Developmental Biology 341 (2010) 236–245

Contents lists available at ScienceDirect

Developmental Biology

j ourna l homepage: www.e lsev ie r.com/deve lopmenta lb io logy

Stimulation of chondrocyte hypertrophy by chemokine stromal cell-derived factor 1in the chondro-osseous junction during endochondral bone formation

Lei Wei a,c,⁎, Katsuaki Kanbe b, Mark Lee a, Xiaochun Wei c, Ming Pei d, Xiaojuan Sun a,Richard Terek a, Qian Chen a

a Department of Orthopaedics, The Warren Alpert Medical School of Brown University/Rhode Island Hospital, Suite 402A, 1 Hoppin Street, Providence RI 02903, USAb Department of Orthopaedic Surgery, Tokyo Women's Medical University, Daini Hospital, 2-1-10 Nishiogu, Arakawa-ku, Tokyo 116-8567, Japanc Department of Orthopaedics, The Second Hospital. Shanxi Medical University, Taiyuan, Shanxi, 030001, PR Chinad Department of Orthopaedics, West Virginia University, Morgantown, WV 26506, USA

⁎ Corresponding author. Department of OrthopaedicSchool of Brown University/Rhode Island Hospital,Providence RI 02903, USA.

E-mail addresses: Lei_Wei@brown.edu (L. Wei), Qia

0012-1606/$ – see front matter © 2010 Elsevier Inc. Adoi:10.1016/j.ydbio.2010.02.033

a b s t r a c t

a r t i c l e i n f o

Article history:Received for publication 10 September 2009Revised 20 February 2010Accepted 23 February 2010Available online 4 March 2010

Keywords:SDF-1/CXCR4Chondrocyte differentiationGrowth plate

During endochondral bone formation, chondrocytes undergo differentiation toward hypertrophy before theyare replaced by bone and bone marrow. In this study, we found that a G-protein coupled receptor CXCR4 ispredominantly expressed in hypertrophic chondrocytes, while its ligand, chemokine stromal cell-derivedfactor 1 (SDF-1) is expressed in the bone marrow adjacent to hypertrophic chondrocytes. Thus, they areexpressed in a complementary pattern in the chondro-osseous junction of the growth plate. Transfection ofa CXCR4 cDNA into pre-hypertrophic chondrocytes results in a dose-dependent increase of hypertrophicmarkers including Runx2, Col X, and MMP-13 in response to SDF-1 treatment. In organ culture SDF-1infiltrates cartilage and accelerates growth plate hypertrophy. Furthermore, a continuous infusion of SDF-1into the rabbit proximal tibial physis results in early physeal closure, which is accompanied by a transientelevation of type X collagen expression. Blocking SDF-1/CXCR4 interaction suppresses the expression ofRunx2. Thus, interaction of SDF-1 and CXCR4 is required for Runx2 expression. Interestingly, knocking downRunx2 gene expression results in a decrease of CXCR4 mRNA levels in hypertrophic chondrocytes. Thissuggests a positive feedback loop of stimulation of chondrocyte hypertrophy by SDF-1/CXCR4, which ismediated by Runx2.

s, The Warren Alpert MedicalSuite 402A, 1 Hoppin Street,

n_Chen@brown.edu (Q. Chen).

ll rights reserved.

© 2010 Elsevier Inc. All rights reserved.

Introduction

All long bones in the vertebrate limb are developed through aprocess called endochondral bone formation, in which bone is formedfrom a cartilage anlage. The growth of the cartilage anlage, which iscalled a growth plate, determines the size and shape of the long bone.This morphogenic process is uniquely regulated by pathways withinthe growth plate and tissues adjacent to the growth plate cartilage.One of these neighboring tissues is the bone marrow located at thebase of the growth plate adjacent to the hypertrophic zone.

The hypertrophic chondrocyte is an important regulatory cellduring endochondral bone formation because bone lengthening isdriven primarily by the rate of differentiation of the hypertrophicchondrocytes from proliferating chondrocytes. Type X collagen andmatrix metalloprotease 13 (MMP-13) are well-known molecularmarkers up-regulated during chondrocyte hypertrophy (Schmid and

Linsenmayer, 1985),while Runt-related transcription factor 2 (Runx2)is a transcription factor that promotes chondrocyte hypertrophy(Wang et al., 2004). Runx2(−/−) mice lack hypertrophic chondro-cytes, while targeted expression of Runx2 in non-hypertrophicchondrocytes accelerates chondrocyte differentiation and leads tomaturation of chondrocytes that do not normally become hypertro-phic (Ducy et al., 1997; Komori et al., 1997). Previous studies haveshown that the degradation of hypertrophic cartilage requires thepresence of bone marrow (Cole et al., 1992). However, the molecularmechanism of this induction remains elusive.We hypothesize that theinduction of hypertrophic matrix degradationmay involve chemokinestromal cell-derived factor 1 (SDF-1) secreted by cells in the bonemarrow area adjacent to the hypertrophic cartilage in the chondro-osseous junction.

Chemokines are soluble peptides that regulate cell movement,morphology, proliferation, and differentiation (Pulsatelli et al., 1999).Chemokines achieve their regulation by signaling through a family ofseven transmembrane G-protein coupled receptors. SDF-1 is an 8 kDapeptide originally isolated from a bone marrow stromal cell line (Joet al., 2000), which activates various primary cells by binding solely toits receptor, CXCR4 (Mohle et al., 1998; Pulsatelli et al., 1999). SDF-1is also found in other cells, including endothelial cells and osteoblasts

237L. Wei et al. / Developmental Biology 341 (2010) 236–245

(Jung et al., 2006; Kollet et al., 2003; Sun et al., 2005). It has beenshown previously that SDF-1 and its receptor CXCR4 play an im-portant role in cell migration, embryonic development, and humanimmunodeficiency virus infection. SDF-1 signaling is importantduring development and morphogenesis, as both SDF-1 and CXCR4knockout mice exhibit significant developmental abnormalities thatlead to embryonic lethality (Ma et al., 1998). The goal of this studyis to determine the distribution pattern of SDF-1 and its receptorCXCR4 in the growth plate, and to determine whether SDF-1/CXCR4signaling regulates chondrocyte differentiation during endochondralbone formation.

