4h) 0.05 0.40 0.968 0.01 0.713
fed glucose 0.22 0.11 0.025 0.528 0.62free fatty acids 0.04 -0.20 0.876 0.594 0.787cholesterol 0.02 0.22 0.948 0.039 0.577triglycerides 0.61 -0.78 0.254 0.013 0.569beta-hydroxy butyrate 0.64 0.26 0.109 0.555 0.734
hormones insulin -0.38 -0.10 0.142 0.873 0.456glucagon 0.14 -0.30 0.388 0.124 0.545leptin -0.22 0.18 0.483 0.536 0.313FGF21 -2.20 0.84 0.036 0.378 0.013insulin/glucagon-ratio -0.50 0.13 0.71 0.897 0.746
amino acids Asp -0.18 -0.25 0.304 0.054 0.001Glu 0.05 -0.44 0.483 0.032 0.189Asn -0.18 0.12 0.106 0.324 0.109Ser -0.14 0.00 0.028 0.544 0.269Gln -0.19 -0.05 0.099 0.412 0.015His 0.12 -0.06 0.3 0.42 0.183Gly -0.04 0.04 0.857 0.752 0.204Thr 0.10 -0.20 0.668 0.25 0.814Cit -0.11 -0.04 0.162 0.878 0.527Arg -0.09 0.01 0.283 0.951 0.212Ala -0.20 -0.02 0.213 0.921 0.254Tyr -0.27 0.05 0.259 0.861 0.063Tau 0.25 0.27 0.182 0.16 0.367Val 0.32 0.17 0.007 0.0126 0.705Met 0.06 0.04 0.349 0.633 0.92Ile 0.55 -0.05 0.001 0.52 0.34Phe 0.19 0.01 0.073 0.753 0.055Orn 0.21 -0.29 0.095 0.019 0.023Leu 0.47 -0.12 0.002 0.267 0.401Trp 0.07 -0.10 0.859 0.45 0.416Lys 0.14 -0.15 0.759 0.285 0.359BCAA 0.33 0.14 0.005 0.209 0.659total amino acids -0.04 0.01 0.709 0.983 0.163
acyl carnitines C0 -0.48 -0.14 0.002 0.259 0.993
20
C2 -0.62 -0.11 0.009 0 0.001C3 -0.63 -0.09 0.004 0.635 0.034C3 DC -0.42 -0.14 0.014 0.356 0.356C4 -1.37 -0.29 0.013 0.516 0.986C4 DC -0.42 0.36 0.071 0.117 0.521C4-3OH -0.31 0.08 0.448 0.84 0.601C5 0.04 -0.15 0.834 0.387 0.271C5OH 0.68 -0.31 0.001 0.051 0.709C5:1 nd ndC5 DC 0.51 0.43 0.21 0.285 0.21C5 3M3OH DC nd ndC6 nd nd 0.386 0.386 0.386C6 DC nd ndC8 -0.13 0.03 0.608 0.918 0.475C8 DC nd ndC10 nd ndC10 DC nd ndC10:1 nd ndC12 nd ndC12OH 0.09 0.28 0.723 0.297 0.297C12:1 nd ndC12:1OH nd ndC14 0.20 -0.43 0.473 0.147 0.046C14OH nd ndC14:1 -0.32 0.61 0.528 0.248 0.175C14:1OH nd ndC14:2 -0.27 0.05 0.292 0.829 0.829C16 0.39 -0.64 0.125 0.02 0.047C16OH nd ndC16:1 0.55 -0.67 0.155 0.091 0.069C16:1OH nd ndC18 0.07 0.34 0.777 0.173 0.777C18OH -0.07 0.03 0.508 0.776 0.126C18:1 0.20 0.46 0.596 0.237 0.376C18:1OH nd ndC18:2 -0.17 0.87 0.774 0.17 0.774C18:2OH nd ndacyl:free ratio -0.55 -0.07 0.005 0.642 0.291total acylcarnitines -0.60 -0.09 0.002 0.572 0.321sum short/medium chain (<C14) 0.16 0.14 0.654 0.689 0.402sum long chain (>C14) -0.50 -0.13 0.002 0.297 0.804C0/(C16+C18) ratio 0.64 0.97 0.075 ns ns
Livertriglycerides -1.55 0.78 0.000 0.002 0.033free fatty acids -1.16 0.42 0.000 0.027 0.111cholesterol -1.15 0.18 0.000 0.201 0.163phospholipids -0.86 0.23 0.000 0.085 0.075glucose 0.15 0.11 0.771 0.615 0.355glycogen 0.09 -0.18 0.440 0.862 0.497
Liver fatty-acid
21
fluxesC16:1n7/C16:0 ratio 0.79 0.35 0.316 <0.001 0.631C18:1/C16:1 ratio 0.61 1.02 0.612 <0.001 0.069C22:4n6/C18:2n6 ratio 1.43 0.62 0.250 0.002 0.039C20:4/C20:3 ratio 1.35 1.03 <0.001 0.841 0.046C18:3n6/C18:2n6 1.05 1.00 0.595 0.854 0.958
