The EMBO Journal vol.8 no.1 pp.309-315, 1989

Derivatives of ColE 1 cer show altered topological

specificity in site-specific recombination

D.K.Summers

University of Cambridge, Department of Genetics, Downing St,Cambridge CB2 3EH, UKCommunicated by N.Symonds

ColEl contains a 250-bp sequence (cer) which is requiredin cis for the conversion of plasmid dimers to monomers.Recombination between cer and parB (a dimer resolutionsite from plasmid CloDF13) occurs in vivo at lowfrequency. The properties of the resulting hybrid siteshave been studied. The type I hybrid closely resembleswild-type cer. It supports intramolecular recombinationand requires the products of the chromosomal xerA, xerBand xerC genes together with the 250-bp site. In contrast,the type H hybrid (although differing from type I by only2 bp) functions independently of the topological relation-ship of the participating sites, supporting both inter- andintramolecular recombination. Furthermore, recombi-nation between type II sites is independent of the pro-ducts of the xerA and xerB genes and requires a site of< 50 bp.Key words: ColEl/plasmid stability/site-specific recombi-nation/topology of recombination

IntroductionUnstable inheritance of high copy number plasmids can resultfrom the accumulation of plasmid multimers, generated byintermolecular, homologous recombination. This reduces thenumber of plasmid molecules segregating independently atcell division and, for randomly partitioned plasmids,increases the frequency of production of plasmid-freedaughter cells. Stable maintenance of ColE (a natural, highcopy number plasmid of Escherichia coli), requires the250-bp cer region in cis. Two copies of cer in direct repeatwithin the same plasmid molecule (e.g. in a plasmid dimer)are a substrate for site-specific recombination. This convertsplasmid dimers to monomers, thus maximizing the numberof segregating units (Summers and Sherratt, 1984).ColEl cer is a topologically constrained system, which

is specific for intramolecular recombination. cer-mediateddimer formation occurs at _104- 10-5 times the fre-quency of dimer breakdown (H.Kaur and D.K.Summers,unpublished data). Examples of other constrained systemsare the resolution of Tn3 transposition cointegrates bytnpR/res (Krasnow and Cozzarelli, 1983) and DNA inversion

systems such as Salmonella flagellar phase variation (Johnsonet al., 1984) and bacteriophage Mu host-range variation(Plasterk and van de Putte, 1985). It has been suggested thatthe requirement for a specific topological relationshipbetween interacting sites in such systems is a consequenceof their precisely defined wrapping in a DNA -protein com-plex. When pairs of sites in the same molecule cometogether, their alignment (i.e. parallel or antiparallel) and

©IRL Press

the handedness with which they wrap around one anotheris restricted by the supercoiling of the DNA molecule(Craigie and Mizuuchi, 1986; Boocock et al., 1987). It isproposed that the formation of an active complex betweencorrectly orientated sites is favoured by supercoiling. If,however, the sites are in the incorrect relative orientation(e.g. a pair of Tn3 res sites in inverted repeat), it will beenergetically more difficult to align the sites correctly. Inthe case of cer, the formation of an active complex betweenthe recombining sites occurs most readily when they are indirect repeat within the same supercoiled molecule.There is no evidence for the involvement of trans-acting

plasmid functions in cer-mediated recombination. There are,however, at least three chromosomal genes (xerA, xerB andxerC) whose products are essential for ColEl dimerresolution. Recent studies have shown that argR (the genefor the repressor of arginine biosynthesis) is identical to xerA[cf. Sherratt et al., (1986) and Lim et al. (1987)] and thatxerB encodes an amino peptidase (D.Sherratt, personalcommunication). The product of xerC is unknown.Multimer resolution sites have been identified in several