Materials and methods

Generation of retrovirus containing CXCR4 cDNA

CXCR4 cDNA was cloned into a myc-tagged retroviral vector(RCAS) by RT-PCR from total RNA isolated from chick sternal cartilagewith primers 5′-CAT GCC ATG GCA ATG GAC GGT TTG GAT-3′, and 5′-CAT GCC ATG GCA GCT GGA ATG GAA ACT TGA-3′ (sequence from 60to 1133), designed according to a DNA sequence from GenBank™(accession number AF294794) (Table 1). PCR products were digestedwith ClaI and ligated into a RCAS vector. RCAS–CXCR4 was sequencedto ensure no spontaneous mutations during subcloning. CDNAs con-tained myc as a marker of the exogenously transfected product.CXCR4–RCAS and empty RCAS vector were transfected into chickenembryonic fibroblasts respectively, and the virus was harvested fromthe medium as previously described (Chen et al., 1995). Medium fromfibroblasts not transfected (mock) was also collected as a control.

Primary chick chondrocyte isolation and culture

Primary cultures of chick embryonic chondrocytes were estab-lished as described previously (Chen et al., 1995; Gibson and Flint,1985). Caudal (proliferative), middle (pre-hypertrophic), and cephal-ic (hypertrophic) parts of the sterna from 17-day-old embryonicchickens were separated under a dissection microscope. They weresubjected to enzymatic treatment with 0.1% trypsin (Sigma-Aldrich,St. Louis, MO), 0.3% collagenase (Worthington, Freehold, NJ), and0.1% type 1 testicular hyaluronidase (Sigma-Aldrich, St. Louis, MO)(dissociation medium). After incubating for 30 min. at 37 °C, the dis-sociation medium was removed and replaced with fresh dissociationmedium and incubated at 37 °C for an additional 1 h. Chondrocyteswere resuspended in plating medium plus 0.01% testicular hyaluron-

Table 1

Gene Primer Sequence

RT-PCR oligonucleotide primer sequences used for detection of target genes' mRNACXCR4(1073 bp)

Forward 5′-CAT GCC ATG GCA ATG GAC GGT TTG GAT-3′Reverse 5′-CAT GCC ATG GCA GCT GGA ATG GAA ACT TGA-3′

MMP-13(1280 bp)

Forward 5′-ATT TAA CGT ACA GAA TTA TGA GTT ACA CAT-3′Reverse 5′-TTC CTT CCT GTT TTC CTA TTA ATT TAA TGC-3′

GPDH(1001 bp)

Forward 5′-ATG GTG AAA GTC GGA GTC AAC GGA TTT-3′Reverse 5′-TCA CTC CTT GGA TGC CAT GTG GAC CAT CAA-3′

Real time RT-PCR oligonucleotide primer sequences used for quantification detection oftarget genes' mRNAMMP-13(150 bp)

Forward 5′-CCCCTTTGATGGACCCTCTGG-3′Reverse 5′-TGGCCAAATTCATGAGCAGCA-3′

CXCR4(167 bp)

Forward 5′-ACCGGATCTTCTTGCCAACCAT-3′Reverse 5′-TGGCAAGGTGATGACAAAGAGG-3′

Type X collagen(82 bp)

Forward 5′-AGT GCT GTC ATT GAT CTC ATG GA-3′Reverse 5′-TCA GAG GAA TAG AGA CCA TTG GAT T-3′

Runx2(181 bp)

Forward 5′-CTT CGC CGT CCA TTC ACT CC-3′Reverse 5′-GTG CAT TCG TGG GTT GGA GA-3′

18S RNA(186 bp)

Forward 5′-CGGCTACCACATCCAAGGAA-3′Reverse 5′-GCTGGAATTACCGCGGCT-3′

idase (plating medium: 10% fetal bovine serum in Ham F-12 medium;Gibco, Grand Island, NY). After culturing overnight, the medium ofthe chondrocyte culture was replaced with fresh medium withouthyaluronidase. Medium was changed every other day.

Chondrocyte cell transfection

Primary chicken chondrocytes were cultured as previously de-scribed (Chen et al., 1995). When cell cultures became 50% confluent,cells were infected with retrovirus conditional medium containingRCAS/CXCR4, or empty RCAS, or mock (no virus). After a four-dayincubation, transfected cells were analyzed by immunocytochemistrywith a mAb against myc-tag (9B11 Cell signaling, Danvers, MA) toconfirm the infection. Before collecting samples for experiment, thecells were stimulated with SDF-1 (100 ng/mL; Cat# 351-FS, R&DSystems, Inc. Minneapolis, MN) for 24 h or pretreated with AMD3100for 2 h (5 µg/mL; Cat# 155148-31-5, Sigma-Aldrich, St. Louis, MO),a specific inhibitor for CXCR4, before stimulation with SDF-1. In somecases, the cells were transfected with full length Runx2 cDNA plasmid(a gift from Dr. D. Chen, Rochester University) or Runx2-siRNA(Dharmacon Com. Lafayette, CO).

Immunocytochemistry

After a four-day incubation, transfected cells were analyzed byimmunocytochemistry with a mAb against myc-tag (1:200, Cat# 9B11,Cell Signaling, Danvers, MA). The transfected cells on 8 chamber poly-styrene vessel tissue culture treated glass slides (REF 354108, BD Bio-sciences, Bedford, MA) were fixed at−20 °C with 70% ethanol, 50 mMglycine, and pH 2.0 for 20 min. Slides were then washed with PBS andincubated with primary antibodies. After washing with PBS, affinity-purified TRITC conjugated donkey anti-mouse antibodies (1:500,Jackson ImmunoResearch, West Grove, PA) were applied with Hoechstnuclear dye (0.5 mg/mL). Slides were washed and mounted in 95%glycerol in PBS. Single or multiple exposure photography was per-formed with a Nikon E800 microscope (Melville, NY).

Organ culture

Whole sterna were isolated from 15-day-old embryonic chickensand cultured in HBSS containing synthetic SDF-1 peptide (100 ng/mL;351-FS, R&D Systems, Inc. Minneapolis, MN) for 1 h, 3 h, and 24 h.Tibia growth plates were isolated from 12-day-old embryonic chickenand cultured in F12 containing 10% FBS and, synthetic SDF-1 peptide(100 ng/mL) for 2, 4, and6 days. The sampleswere collected, embeddedin Tissue Tek (Sakura Finetechanical Co., Ltd., Tokyo, Japan), andsubjected to frozen sectioning. Ten µm sections were analyzed byimmunohistochemistrywith amAbagainst SDF-1 (25 µg/mL;MAB310,R&D Systems, Inc. Minneapolis, MN) or with a mAb against type Xcollagen (1:2 dilution; Cat# X-AC-9, Developmental Studies HybridomaBank, Iowa City, IA). To detect the distribution of Runx2 in growth plate,10 µm sections from one-day-old mice tibia growth plates (C57BL/6)were analyzed by immuno-fluorescent stainingwith a rabbit Ab againstRunx2 (1:200; Cat# AB/RNT20, CeMines, Inc. Golden, Co.). The sectionswere fixed at−20 °C with 70% ethanol, 50 mM glycine, and pH 2.0 for20 min. Slides were then washed with PBS and incubated with primaryantibody. After washing with PBS, affinity-purified TRITC conjugateddonkey anti-mouse antibody or affinity-purified FITC conjugateddonkey anti-rabbit antibody (1:500, Jackson ImmunoResearch, WestGrove, PA) was applied with Hoechst nuclear dye (0.5 mg/mL). Thesections were washed and mounted in 95% glycerol in PBS. Singleor multiple exposure photography was performed with a Nikon E800microscope (Melville, NY).