SignalingP-AMPK/total AMPK -0.10 0.13 0.599 0.493 0.429P-eIF2α/total eIF2α -1.00 -0.13 0.019 0.73 0.089P-AKT/total AKT -0.23 -0.06 0.139 0.998 0.826P-4EBP1/total 4EBP1 0.09 0.06 0.927 0.073 0.145P-P70S6K/P70S6K -0.36 0.54 0.219 0.174 0.987P-ACACβ/total ACACβ 0.01 -0.26 0.532 0.135 0.93
Mitochondrial biogenesisCitrate synthase activity [U/mg] 0.07 -0.12 0.944 0.104 0.280mtDNA copy nr (Nd1/18S) 0.07 -0.12 0.207 0.001 0.018
OXPHOS complex 5 (ATP-synthase) 0.22 0.20 0.043 0.201 0.574complex 4 (cytochrome c oxidase) 0.19 -0.06 0.860 0.790 0.795complex 3 (cytochrome c reductase) 0.36 0.55 0.459 0.252 0.855complex 2 (succinate dehydrogenase) 0.03 0.05 0.556 0.839 0.684complex 1 (NADH dehydrogenase) 0.31 0.20 0.585 0.627 0.403
LipogenesisPparγ -0.79 0.26 0.051 0.431 0.265Srebf1 -0.28 -0.09 0.737 0.804 0.748Fasn -0.39 -0.84 0.617 0.068 0.771Scd1 -0.34 -0.94 0.814 0.012 0.966Acacα -0.58 -0.64 0.338 0.113 0.741Mixipl 0.19 -0.41 0.221 0.012 0.289Adrp -0.16 -0.21 0.086 0.457 0.217
Fatty-acid oxidationPparα -0.39 0.42 0.331 0.156 0.494Pgc1α 1.33 0.05 0.03 0.935 0.627Cpt1 0.48 -0.14 0.049 0.56 0.912Acox 0.06 -0.05 0.685 0.755 0.557Foxo1 0.36 0.18 0.183 0.488 0.446Lcad 0.06 0.01 0.809 0.889 0.888Mcad -0.16 -0.08 0.067 0.077 0.596Ucp2 0.02 -0.11 0.052 0.331 1.000mAco 1.30 0.51 0.02 0.013 0.656
CholesterolCyp7a1 0.28 0.49 0.402 0.424 0.882Srebp2 -0.08 0.27 0.452 0.786 0.482Hmgcr 0.22 -0.29 0.465 0.529 0.472
GluconeogenesisPCK1 1.91 0.12 0.001 0.974 0.641Pck1 0.47 0.47 0.183 0.345 0.348
22
G6Pase (periportal) 0.05 -0.13 0.367 0.27 0.597G6Pase (pericentral) -0.06 0.02 0.661 0.545 0.441G6pc -0.36 -0.03 0.599 0.862 0.801
Ketone bodiesHmgcs2 -0.28 0.28 0.656 0.432 0.614
Urea cycleArg1 0.52 -0.27 0.044 0.281 0.637Ass 1.34 -0.20 0.000 0.426 0.811
InflammationITGAM score* -0.06 -0.67 0.911 0.254 0.709Tlr 4 0.37 -0.10 0.206 0.717 0.891Tnfα 0.86 -0.99 0.112 0.071 0.268Cd68 0.34 -0.48 0.176 158 0.248Mcp1 -1.48 -0.07 0.022 0.971 0.792Itgam (Cd11b) -0.54 -0.12 0.067 0.675 0.09P-NFκB/total NFκB -0.29 -0.18 0.068 0.547 0.127
Fat export/importApob -0.06 -0.07 0.667 0.652 0.416Mttp -0.03 -0.29 0.859 0.099 0.824Cd36 0.14 -0.31 0.508 0.156 0.472
LipolysisLipc 0.07 -0.17 0.749 0.396 0.306Pnlip 0.03 0.04 0.881 0.875 0.354
Cell stressspliced Xbp1 -0.56 0.08 0.082 0.487 0.899Xbp1 -0.19 -0.18 0.297 0.321 0.474spliced Xbp/total XBP1 -0.48 0.50 0.265 0.241 0.998Gadd34 0.10 -0.05 0.732 0.211 0.064Ddit3 -0.61 -0.08 0.068 0.247 0.117Asns 0.21 -1.29 0.620 0.000 0.414Clec2 0.95 -0.03 0.025 0.94 0.414Fgf21 -2.42 -1.31 0.031 0.181 0.177
Insulin signalingPtp1b 0.40 -0.02 0.133 0.936 0.603
23
Supplemental Table 8: Plasma acyl-carnitine levels in mice fed diets differing in protein and fat content for 3 weeks. Values are expressed as mean ± SEM (n=3 per group; plasma of 2 mice were pooled). P-values < 0.1 from the two-way ANOVA are shown on the right. n.s.: not significant (P>0.05). n.d.: non-detectable.