other high copy number plasmids including pMBl, ColKand CloDF13 (Summers and Sherratt, 1988). ColEl cer andColK ckr recombine efficiently in vivo to generate a hybridresolution site. Comparison of the sequence of the hybridwith cer and ckr shows that crossing-over occurs within aregion of 35 bp close to one end of cer (Summers et al.,1985). The position of crossover cannot be defined moreaccurately because cer and ckr are homologous within thisregion. In principle, hybrids formed between sites showinggreater divergence should allow the crossover to be definedmore precisely, although efficient recombination is less likelybetween distantly related sites. This report describes thegeneration, in vivo, of hybrids between cer and CloDF13parB (Hakkaart et al., 1984). These sites show 56% DNAsequence homology (Figure 1), with the greatest similarityaround the crossover site. Characterization of the hybridshas allowed a more precise localization of the crossover siteand has given an insight into the molecular basis of thetopological constraints operating during the multimerresolution reaction.

ResultsGeneration of hybrids between cer and parBPlasmid pAP451, which contains cer and parB in directrepeat, was constructed by inserting the 400-bp ClaI -SmaIparB fragment from pEV87 between the AccI and SmaI sitesof pKS451 (Figure 2a). pAP451 was transformed intoDS941xerA and DS941(xer+), and plasmid DNA from thetransformants was analysed on an agarose gel (Figure 2b).In xerA, the fastest-running band corresponded to pAP45 1monomer supercoils. In xer+, however, there was an

additional band in the position predicted for the product ofrecombination between cer and parB. DNA from this band

309

37 50 3800

ColEl GTGAAACCATGAAAAATGGCAGCTTCAGTGGATTAAGTGGGGGTAATGTGGCCTGTACCCTCTGGTTGCATAGGTATTCA** * ***** * * * * * * ** * ** ******** ** **

CloDF AGAAAGTCGGTAAAAAAAGGGCTTACGGCATCCATTTTACGTCAAAACATATGCTATGCAGTTGCGTGCATAGGCATGCA

38 50 Sau3A

ColEl TACGGTTAAAATTTATCAGGCGCGATCGCGGCAGTTTTTC-GGGTGGTTTGTTGCCATTTTTACCTGTCTGCTGCCGTGATC* ** ********* * ****** * **** * ***** ****** ******* ***** * ** **** * *

CloDF TTAGGATAAAATTTACCGGGCGCGTTTCCGGC-GGTTTTCCGGGTGGGTTGTTGCTTGTTTTATCCCGTAGCCGCCGGAAAC

MluI RsaI 3 950

ColEl GCGCTGAACGCGTTTTAGCGGTGCGTACAATTAAGGGA--TTATGGTAAATCCACTTACTGTCTGCCCTCGTAGCCATCGAG** * ** ** * ***** ** ******* *********** * * * * * *

CloDF GCCGCCAGTGCCTTCTGGCGGT----ACCGATAAGGGATGTTATGGTAAATATCTTCGAGTTTCAGGTACAAAAAAAGCTCCTaqI RsaI AluI

Fig. 1. DNA sequences of ColEl cer and CloDF13 parB. Asterisks denote sequence identity and hyphens show where a break has been insertedduring analysis to optimize sequence alignment. ColEl coordinates are those of Chan et al. (1985). Restriction sites mentioned in the text are shownand the cer crossover region is indicated by a horizontal line above the ColEl sequence.

was transformed into DS94lxerA. All transformantscontained plasmids of the same size but there was significantvariation in the proportions of plasmid multimers (Figure2b). In 20% of transformants (type I hybrids) plasmids werealmost exclusively monomeric, while in the remaining 80%(type II hybrids) multimers predominated. Restrictionanalysis confirmed that plasmids containing both type I andtype II hybrids had lost the unique EcoRI site which liesbetween cer and parB in pAP45 1 but had retained the MluIand HindIII sites. This is consistent with being the productsof intramolecular recombination between cer and parB.