Fig. 1. Distribution of SDF-1 and CXCR4 in the growth plate. Immunohistochemical staining for CXCR4 and SDF1 was performed on one-day-old mouse proximal tibial growth plates.CXCR4 expression was strongest in the hypertrophic zone (red color) (A), while SDF-1 was most strongly expressed in bone marrow (red color) adjacent to the hypertrophicchondrocytes(B). Scale bar=20 µm.

Fig. 2. Expressions of CXCR4, type X, and Runx2 in proliferative, pre-hypertrophic, andhypertrophic chondrocytes. Total RNA was isolated from three different zones of 17-day-old chicken embryonic sterna and qRT-PCR was carried out to quantitate CXCR4mRNA. CXCR4 mRNA was much higher in hypertrophic chondrocytes than inproliferative and pre-hypertrophic chondrocytes (A), similar to the up-regulation ofhypertrophic markers type X collagen and Runx2 (B). Bar graphs show the averages ofquantified data from three independent experiments using Real time PCR. *: pb0.05compared to proliferative chondrocytes.

238 L. Wei et al. / Developmental Biology 341 (2010) 236–245

Immunohistochemistry

To detect the distribution of CXCR4 and SDF-1 in growth plate, theknee joints from one-day-old mice (C57BL/6) were fixed overnight in4% paraformaldehyde in phosphate-buffered saline (pH 7.4), dehy-drated in ethanol, cleared in xylene, and embedded in paraffin. Tenµm sections were prepared and collected on positively charged glassslides (Superfrost Plus, Fisher Scientific). The sections were dried on ahot plate to increase adherence to the slides. Immunohistochemistrywas carried out using the Histostain-SP Kits (Zymed, Cat# 95-9943).Sections were de-paraffined and re-hydrated through conventionalmethods. Endogenous peroxidase was blocked by treating the sec-tions with 3% hydrogen peroxide in methanol for 30 min. The sectionswere digested by 5 mg/mL hyaluronidase (Cat# H3506, Sigma-Aldrich, St. Louis, MO) for 20 min. Nonspecific protein binding wasblocked by incubation with a serum blocking solution. The sectionswere incubated with affinity-isolated Ig G fractions of monoclonalmouse Ab against human CXCR4 (25 µg/mL; Cat# MAB171 R&DSystems, Inc., Minneapolis, MN) and a mAb against SDF-1 (25 µg/mL;Cat# MAB310 R&D Systems, Inc., Minneapolis, MN) respectively at4 °C overnight. The negative control sections were incubated withisotype control (25 µg/mL; Cat# MAB002 R&D Systems, Inc., Min-neapolis, MN) in 0.01 M PBS. Thereafter, the sections were treatedsequentially with ready to use biotinylated secondary antibody andready to use streptavidin–peroxidase conjugate (Zymed), and then

239L. Wei et al. / Developmental Biology 341 (2010) 236–245

were followed by standardized development in AEC chromogen(Zymed). The sections were counterstained with ready to use hema-toxylin (Zymed). Photography was performed with a Nikon E800microscope (Melville, NY).

Reverse transcriptase-polymerase chain reaction (RT-PCR)

Seventeen-day-old embryonic chicken sterna were separated intothree parts under a dissection microscope: lower third/caudal (prolif-erative zone), middle (pre-hypertrophic zone), and upper third/ce-phalic (hypertrophic zone). Total RNA was extracted from each zoneusing RNeasy mini kit (Qiagen, Valencia, CA) according to themanufacturer's protocol. First-strand complementary DNA (cDNA)was made from 1 µg of total RNA with Superscript II reverse tran-scriptase (Gibco BRL) following the manufacturer's protocol. Primers

Fig. 3. SDF-1/CXCR4 induction of chondrocyte hypertrophy. To determine whether SDF-1chondrocytes was infected with chicken fibroblast conditional medium containing RCAS–CXexpression in proliferative chondrocytes transfected with RACS–CXCR4 was detected by immred color for CXCR4). qRT-PCR was performed for MMP-13 (B) and type X collagen (C). MMchondrocytes transfectedwith RCAS–CXCR4with SDF-1 in a dose-dependent manner. Similaof quantified data of type X collagen using Real time PCR from three independent experimenbar=20 µm. CECs: chicken embryonic proliferative chondrocytes.

used in amplification of target genes mRNA are shown in Table 1. PCRreactions were performed as follows: 40 cycles with the GoldTaq PCRsystem (Perkin Elmer, Norwalk, CT) at 94 °C for 30 s, 50 °C for 1 min,and 72 °C for 2 min. GAPDH housekeeping genemRNAwas amplified atthe same time as the internal control. The amplified cDNA fragmentswere detected by electrophoresis in 1.2% (weight/volume) agarose gels.

Real time PCR

After cells were incubated with SDF-1 for 24 h, total RNA wasisolated with the RNeasy mini kit (QIAGEN). One µg total of RNA wasreverse transcribed with the iScript™ cDNA Synthesis Kit (Bio-Rad,Hercules, CA). Real time quantitative PCR amplificationwas performedusing the QuantiTect SYBR Green PCR kit (QIAGEN, Valencia, CA) withthe DNA Engine Opticon 2 Continuous Fluorescence Detection System

/CXCR4 signaling induces chondrocytes hypertrophy, 50% confluency of proliferativeCR4 or RCAS alone for 4 days and then treated with 100 ng SDF-1/mL for 1 day. CXCR4uno-fluorescent staining with myc-tag antibody but not in RACS transfected group (A,P-13 and type X collagen mRNA expression increased after treatment of proliferative

r results were observed in three experiments for mmp-13. Bar graphs show the averagests. *: Significant difference in comparison to the non-SDF-1 treated group, pb0.05. Scale

Fig. 4. SDF-1 can diffuse into cartilage. To determine whether SDF-1 can diffuse intocartilage, 17-day chicken embryonic sternal cartilage was incubated with SDF-1(100 ng/mL) or without SDF-1 for 1 h, 3 h, and 24 h. Ten µm frozen sections were usedto detect SDF-1 by immuno-fluorescent staining with mAb against SDF-1. Fluorescencemicroscopy showed a progressive increase in SDF-1 staining (red color) surroundingchondrocytes during the 24 h time course (A, B,C) compared to control at 24 h (D).Scale bar=20 µm.