LF/LP LF/HP HF/LP HF/HP ANOVA (P-values)HP HF HPxHF
C0 [mM] 31.9±2.4 23.1±1.5 29.2±1.8 20.6±0.6 0.002 0.259 0.993C2 [mM] 5.4±0.4 3.9±0.2 5.5±0.6 3.2±0.4 0.001 0.486 0.353C3 [μM] 175.0±13.4 153.3±8.8 212.5±35.1 96.6±6.7 0.004 0.635 0.034C3 DC (malonyl carnitine) [μM] 20.0±0.1 16.6±3.3 20.0±0.1 13.3±3.3 0.014 0.356 0.356C4 [μM] 580.0±48.1 246.6±8.8 502.5±78.1 173.3±8.8 0.013 0.516 0.986C4 3OH [μM] 75±4.3 70±10.0 90.0±28.9 63.3±23.3 n.s. n.s. n.s.C4 DC [μM] 41.6±3.1 26.6±13.3 47.5±2.9 40.0±0.1 n.s. n.s. n.s.C5 [μM] 80.0±6.8 93.3±14.5 82.5±11.9 73.3±6.7 n.s. n.s. n.s.C5 OH [μM] 56.6±6.1 90.0±0.1 45.0±5.8 73.3±8.8 0.001 0.049 0.709C5 DC [μM] 13.3±2.1 13.3±3.3 12.5±2.9 23.3±8.8 n.s. n.s. n.s.C5 3M3OH DC [μM] n.d. n.d. n.d. n.d. n.s. n.s. n.s.C5:1 [μM] 1.6±1.7 3.3±0.3 n.d. 3.3±3.3 n.s. n.s. n.s.C6 [μM] 13.3±2.1 13.3±3.3 27.5±16.6 13.3±3.3 n.s. n.s. n.s.C6 DC[μM] 8.3±1.7 10±5.8 15.0±5.8 6.6±3.3 n.s. n.s. n.s.C8 [μM] 25.0±2.2 20.0±0.1 22.5±7.3 23.3±3.3 n.s. n.s. n.s.C8 DC [μM] n.d. 3.3±0.3 2.5±2.9 n.d. n.s. n.s. n.s.C10 [μM] 10.0±0.1 10.0±0.1 15.0±5.8 10.0±0.1 n.s. n.s. n.s.C10:1[μM] n.d. n.d. 2.5±2.9 n.d. n.s. n.s. n.s.C10 DC [μM] 5.0±2.2 n.d. 7.5±5.5 6.6±3.3 0.155 0.08 0.07C12 [μM] 10.0±0.1 10.0±0.1 17.5±5.5 10.0±0.1 n.s. n.s. n.s.C12 OH [μM] 10.0±0.1 13.3±3.3 15.0±3.3 13.3±3.3 n.s. n.s. n.s.C12:1[μM] 1.6±1.7 3.3±0.3 2.5±2.9 3.3±0.3 n.s. n.s. n.s.C12:1 OH [μM] n.d. 3.3±0.3 n.d. n.d. n.s. n.s. n.s.C14 [μM] 28.3±3.1 46.6±6.7 32.5±10.9 23.3±3.3 n.s. n.s. n.s.C14OH [μM] n.d. 3.3±3.3 n.d. n.d. n.s. n.s. n.s.C14:1[μM] 28.3±3.1 40.0±5.8 67.5±31.8 36.6±3.3 n.s. n.s. n.s.C14:1 OH [μM] 5.0±2.2 6.6±3.3 10.0±4.7 10.0±0.1 n.s. n.s. n.s.C14:2 [μM] 11.6±1.7 10.0±0.1 12.5±2.9 10.0±0.1 n.s. n.s. n.s.C16 [μM] 106.6±15.4 180.0±16.3 97.5±20.2 86.6±12.0 0.125 0.02 0.047C16 OH [μM] 5.0±2.2 6.6±3.3 2.5±2.9 n.d. n.s. n.s. n.s.C16:1[μM] 33.3±6.1 70±11.5 35.0±17.3 30.0±5.8 n.s. n.s. n.s.C16:1 OH [μM] 3.3±2.1 6.6±3.3 2.5±2.9 6.6±3.3 n.s. n.s. n.s.C18 [μM] 30.0±4.5 33.3±3.3 40.0±8.2 40.0±5.8 n.s. n.s. n.s.C18OH [μM] 6.6±2.1 6.6±3.3 5.0±3.3 3.3±3.3 n.s. n.s. n.s.C18:1 [μM] 131.6±21.8 206.6±33.8 242.5±96.0 223.3±44.8 n.s. n.s. n.s.C18:1 OH [μM] 5.0±2.2 10.0±5.8 12.5±2.9 10.0±0.1 n.s. n.s. n.s.C18:2 [μM] 8.3±1.7 10.0±0.1 20.0±11.5 16.6±3.3 n.s. n.s. n.s.C18:2 OH [μM] n.d. n.d. n.d. n.d. n.s. n.s. n.s.C0/(C16+C18) 261±46 146±44 228±37 167±17 0.075 n.s. n.s.Acyl/free carnitine ratio 0.2±0.1 0.2±0.1 0.2±0.1 0.2±0.1 n.s. n.s. n.s.Total acyl-carnitine 6.8±0.5 5.3±.0.1 7.2±1.0 4.3±0.5 0.005 0.6 0.291Sum short/medium chain (<C14) 6.6±0.1 4.8±0.1 6.7±0.2 3.9±0.1 0.002 0.6 0.321Sum long chain (≥C14) 0.2±0.3 0.3±0.8 0.3±0.4 0.3±0.4 n.s. n.s. n.s.