DNA sequences of the hybrid sitesThe sites of recombination between cer and parB weredetermined by sequencing the short MluI-HindIl fragmentsfrom plasmids containing type I or type II hybrids (at leastfive representatives of each class were sequenced). Figure3 shows the sequences surrounding the crossover sites ofthe hybrids, together with the corresponding regions of cerand parB. Type I and type H hybrid sites differed by 2 bp(Figure 3c). Inspection of the sequences shows that type Ihybrids were generated by a unique crossover event but thatcrossing-over at any of three adjacent bonds could haveproduced the type II hybrid.To facilitate subsequent analysis, the MluI-HindH

fragment from one representative of each hybrid type wasexchanged for the MluI-HindIl fragment of pKS490.(pKS490 is a pUC8 derivative containing the 280-bpHpaII- TaqI cer fragment of ColEl in the polylinker AccIsite.) This simply has the effect of putting the hybrid siteswithin the pUC8 polylinker.

The effect of hybrid sites upon plasmid stabilityColEl cer stabilizes multicopy plasmids by preventing theaccumulation of plasmid multimers in recombination-proficient strains. Plasmids containing the type-II-hybrid sitemultimerize extensively and should therefore be very

unstable. The stability ofpUC8 derivatives containing hybridsites was compared with pUC8 (no multimer resolution site),pKS490 (pUC8cer+) and pEV87 (parB+) in host strainsDS941 (Figure 4a) and DS941xerA (Figure 4b). These

,cer,f1 ---N

M \

FpAP451 parB

I!

Fig.2. Recombination between cer and parB. (a) Recombinationbetween directly repeated copies of cer and parB in pAP451 results inthe deletion of intervening DNA. Restriction sites are shown thus:M = MluI, E = EcoRI, H = HindIII. (b) pAP451 in DS941xerA(lane 1) and DS941 (lane 2). When DS941xerA was transformed withthe faster-running band from lane 2, transformants contained eitherplasmid monomers (lane 3; type I hybrid) or a mixture of monomersand higher forms (lane 4; type II hybrid).

strains carry the recF mutation, so high copy numberplasmids should be stably inherited because few, if any,multimers will be generated by homologous recombination.It was found that pUC8 and plasmids containing cer, parBor the type-I-hybrid site were maintained stably in both hoststrains. However, the plasmid containing the type II hybrid,although stable in xer+, was unstable in xerA.Figure 5 shows the plasmid content of the strains used

in the stability experiment. pUC8 and plasmids containingcer, parB or the type I hybrid were predominantlymonomeric. Plasmids containing the type II hybridmultimerized in both host strains. In the xer+ background(Figure Sa), monomers were the most common form, withhigher-order oligomers present at a lower concentration. InxerA, however, multimerization was more extensive and theproportion of monomers was reduced (Figure Sb).

310

D.K.Summers

11. ol

cer-mediated recombination

(a) Type I Hybrid4

cer GCTGCCGTGATCGCGCTGAACGCGTTTTAGCGGTGCGTACAATTAAGGGATTATGGTAAAT

parB TAGCCGCCGGAAACGCCGCCAGTGCCTTCTGGCGGTACCGATAAGGGATGTTATGGTAAAT

I GCTGCCGTGATCGCGCTGAACGCGTTTTAGCGGTGCGTACAATTGGGATGTTATGGTAAAT

(b) Type II Hybrid

+4"cer GCTGCCGTGATCGCGCTGAACGCGTTTTAGCGGTGCGTACAATTAAGGGATTATGGTAAAT

parB GCCGCCGGAAACGCCGCCAGTGCCTTCTGGCGGTACCGATAAGGGATGTTATGGTAAATAT

II GCTGCCGTGATCGCGCTGAACGCGTTTTAGCGGTGCGTACAAGGGATGTTATGGTAAATAT

(c) Comparison of Type I and Type II Hybrids

I GCTGCCGTGATCGCGCTGAACGCGTTTTAGCGGTGCGTACAATTGGGATGTTATGGTAAAT

I I GCTGCCGTGATCGCGCTGAACGCGTTTTAGCGGTGCGTACAA--GGGATGTTATGGTAAAT

Fig. 3. DNA sequences of the crossover regions of cerlparB hybrids.(a) Generation of the type I hybrid; (b) generation of the type II

hybrid. (c) Comparison of type-I- and type-II-hybrid sequences.