240 L. Wei et al. / Developmental Biology 341 (2010) 236–245

(MJ Research, Waltham, MA). Primers used in amplification of targetgenes mRNA are shown in Table 1. mRNA levels were normalized to18S mRNA levels (Zhen et al., 2001). Calculation of mRNA valueswas performed as previously described (Wei et al., 2006). The cyclethreshold (Ct) values for 18S RNA and that of samples were measuredand calculated by computer software (MJ Research, Waltham, MA).Relative transcription levels were calculated as x=2−ΔΔCt, in whichΔΔCt=ΔE−ΔC, and ΔE=Ctexp−Ct18s; ΔC=Ctctl−Ct18s.

In vivo infusion of SDF-1 in rabbit tibial physis

The study was approved by the Institutional Animal Care and UseCommittee of Rhode Island Hospital. The animals were a subsetof those used for a previous study (Lee et al., 2007). A continuousinfusion system consisting of a fenestrated catheter and an osmoticpump were implanted into the right proximal tibial physis of twentysix-week-old New Zealand White rabbits (Millbrook Breeding Labs,Amherst, MA). Ten animals received an osmotic pump loaded withhuman recombinant SDF-1α (PeproTech, Rocky Hill, New Jersey) at aconcentration of 250 µg/mL in phosphate-buffered saline solution for4 weeks (SDF-1-treated group). The sham-treated group consisted often rabbits implanted with a pump housing phosphate-bufferedsaline solution for 4 weeks. The catheter was inserted into the growthplate cartilage and after 8 weeks was in the subchondral bonemarrowregion due to growth.

Two rabbits were randomly chosen from both the SDF-1-treatedgroup and the sham-treated group at 2 and 4 weeks after implanta-tion. The animals were killed with a sodium pentobarbital overdose(100 mg/kg). The remaining rabbits from each group were killed at8 weeks with use of the same method. The proximal part of the tibiaefrom the rabbits was harvested, placed in 4% paraformaldehyde for2 days, decalcified in Richman–Gelfand–Hill solution for 16 h, washedwith tap water for 8 h, dehydrated with serial ethanol and xylenewashes, and then were embedded in paraffin. Multiple 6-µm sectionswere obtained and stained with hematoxylin and eosin as well assafranin O for histological analysis.

To quantify the mRNA level of type X collagen, a Paradise FFPEReagent System kit (Molecular Devices, Sunnyvale, CA) was used toextract and amplify RNA from laser captured cells (Sabo et al., 2008).In brief, 6-µm sections were air dried and dehydrated through gradedalcohols, and subjected to laser captured microdissection (LCM)within 2 h of deparaffinization. Five thousand cells were micro-dissected from the proliferative and hypertrophic zone tissue sectionsrespectively and captured on LCM Macro CapSure caps (MolecularDevices) using an AutoPix Automated LCM instrument (MolecularDevices). The quantification of mRNA was performed by Real timePCR using the QuantiTect SYBR Green PCR kit (QIAGEN, Valencia, CA)with the DNA Engine Opticon 2 Continuous Fluorescence DetectionSystem (MJ Research, Waltham, MA). Primers (5′–3′) for rabbitType X collagen were: forward, CCAGTGAGAGGAGAACAAGG; reverse,TGGCACAGAAATGCCAGCTG (Access number: AF247705, 306 bp).Amplification conditions were as follows: 2 min preincubation at50 °C, 10 min at 95 °C for enzyme activation, and 40 cycles at 95 °Cdenaturation for 10 s, 55 °C annealing for 30 s and 72 °C extensionfor 30 s. The comparative threshold cycle (Ct) method, i.e., 2−ΔΔCt

method was used for the calculation of fold amplification (Wei et al.,2006).

Statistical analysis

Two-tailed t-tests were used to compare mRNA levels from pro-liferative chondrocyte to hypertrophic chondrocytes. MRNA levels inchondrocytes under different conditions were analyzed by one-wayANOVA with the Dunnett Multiple Comparison post-hoc test at arejection level of 5% unless specifically noted.

Results

Distribution of CXCR4 and SDF-1 in a growth plate

As the first step to evaluate the potential role of the SDF-1/CXCR4axis in the growth plate, we analyzed distribution of SDF-1 and itsreceptor CXCR4 in tibial growth plates from one-day-old mice byimmunohistochemistry (Fig. 1). SDF-1 receptor, CXCR4, was stronglyexpressed in the hypertrophic zone of the growth plate, while weakexpression was found in the proliferative and pre-hypertrophic zones(Fig. 1A, red color). SDF-1 was present at very low levels in growthplate cartilage in comparison to its strong expression in the bonemarrow area adjacent to the hypertrophic zone of the growth plate(Fig. 1B, brown color).

Expression levels of CXCR4, type X collagen, and Runx2 in the growthplate

To quantify the expression levels of CXCR4 in different zonesof growth plates, we used embryonic chicken sterna, which wereseparated into the three different zones under a dissectionmicroscope.Quantitative real time RT-PCR analysis indicated that CXCR4 mRNAwasmost highly expressed in hypertrophic chondrocytes, while it wasexpressed at very low levels in the proliferating or pre-hypertrophicchondrocytes (Figs. 2A, B). This is similar to the up-regulation of typeX collagen and Runx2 mRNA in hypertrophic chondrocytes (Fig. 2B).

SDF-1/CXCR4 interaction stimulates chondrocyte hypertrophy

To test whether the interaction of SDF-1 and CXCR4 stimulateschondrocyte hypertrophy, we cloned a full length CXCR4 cDNA fromchicken growth plate chondrocytes and then cloned it into a retroviralvector RCAS. The RCAS–CXCR4 cDNA was then transfected into

241L. Wei et al. / Developmental Biology 341 (2010) 236–245

proliferative chondrocytes (Fig. 3A). Cells transfected with CXCR4showed a significant increase of type X collagen and MMP-13 mRNAlevels in response to SDF-1 treatment in a dose-dependent manner(Figs. 3B and C). In contrast, proliferative chondrocytes transfectedwith empty vector RCAS had no increase in the mRNA levels of type Xcollagen or MMP13 in response to SDF-1 treatment.