24
Supplemental Table 9: Plasma amino-acid levels in mice fed diets differing in protein and fat content for 3 weeks. The amino acids are identified by their 3-letter code (Cit: citrulline, Tau: taurine, Orn: ornithine). Values are given in µmoles/L. Values are expressed as mean ± SEM n=7-10 per group. P-values < 0.1 from the two-way ANOVA are shown on the right. n.s.: not significant (P>0.05).
[µM] LF/LP LF/HP HF/LP HF/HP ANOVAHP HF HP*HF
Asp 31.3±2.6 40.1±4.6 36.9±2.1 21.3±4.4 n.s. n.s. n.s.Glu 20.5±1.1 26.7±7.8 17.7±1.3 15.8±1.4 n.s. n.s. n.s.Asn 51.2±3.1 51.1±8.1 63.7±4.2 48.0±4.3 n.s n.s n.sSer 276.0±13.5 226.3±7.1 268.6±11.3 251.4±11.3 n.s n.s n.sGln 567.6±23.3 595.0±50.2 622.4±30.1 487.6±22.9 n.s. n.s. n.s.His 77.8±3.3 92.3±12.2 81.1±5.1 79.3±1.2 n.s n.s n.sGly 457.4±16.8 483.8±49.2 495.6±14.2 460.6±17.6 n.s n.s n.sThr 213.7±19.5 209.6±36.8 194.3±9.8 180.4±13.9 0.6 0.03 0.8Cit 56.2±4.3 52.6±5.5 58.3±2.1 49.1±5.3 n.s n.s n.sArg 75.9±5.2 76.9±6.7 83.3±4.4 70.1±5.1 n.s n.s n.sAla 515.9±36.0* 511.4±52.4 558.8±35.9 460.3±32.1 n.s n.s n.sTyr 205.4±20.0 218.8±12.9 241.7±11.9 188.6±10.0 n.s n.s n.sTau 147.0±13.6 198.2±32.6 199.8±18.1 209.9±30.5 0.04 0.3 0.4Val 153.7±10.3 188.5±8.5 170.0±10.1 215.1±18.3 <0.001 0.07 0.03Met 61.4±6.5 54.3±7.2 63.9±4.4 58.2±7.5 n.s n.s n.sIle 68.5±6.4 106.9±15.6 71.1±4.6 93.9±6.4 <0.001 0.04 0.01Phe 49.1±3.4 64.6±7.0 55.9±1.1 55.3±3.5 0.2 0.05 0.005Orn 84.3±3.9 121.7±23.5 83.5±4.4 77.4±3.1 n.s. n.s n.sLeu 85.4±7.4 124.8±17.8 82.8±5.4 106.6±6.7 <0.001 0.002 0.007Trp 201.6±15.2 212.7±23.6 202.6±12.8 185.3±17.1 n.s n.s n.sLys 346.6±32.1 391.2±53.9 340.9±25.1 318.6±33.2 n.s n.s n.sΣ BCAA 301.7±23.5 370.1±24.2 323.8±18.7 415.7±29.9 <0.001 0.07 0.02Σ amino acids 3585.7±198.2 3431.0±153.6 3812.8±193.0 3626.9±159.7 n.s. n.s n.s
25
References
[1] J.M. Ruijter, C. Ramakers, W.M. Hoogaars, Y. Karlen, O. Bakker, M.J. van den Hoff, A.F. Moorman, Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data, Nucleic Acids Res, 37 (2009) e45.