Hyphens indicate where a break has been introduced during analysis toalign the sequences. Small vertical arrows indicate those bonds in cer

and parB at which breakage and reunion could give rise to the hybridsites.

Further characterization of type I hybridsDimers of a plasmid containing the type-I-hybrid site weretransformed into xer+, xerA and xerB recipients. Thedimers were converted to monomers in xer+ transformantsbut remained as dimers in xerA and xerB (Figure 6a). Thusrecombination between type-I-hybrid sites depends upon theproducts of xerA and xerB and resembles recombinationmediated by wild-type cer (Summers and Sherratt, 1988).The type-I-hybrid site was cloned into the polylinker of

pKS451 so that it was in direct repeat with the cer site inthis plasmid. When the resulting plasmid was transformedinto DS941, recombination occurred between cer and thehybrid site. This deleted the intervening DNA and generateda new (type III) hybrid. The crossover region of the typeIII hybrid was sequenced and found to be identical to thetype I hybrid (Figure 7).

Further characterization of type 11 hybridsDimers of a plasmid containing the type II hybrid were

transformed into xer+, xerA and xerB. Plasmid monomers,dimers and higher-order oligomers were seen in alltransformants (Figure 6b). In the xer+ recipient, monomers

were the most common form but in xerA and xerB, multimerswere more abundant. An identical result was obtained whenrecA strains were used (not shown).Does recombination between type H hybrids require the

full 250-bp site? A deletion derivative of the type II site(deletion 3888), which lacks all cer sequences to the left ofthe Sau3A site at ColEl coordinate 3888 (Figure 1), was

tested for recombination proficiency. When dimerscontaining this derivative were transformed into xer+, xerAand xerB, monomers and higher-order oligomers were seen

in all transformants (Figure 6c). Plasmids containing thedeletion derivative were unstable in both xer+ and xerAbackgrounds (Figure 4). In contrast, a plasmid containing

75 -

50

a

0

C

C

0

10

._

a

o

l:

25

0

100

75.

50

25

0

0 50 100Generations

1&40 200

Fig. 4. Plasmid stability in (a) DS941 and (b) DS941xerA. Plasmidstested were: pUC8 (O), pKS490 (0), pEV87 (A), pUC8 + type Ihybrid (-), pUC8 + type II hybrid (*), pKS3888 (A),pUC8 + type II deletion 3888 (V) Data shown are the mean of sixindependent experiments.

the equivalent deletion derivative of cer (pKS3888) was

monomeric (Figure 5) and stably maintained in both xer+and xerA (Figure 4).

Further deletion mapping of the type-Il-hybrid site was

performed by subcloning restriction fragments into pUC8,transforming into DS941xerA and screening the trans-formants for plasmid oligomers. The results show that allsequences necessary for xerA, xerB-independent recom-bination lie within a 50-bp MluI- TaqI fragment (Figure 8).

The effect of xerC upon hybrid recombinationMutations in the recently identified xerC gene block cer-

mediated recombination. They are not complemented byxerA or xerB and the gene product is unknown (S.Collomsand D.Sherratt, personal communication). When monomers

or diners of plasmids containing cer, type I or type II hybridswere transformed into xerC hosts, there was no recom-bination and the oligomeric state of the transforming DNA

311

V

V

VV

V

(a)

0

00

V 0

(b) v 4

I

D.K.Summers

a

2 L% U A

.-~.

Fig. 5. Plasmid content of strains used for stability testing in (a)DS941 and (b) DS94lxerA. Plasmids contained in the strains are:pUC8 (lane 1), pKS49O (lane 2), pEV87 (lane 3), pUC8 + type Ihybrid (lane 4), pUC8 + type II hybrid (lane 5), pKS3888 (lane 6),pUC8 + type HI deletion 3888 (lane 7). Symbols below each lanecorrespond to those used in Figure 4.

was unchanged (Figure 9). Thus recombination involvingcer and both of the hybrid sites requires the product of xerC.