SDF-1 infiltrates cartilage tissue and accelerates growth plate hypertrophy

To determine whether SDF-1 could conceivably diffuse intogrowth plate cartilage tissue from adjacent tissue, sternal cartilagewas incubated with 100 ng/mL SDF-1 for 1, 3, and 24 h in organculture. Immunohistochemistry was performed to detect SDF-1 in

Fig. 5. SDF-1 accelerates growth plate chondrocyte hypertrophy in organ culture. To confirmgrowth plates were cultured in the presence of SDF-1 (100 ng/mL) or in the absence of SDexpression by immuno-fluorescent staining with mAb against type X collagen. A progressivewas seen. The ratio of the length of the hypertrophic zone to that of the total growth plate

cartilage tissue using a mAb against SDF-1. While SDF-1 was barelydetectable after 1 h incubation (Fig. 4A), a faint staining of SDF-1 wasdetected around chondrocytes after 3 h incubation (Fig. 4B). SDF-1was detected surrounding many chondrocytes after 24 h incubation(Fig. 4C). This suggests that SDF-1 is capable of diffusing into cartilagetissue and interacting with chondrocytes.

To further test whether SDF-1 induces chondrocyte hypertrophy inorgan culture, entire tibia cartilaginous growth plates were dissectedfrom 12-day-old chicken embryos and incubated in the presence orabsence of SDF-1 (100 ng/mL) for 2, 4, and 6 days. Immunohisto-chemical analysis with a mAb against type X collagen was performedto determine the length of the hypertrophic zone. Compared to non-SDF-1 treated samples, the length of the hypertrophic zone was

that SDF-1 induces chondrocyte hypertrophy in growth plates, 12-day-old chicken tibiaF-1 for 2, 4, and 6 days. Ten µm frozen sections were used to detect type X collagenincrease in the size of the hypertrophic growth plate based on type X collagen stainingwas calculated at the different time points (B). (*pb0.05). Scale bar=100 µm.

Fig. 6. SDF-1/CXCR4 signaling regulates Runx2 expression. Fifty percent confluentproliferative chondrocytes were infected with RACS–CXCR4 or RCAS for 4 days and thentreated with 100 ng/mL SDF-1 for 1 day. Real time PCR was used to quantify Runx2gene expression and western blot was used to detect Runx2 protein levels. (A) Runx2mRNA expression increased after RACS–CXCR4 transfection and SDF-1 exposure,however, the increase of Runx2 expressionwas inhibited by CXCR4 inhibitor AMD3100.*pb0.05 compared to RACS; #: compared to RACS–CXCR4 and SDF-1 treatment. (B)Western blot showed similar changes in Runx2 protein.

242 L. Wei et al. / Developmental Biology 341 (2010) 236–245

increased significantly after incubationwith SDF-1 for 4 days, and wasfurther increased after incubation for 6 days (Fig. 5). The decreaseof the length of the proliferative and pre-hypertrophic zones in theSDF-1 treated growth plate was also accelerated, possibly due to anincrease of the conversion rate to hypertrophy.

Fig. 7. Runx2 regulates CXCR4, MMP-13, and type X collagen expression. 2.5×105

hypertrophic chondrocytes from 17-day chicken sterna embryo were seeded in F12culture medium overnight and transfected with 1 µg human full length Runx2 DNA orco-transfected with 1 µg human full length Runx2 DNA combined with Runx2 Si RNA(5 nM/mL) 2 days in 6-well plates. mRNA levels of CXCR4, MMP-13, and type Xcollagen were quantified by Real time PCR. Over-expression of Runx2 increased CXCR4(A), MMP-13 (B), and type X collagen expression while down-regulation of Runx2using SiRNA inhibited their endogenicity and Runx2 induction of CXCR4, MMP-13, and

SDF-1/CXCR4 interaction stimulates Runx2 expression

To test whether SDF-1 treatment of chondrocytes induces Runx2,proliferating chondrocytes were incubated with 100 ng/mL SDF-1after transfection with CXCR4 or empty vector. Real time RT-PCRresults indicated that SDF-1 induced Runx2 mRNA expression inchondrocytes transfected with CXCR4 expression construct (Fig. 6A).Furthermore, this induction of Runx2 was partially inhibited byAMD3100, a specific inhibitor of CXCR4 (Fig. 6A). Western blot resultsshow that the changes in Runx2 protein levels were similar to thechanges in Runx2 mRNA (Fig. 6B).

type X collagen expression. *: Significant difference in comparison to mock control,pb0.05. #: Statistically significant in comparison to Runx2 treatment alone.

Runx2 regulates CXCR4, MMP-13, and type X collagen expression

To determine whether up-regulation of CXCR4 in hypertrophicchondrocytes was dependent on Runx2 expression, hypertrophicchondrocytes from 17-day-old chicken embryo sterna were trans-fected with Runx2 SiRNA and/or Runx2 cDNA. Over-expression ofRunx2 resulted in an increase of CXCR4 (Fig. 7A), MMP-13 (Fig. 7B),and type X collagen mRNA levels (Fig. 7C), while knocking downRunx2 expression led to a decrease of CXCR4, MMP-13, and type Xcollagen mRNA levels (Figs. 7A, B, and C).

SDF-1 induces physeal closure and stimulates type X collagen expressionin rabbit proximal tibial physis

To determine the effect of activating the SDF-1/CXCR4 pathway onregulation of chondrocyte differentiation in vivo, human recombinantSDF-1 (250 µg/mL) or PBS controls were administrated into a growthplate in vivo by using a continuous infusion system, consisting of afenestrated catheter and an osmotic pump implanted into the right

243L. Wei et al. / Developmental Biology 341 (2010) 236–245

proximal tibial physis of twenty six-week-old New Zealand Whiterabbits. As we reported previously, in the SDF-1-treated group,the SDF-1-treated leg demonstrated a significant decrease in lengthof 3.7±3.1 mm compared with the control leg (p=0.006; Lee et al.,2007). Histologic analysis indicates a marked difference in physealmorphology between the SDF-1-treated and PBS-treated groups atthe eight-week time-point. The PBS-treated physes demonstrated anormal column cellular arrangement (Fig. 8A-a), while the SDF-1-treated physes were narrowed with gross disruption of the columnarorganization. The border between the residual proliferative and hy-pertrophic zones of SDF-1-treated physes was indistinct, and thecartilage column was replaced by vessels and new bone formation,similar to normal physeal closure (Fig. 8B-a). To determine whetherthe SDF-1 induced physeal closure involves stimulation of chondro-cyte hypertrophy, 5000 cells were microdissected through laser cap-ture from the proliferative and hypertrophic zones of the proximaltibial physis respectively (Fig. 8A-b and 8A-c). Five thousand cells