[2] B.J. van den Bosch, C.M. van den Burg, K. Schoonderwoerd, P.J. Lindsey, H.R. Scholte, R.F. de Coo, E. van Rooij, H.A. Rockman, P.A. Doevendans, H.J. Smeets, Regional absence of mitochondria causing energy depletion in the myocardium of muscle LIM protein knockout mice, Cardiovasc Res, 65 (2005) 411-418.
[3] A. Hem, A.J. Smith, P. Solberg, Saphenous vein puncture for blood sampling of the mouse, rat, hamster, gerbil, guineapig, ferret and mink, Lab Anim, 32 (1998) 364-368.
[4] F.G. Schaap, A.E. Kremer, W.H. Lamers, P.L. Jansen, I.C. Gaemers, Fibroblast growth factor 21 is induced by endoplasmic reticulum stress, Biochimie, (2012).
[5] H.M. van Eijk, D.R. Rooyakkers, N.E. Deutz, Rapid routine determination of amino acids in plasma by high-performance liquid chromatography with a 2-3 microns Spherisorb ODS II column, J Chromatogr, 620 (1993) 143-148.
[6] P. Vreken, A.E. van Lint, A.H. Bootsma, H. Overmars, R.J. Wanders, A.H. van Gennip, Quantitative plasma acylcarnitine analysis using electrospray tandem mass spectrometry for the diagnosis of organic acidaemias and fatty acid oxidation defects, J Inherit Metab Dis, 22 (1999) 302-306.
[7] R. Shiri-Sverdlov, K. Wouters, P.J. van Gorp, M.J. Gijbels, B. Noel, L. Buffat, B. Staels, N. Maeda, M. van Bilsen, M.H. Hofker, Early diet-induced non-alcoholic steatohepatitis in APOE2 knock-in mice and its prevention by fibrates, J Hepatol, 44 (2006) 732-741.
[8] G. Dacremont, G. Vincent, Assay of plasmalogens and polyunsaturated fatty acids (PUFA) in erythrocytes and fibroblasts, J Inherit Metab Dis, 18 Suppl 1 (1995) 84-89.
[9] R. Koopman, G. Schaart, M.K. Hesselink, Optimisation of oil red O staining permits combination with immunofluorescence and automated quantification of lipids, Histochem Cell Biol, 116 (2001) 63-68.
[10] E. Wisse, F. Braet, H. Duimel, C. Vreuls, G. Koek, S.W. Olde Damink, M.A. van den Broek, B. De Geest, C.H. Dejong, C. Tateno, P. Frederik, Fixation methods for electron microscopy of human and other liver, World J Gastroenterol, 16 (2010) 2851-2866.
[11] H.R. Gosker, P. Schrauwen, R. Broekhuizen, M.K. Hesselink, E. Moonen-Kornips, K.A. Ward, F.M. Franssen, E.F. Wouters, A.M. Schols, Exercise training restores uncoupling protein-3 content in limb muscles of patients with chronic obstructive pulmonary disease, Am J Physiol Endocrinol Metab, 290 (2006) E976-981.
[12] X. Tong, M. Muchnik, Z. Chen, M. Patel, N. Wu, S. Joshi, L. Rui, M.A. Lazar, L. Yin, Transcriptional repressor E4-binding protein 4 (E4BP4) regulates metabolic hormone fibroblast growth factor 21 (FGF21) during circadian cycles and feeding, J Biol Chem, 285 (2010) 36401-36409.
[13] J.L. Estall, J.L. Ruas, C.S. Choi, D. Laznik, M. Badman, E. Maratos-Flier, G.I. Shulman, B.M. Spiegelman, PGC-1alpha negatively regulates hepatic FGF21 expression by modulating the heme/Rev-Erb(alpha) axis, Proc Natl Acad Sci U S A, 106 (2009) 22510-22515.
[14] S.H. Back, M. Schroder, K. Lee, K. Zhang, R.J. Kaufman, ER stress signaling by regulated splicing: IRE1/HAC1/XBP1, Methods, 35 (2005) 395-416.