Discussion

Recombination between cer and parB occurs within thecrossover region identified previously by examination ofhybrids between cer and ckr from plasmid CoIK (Figure 1Oa)(Summers et aL, 1985). Whereas recombiation between cerand ckr is efficient and yields a unique product, the inef-ficiency of cerlparB recombination suggests that analysis ofthe type I a'nd type II hybrids may not give a precise indica-tion of the normal crossover site. Recombination betweencer and the type I hybrid is efficient and yields a productidentical to the type I hybrid. Crossing-over between cer andthe type I hybrid must have occurred at, or to the left

b C

+ A B

Type 11

+ A B_ . .-J

Type 11cei elt o0

C..i

+ A B

Type

Fig. 6. Transformation of xer mutants with dimers of cer-parBhybrids. (a) DS941, DS941xerA and DS941xerB respectively,transformed with dimers containing type-I-hybrid sites. (b) DS941,DS941xerA and DS941xerB transformed with dimers containing type-II-hybrid sites. (c) DS941, DS941xerA and DS941xerB transformedwith dimers containing type II deletion 3888.

of ColEl coordinate 3924, where the sequence of the typeI hybrid changes from cer to parB. It has been shownpreviously that crossing-over between cer and ckr occursbetween coordinates 3907 and 3943 (Summers et al., 1985)so, incorporating this new information, the cer crossoversite appears to lie between coordinates 3907 and 3924. This17-bp sequence also contains the three possible sites ofcrossing-over between cer and parB which could generatethe type II hybrid (Figure 3b).The identification of two different hybrids suggests that

there may be two possible alignments of cer and parB withinan active synaptic complex. Due to gain and loss of basesbetween the sequences, it is not possible to align themthroughout the whole of the crossover region. However, twonon-ideal alignments can be obtained by optimizing pairingfrom either the right end (Figure 3a) or the left end (Figure3b) of the crossover region. These two alignments probablyreflect the pairing of the sites in vivo because the type-I- andtype-Il-hybrid sequences can then be generated by breakageand reunion of adjacent bonds. Unlike the two cer-parBpairings, cer and the type I hybrid can be aligned in phasethroughout the crossover region, although the type I hybriddiffers from cer at five positions (Figure 7). The efficiencyof cer/type I recombination suggests that the correctalignment of the DNA sequences throughout the crossoverregion may be more important than perfect sequencehomology.

Overlapping the 17-bp crossover region there is aninverted repeat with homology to the consensus IHF bindingsequence (Figure 10). This suggests that IHF might bind tocer in the same way that it binds the ends of the transposonTnl000 (Wiater and Grindley, 1988). Although cer-mediatedrecombination has been observed in mutants which lack IHF

312

cer-mediated recombination

4cer GCTGCCGTGATCGCGCTGAACGCGTTTTAGCGGTGCGTACAATTAAGGGATTATGGTAAAT

******************************************** * ***********

Type I GCTGCCGTGATCGCGCTGAACGCGTTTTAGCGGTGCGTACAATTGGGATGTTATGGTAAAT

Type III GCTGCCGTGATCGCGCTGAACGCGTTTTAGCGGTGCGTACAATTGGGATGTTATGGTAAAT

Fig. 7. Generation of the type IIH hybrid by recombination between cer and a type I site. Recombination must have occurred to the left of the bondsindicated by small vertical arrows.

GATCGCGCTGAACGCGTTTTAGCGGTGCGTACAAGGGATGTTATGGTAAATATATCTTCGAGTTTCAGGTACAAAAAAAGCTSau3A MluI RsaI TaqI RsaI AluI

+

Fig. 8. Deletion mapping of the region of the type II hybrid required for xerA, xerB-independent recombination. Horizontal bars indicate undeletedDNA sequences. Deletion derivatives were scored for their ability (+) or inability (-) to generate plasmid oligomers when transformed intoDS941xerA.