Fig. 8. SDF-1 infusion results in the tibial physeal closure and stimulates type X collagen exprPBS (No-SDF-1 treatment) for 8 weeks were stained with safranin O for gross morphologycapture with captured area indicated by blue shade (A-b, A-c and B-c). The PBS-treated cohypertrophic zone. The SDF-1-treated rabbit physis (B-a) exhibits marked thinning witdisorganization of cell columns; scattered hypertrophic chondrocytes; and vascular, as welconsistent with physeal closure. Brackets on two photomicrographs (A-c and B-c) indicatelacuna. Cells were microdissected from the proliferative and hypertrophic zones respectivelSDF-1-treated physis (B-c). Real time PCR results indicate that the expression of type X mRNsignificantly increased in the hypertrophic zone of the SDF-1-treated physis at four-week timlevel in the remnant cartilage when the growth plate was closed after the physis was treat

were also microdissected from the residual growth plate withoutdistinction between the proliferative and hypertrophic zones in thephyses treated with SDF-1 for 8 weeks (Fig. 8B-c). Real time RT-PCRresults demonstrated that in controls, type X collagen expression wasonly detectable in the hypertrophic zone and the residual growthplate, but not in the proliferative zone. After SDF-1 treatment for4 weeks, Col X mRNA levels were increased in the hypertrophic zonecompared to control (Fig. 8C). After SDF-1 treatment for 2 weeks,Col X mRNA levels were not increased compared to control. The Col XmRNA level in the residual growth plate of the eight-week SDF-1treatment group was equivalent to that in the hypertrophic zone ofthe control rabbits (Fig. 8C).

Discussion

The cartilaginous growth plate determines the size and shape of along bone by maintaining sequential differentiation of chondrocytes

ession. Tissue sections of rabbit proximal tibiae treated with SDF-1 (SDF-1 treatment) or(A-a and B-a). Unstained sections were used for chondrocyte microdissection by laserntrol rabbit physis (A-a) demonstrates normal growth plate morphology with a distalhout distinction between proliferative and hypertrophic zone remnants. There wasl as osseous, invasion into the growth plate remnant (B-a and B-b). These features arethe height of the physis, defined from the resting zone to the last intact hypertrophicy in the control physis (A-b and A-c), and from the remnant of the growth plate in theA was not detectable in the proliferative chondrocytes. Type X collagen expression wase point in comparison to those from the PBS-treated physis, and remained at the same

ed with SDF-1 for 8 weeks (C).

Fig. 8 (continued).

244 L. Wei et al. / Developmental Biology 341 (2010) 236–245

from proliferation to hypertrophy, and by regulating the productionrate of hypertrophic chondrocytes. Misregulation of this processmay lead to chondrodysplasia. The signaling pathways regulatinggrowth plate chondrocyte hypertrophy are not completely under-stood. There are two major transition points regulating chondrocytehypertrophy. The first is the entry of the hypertrophic stage fromproliferation, which occurs mainly in the pre-hypertrophic zone thatexpresses the Ihh and PTHrP receptors. Previous studies have sug-gested a negative feedback loop in which Ihh induces PTHrP at theproximal end of the growth plate, whose interaction with its receptorin the pre-hypertrophic zone potently inhibits chondrocyte entryinto hypertrophy (Vortkamp et al., 1996). The second transition pointis the exit of hypertrophic cartilage to bone, which occurs at thechondro-osseous junction. Previous studies have shown that thistransition requires degradation of hypertrophic cartilage, which isnot only mediated by metalloproteinases including MMP 9 and 13 inhypertrophic chondrocytes (Vu et al., 1998), but also is induced by thepresence of cells from the bone marrow area in the chondro-osseousjunction (Cole et al., 1992). However, the molecular nature of thisinduction remains elusive.

Our study suggests that the chemokine stromal cell-derived factor1 (SDF-1) may be involved in this process. We found that SDF-1 andits receptor CXCR4 are expressed in a complementary pattern at thechondro-osseous junction in the growth plate, with hypertrophiccartilage positive for the receptor CXCR4, and its adjacent bonemarrow

expressing the ligand SDF-1. Interestingly, such a complementaryexpression pattern of SDF-1/CXCR4 exists in a wide variety of opposedtissue pairs during development, including gastrular mesoderm/ectoderm, vascular endothelium/mesoderm, thyroid endodermal epi-thelium/mesenchyme, and nasal ectodermal epithelium/mesenchyme(McGrath et al., 1999). Such a complementary gene expression pat-tern results in a paracrine regulatory mechanism in which an SDF-1producing tissue induces the development of the opposing tissue thatexpresses CXCR4. Based on this complementary gene expression pat-tern in thegrowthplate,wehypothesized that SDF-1 frombonemarrowinduces and/or enhances differentiation and degradation of hypertro-phic cartilage, which expresses CXCR4.

In this study, we tested this hypothesis directly by examining therole of the chemokine SDF-1 and its receptor CXCR4 in this regulatoryprocess in cells, organ cultures, and in vivo. We found that transfectionof CXCR4 into proliferative chondrocytes resulted in a dose-depen-dent increase of MMP-13 and type X collagen in response to SDF-1treatment. Both MMP-13 and type X collagen are well-knownmarkers for hypertrophic chondrocytes. In organ culture, SDF-1 iscapable of diffusing into sternal cartilage rapidly and accumulatesaround chondrocytes. This suggests that SDF-1 synthesized by cells inbonemarrowmay be capable of diffusing into the adjacent cartilage inthe chondro-osseous junction. Previous data have shown that SDF-1binds to glycosaminoglycans in the extracellular matrix or on the cellsurface (Fermas et al., 2008; Uchimura et al., 2006; Mbemba et al.,1999). Such binding may stabilize SDF-1 and result in its accumula-tion around chondrocytes.

We have shown that, when a tibia growth plate was incubatedwith SDF-1, SDF-1 stimulated elongation of the hypertrophic zone atthe distal end of the growth plate towards the proximal end. However,it did not result in a neo hypertrophic zone at the top of the growthplate. How is this polarity achieved? Our data suggest that this zonespecific induction may be due to the specific expression of the SDF-1receptor CXCR4 in the hypertrophic cartilage. We have shown thatinduction of hypertrophic chondrocyte markers, including Runx2,Col X, and MMP-13 in chondrocytes, requires the presence andinteraction of both SDF-1 and CXCR4. In organ culture, although SDF-1infiltrates the growth plate tissue in all directions, only the distalregion of a growth plate contains CXCR4, and this is the area wherehypertrophy is enhanced by SDF-1. Since a major source of SDF-1in vivo is from cells in the bone marrow area at the chondro-osseousjunction adjacent to the hypertrophic cartilage, these cells may beinvolved in inducing the hypertrophic cartilage phenotype includingsynthesis of type X collagen and MMP-13 (Inada et al., 2004).

The in vivo effects of SDF-1 on gene expression in the growth platewere consistent with our in vitro findings. Elevation of SDF-1 con-centration in rabbit growth plates in vivo leads to increased type Xcollagen gene expression, degradation of the cartilage matrix, poten-tially from MMP-13, and premature closure of the growth plate (Leeet al., 2007). Thus, the closure of growth plate in the SDF-1-treatedphysis is associated with stimulation of chondrocyte hypertrophy.

Interaction of SDF-1 and CXCR4 in articular chondrocytes results inup-regulation and release of MMP-3, -9, and -13 (Kanbe et al., 2002;Kanbe et al., 2004). Interestingly, high concentration of SDF-1, whichoccurs in the synovium of rheumatoid arthritis and osteoarthritispatients, results in death of articular chondrocytes (LeiWei et al., 2006).Since chondrocytes from the hypertrophic zone of a growth plate andthose fromOAarticular cartilage share somecommon features includingup-regulation of Col X and MMP-13, one may hypothesize that a highconcentration of SDF-1mayalso contribute to cell death occurring in thechondro-osseous junction in the growth plate, similar to that in OAcartilage. This hypothesis remains to be tested.

Our study reveals a role for Runx2, a transcription factor critical forbone formation (Dong et al., 2006; Ducy et al., 1997; Kamekura et al.,2006; Komori et al., 1997; Yoshida et al., 2004; Zou et al., 2006) inregulating chondrocyte hypertrophy by SDF-1/CXCR4 signaling. This

245L. Wei et al. / Developmental Biology 341 (2010) 236–245

role is twofold. First, Runx2 mediates SDF-1 induction of chondrocytehypertrophy.We have shown that treating the CXCR4 cDNA transfectedproliferating chondrocytes with SDF-1 resulted in a significant increaseof Runx2 mRNA and protein levels. Runx2, in turn, was involved inactivating Col X expression. Recent data have shown that SDF-1 alsoregulates osteoblast properties through Runx2 (Zhu et al., 2007).Second, Runx2 up-regulates CXCR4 in hypertrophic chondrocytes.Through Runx2 over-expression and knock-down experiments, wedemonstrated that Runx2 plays an important role for CXCR4 expressionin hypertrophic chondrocytes. Thus, our findings suggest a positivefeedback loop in which Runx2 regulates chondrocyte differentiationthrough activation of SDF-1/CXCR4 signaling; and activation of SDF-1/CXCR4 signaling further enhances Runx2 expression, thereby inducingchondrocyte hypertrophy.

Acknowledgments

This project was supported by grants AR052479, AG14399,AG00811, P20RR024484 from NIH, and a grant from the AircastFoundation. The content is solely the responsibility of the authors anddoes not necessarily represent the official views of the National Centerof Research Resources or the National Institutes of Health.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.ydbio.2010.02.033.

References

Chen, Q., Johnson, D.M., Haudenschild, D.R., Tondravi, M.M., Goetinck, P.F., 1995.Cartilagematrix protein forms a type II collagen-independent filamentous network:analysis in primary cell cultures with a retrovirus expression system. Mol. Biol. Cell6, 1743–1753.

Cole, A.A., Luchene, L.J., Linsenmayer, T.F., Schmid, T.M., 1992. The influence of bone andmarrow on cartilage hypertrophy and degradation during 30-day serum-free cultureof the embryonic chick tibia. Dev. Dyn. 193, 277–285.

Dong, Y.F., Soung, D.Y., Schwarz, E.M., O'Keefe, R.J., Drissi, H., 2006. Wnt induction ofchondrocyte hypertrophy through the Runx2 transcription factor. J. Cell. Physiol.208, 77–86.

Ducy, P., Zhang, R., Geoffroy, V., Ridall, A.L., Karsenty,G., 1997.Osf2/Cbfa1: a transcriptionalactivator of osteoblast differentiation. [see comment]. Cell 89, 747–754.

Fermas, S., Gonnet, F., Sutton, A., Charnaux, N., Mulloy, B., Du, Y., Baleux, F., Daniel, R.,2008. Sulfated oligosaccharides (heparin and fucoidan) binding and dimerizationof stromal cell-derived factor-1 (SDF-1/CXCL 12) are coupled as evidenced byaffinity CE-MS analysis. Glycobiology 18, 1054–1064.

Gibson, G.J., Flint, M.H., 1985. Type X collagen synthesis by chick sternal cartilage and itsrelationship to endochondral development. J. Cell Biol. 101, 277–284.

Inada,M.,Wang, Y., Byrne,M.H., Rahman,M.U.,Miyaura, C., Lopez-Otin, C., Krane, S.M., 2004.Critical roles for collagenase-3 (Mmp13) in development of growth plate cartilage andin endochondral ossification. Proc. Natl. Acad. Sci. USA 101, 17192–17197.

Jo, D.Y., Rafii, S., Hamada, T., Moore, M.A., 2000. Chemotaxis of primitive hematopoieticcells in response to stromal cell-derived factor-1. J. Clin. Invest. 105, 101–111.

Jung, Y., Wang, J., Schneider, A., Sun, Y.X., Koh-Paige, A.J., Osman, N.I., McCauley, L.K.,Taichman, R.S., 2006. Regulation of SDF-1 (CXCL12) production by osteoblasts; apossible mechanism for stem cell homing. Bone 38, 497–508.

Kamekura, S., Kawasaki, Y., Hoshi, K., Shimoaka, T., Chikuda, H., Maruyama, Z., Komori, T.,Sato, S., Takeda, S., Karsenty, G., Nakamura, K., Chung, U.-i., Kawaguchi, H., 2006.Contributionof runt-related transcription factor2 to thepathogenesis of osteoarthritisin mice after induction of knee joint instability. Arthritis Rheum. 54, 2462–2470.

Kanbe, K., Takagishi, K., Chen, Q., 2002. Stimulation of matrix metalloprotease 3 releasefrom human chondrocytes by the interaction of stromal cell-derived factor 1 andCXC chemokine receptor 4. [see comment]. Arthritis Rheum. 46, 130–137.

Kanbe, K., Takemura, T., Takeuchi, K., Chen, Q., Takagishi, K., Inoue, K., 2004. Synovectomyreduces stromal-cell-derived factor-1 (SDF-1) which is involved in the destruction ofcartilage in osteoarthritis and rheumatoid arthritis. J. Bone Joint Surg. Br. 86, 296–300.

Kollet, O., Shivtiel, S., Chen, Y.-Q., Suriawinata, J., Thung, S.N., Dabeva, M.D., Kahn, J.,Spiegel, A., Dar, A., Samira, S., Goichberg, P., Kalinkovich, A., Arenzana-Seisdedos, F.,Nagler, A., Hardan, I., Revel, M., Shafritz, D.A., Lapidot, T., 2003. HGF, SDF-1, andMMP-9 are involved in stress-induced human CD34+ stem cell recruitment to theliver. J. Clin. Invest. 112, 160–169.

Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y.,Bronson, R.T., Gao, Y.H., Inada, M., Sato, M., Okamoto, R., Kitamura, Y., Yoshiki, S.,Kishimoto, T., 1997. Targeted disruption of Cbfa1 results in a complete lack of boneformation owing to maturational arrest of osteoblasts. [see comment]. Cell 89,755–764.

Lee, M.C., Bier, A.D., Nickisch, F., Eberson, C.P., Ehrlich, M.G., Chen, Q., 2007. Epiphysiodesiswith infusion of stromal cell-derived factor-1 in rabbit growth plates. J. Bone JointSurg. Am. 89, 102–113.

Lei Wei, X.S., Wang, Z., Sun, C., Kanbe, K., Terek, R., Chen, Q., 2006. Chondrocyte deathinduced by pathological concentration of chemokine stromal cell-derived factor-1.J. Rheum. 33.

Ma, Q., Jones, D., Borghesani, P.R., Segal, R.A., Nagasawa, T., Kishimoto, T., Bronson, R.T.,Springer, T.A., 1998. Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellarneuron migration in CXCR4- and SDF-1-deficient mice. Proc. Natl. Acad. Sci. USA 95,9448–9453.

Mbemba, E., Benjouad, A., Saffar, L., Gattegno, L., 1999. Glycans and proteoglycans areinvolved in the interactions of human immunodeficiency virus type 1 envelopeglycoprotein and of SDF-1alpha with membrane ligands of CD4(+) CXCR4(+)cells. Virology 265, 354–364.

McGrath, K.E., Koniski, A.D., Maltby, K.M., McGann, J.K., Palis, J., 1999. Embryonicexpression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev. Biol.213, 442–456.

Mohle, R., Bautz, F., Rafii, S., Moore, M.A., Brugger, W., Kanz, L., 1998. The chemokinereceptor CXCR-4 is expressed on CD34+ hematopoietic progenitors and leukemiccells and mediates transendothelial migration induced by stromal cell-derivedfactor-1. Blood 91, 4523–4530.

Pulsatelli, L., Dolzani, P., Piacentini, A., Silvestri, T., Ruggeri, R., Gualtieri, G., Meliconi, R.,Facchini, A., 1999. Chemokine production by human chondrocytes. J. Rheum. 26,1992–2001.

Sabo, E., Meitner, P.A., Tavares, R., Corless, C.L., Lauwers, G.Y., Moss, S.F., Resnick,M.B., 2008. Expression analysis of Barrett's esophagus-associated high-gradedysplasia in laser capture microdissected archival tissue. Clin. Cancer Res. 14,6440–6448.

Schmid, T.M., Linsenmayer, T.F., 1985. Developmental acquisition of type X collagen inthe embryonic chick tibiotarsus. Dev. Biol. 107, 373–381.

Sun, Y.X., Schneider, A., Jung, Y., Wang, J., Dai, J., Cook, K., Osman, N.I., Koh-Paige, A.J.,Shim, H., Pienta, K.J., Keller, E.T., McCauley, L.K., Taichman, R.S., 2005. Skeletallocalization and neutralization of the SDF-1(CXCL12)/CXCR4 axis blocks prostatecancer metastasis and growth in osseous sites in vivo. J. Bone Miner. Res. 20,318–329.

Uchimura, K., Morimoto-Tomita, M., Bistrup, A., Li, J., Lyon, M., Gallagher, J., Werb, Z.,Rosen, S.D., 2006. HSulf-2, an extracellular endoglucosamine-6-sulfatase, selec-tively mobilizes heparin-bound growth factors and chemokines: effects on VEGF,FGF-1, and SDF-1. BMC Biochem. 7, 2.

Vortkamp, A., Lee, K., Lanske, B., Segre, G.V., Kronenberg, H.M., Tabin, C.J., 1996.Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-relatedprotein [see comments]. Science 273, 613–622.

Vu, T.H., Shipley, J.M., Bergers, G., Berger, J.E., Helms, J.A., Hanahan, D., Shapiro, S.D.,Senior, R.M., Werb, Z., 1998. Mmp-9/gelatinase B is a key regulator of growth plateangiogenesis and apoptosis of hypertrophic chondrocytes. Cell 93, 411–422.

Wang, X., Manner, P.A., Horner, A., Shum, L., Tuan, R.S., Nuckolls, G.H., 2004. Regulationof MMP-13 expression by RUNX2 and FGF2 in osteoarthritic cartilage. Osteoar-thritis Cartilage 12, 963–973.

Wei, L., Sun, X., Terek, R., Chen, Q., 2006. CD95 induced osteoarthritic chondrocytesapoptosis andnecrosis: dependencyonp38mitogen-activatedproteinkinase. ArthritisRes. Ther. 8, R37.

Yoshida, C.A., Yamamoto, H., Fujita, T., Furuichi, T., Ito, K., Inoue, K.I., Yamana, K., Zanma, A.,Takada, K., Ito, Y., Komori, T., 2004. Runx2 and Runx3 are essential for chondrocytematuration, and Runx2 regulates limb growth through induction of Indian hedgehog.Genes Dev. 18, 952–963.

Zhen, X., Wei, L., Wu, Q., Zhang, Y., Chen, Q., 2001. Mitogen-activated protein kinase p38mediates regulation of chondrocyte differentiation by parathyroid hormone. J. Biol.Chem. 276, 4879–4885.

Zhu,W., Boachie-Adjei, O., Rawlins, B.A., Frenkel, B., Boskey, A.L., Ivashkiv, L.B., Blobel, C.P.,2007. A novel regulatory role for stromal-derived factor-1 signaling in bonemorphogenic protein-2 osteogenic differentiation of mesenchymal C2C12 cells.J. Biol. Chem. 282 (26), 18676–18685.

Zou, L., Zou, X., Li, H., Mygind, T., Zeng, Y., Lu, N., Bunger, C., 2006. Molecular mechanismof osteochondroprogenitor fate determination during bone formation. Adv. Exp.Med. Biol. 585, 431–441.