(H.Withers and D.Summers, unpublished data) this does notnecessarily exclude a role for IHF in recombination. Adecrease in the rate of recombination would not easily bedetected in our assays and it has been shown that, at leastfor TnJO transposition (Morisato and Kleckner, 1987), HUprotein can substitute for IHF.What can we say about the mechanism of recombination

mediated by the type H hybrid? Most strikingly, it appearsto be topologically unconstrained. Following transformationwith a type II dimer, intermolecular recombination generatestrimers and higher forms, while intramolecular eventsproduce monomers (Figure 6b). Furthermore, it wouldappear that two distinct recombination pathways operatesimultaneously in a xer+ background. One is closely relatedto normal cer-mediated recombination. It requires a full-length site plus the products of xerA, xerB and xerC andconverts oligomers to monomers by intramolecularrecombination. The second pathway (which is independentof the xerA and xerB gene products and the left-hand 200 bpof the site) mediates both inter- and intramolecularrecombination. The limited multimerization seen in a xer+background is the result of simultaneous operation of thesetwo pathways. In a xerA or xerB background (or when theleft-hand part of the site is deleted), the topologicallyconstrained pathway is abolished and the resulting high levelof multimers is the net result of inter- and intramolecularrecombination mediated by the unconstrained pathway.The observation that topologically constrained recombi-

nation between type II sites is abolished either by deletionof the left-hand end of the site or inactivation of xerA orxerB suggests that the xerA and xerB gene products maynormally interact with the left-hand end of cer. This isconsistent with footprinting studies which show that the

Fig. 9. The effect of xerC on plasmid recombination. DS941 xerC wastransformed with monomers or dimers respectively of pUC8 containingcer (lanes 1 and 2), type-I-hybrid site (lanes 3 and 4) or type IIhybrid site (lanes 5 and 6).

product of xerA binds specifically to the cer P1 promoter(Summers and Sherratt, 1988; D.Sherratt, personalcommunication) and the fact that neither xerA nor xerB isa recombinase. According to the proposals of Craigie andMizuuchi (1986), one would expect a complex between cer

313

IRL IRR

TTTTAGCGGTGCGTACAATTAAGGGATTATGGTAAATCCACTTACTGTC*-----------------------------------*

**

.__

cer x ckrcer x parB (I)cer x parB (II)cer x Type I hybrid

(b)

CAATTAAGGGATT

CAGTAAGTGGATT

YAA---RTTGATA

IRL

IRR

IHF concensus

Fig. 10. Details of the cer crossover region. (a) Sequences containing the sites of crossover between cer and ckr, parB, or the type I hybrid areindicated thus: *----*. IRL and IRR denote the left and right portions of the inverted repeat within the crossover region. (b) Homology between theinverted repeat sequence and the consensus IHF binding sequence.

and the products of the xer genes to be unable to interactproductively with a second site in an incorrect topologicalrelationship. This is clearly not true for the type II hybridwhich resembles unconstrained recombination systems suchas X-Int where the products are formed as a result of randomcollisions between sites (Spengler et al., 1985).Normal cer-mediated recombination seems to incorporate

some kind of molecular 'safety catch', which blocks anyrecombination event which does not follow the topologicallyconstrained xerA, xerB-dependent pathway. The safety catchis also functional in the type I hybrid which, like cer, isinactive when 200 bp at the left-hand end of the site isdeleted. Thus the 2-bp deletion which distinguishes type Ifrom type II hybrids, overrides the safety catch andtransforms a topologically constrained recombination systeminto an unconstrained one.What might be the molecular nature of the safety catch?

Suppose that a complex between cer and the recombinaseis inactive. Activation may result from the binding of thexerA and xerB gene products, modifying the interactionbetween recombinase and site and simultaneously introducingtopological constraints upon interaction with a second site.The altered sequence of the site in the type II hybrid mayrender the recombinase-site complex active in the absenceof the xerA of xerB gene products or their binding sites.Construction of the full complex would then no longer beessential for recombination and there would be no constraintupon the topological relationship of the participating sites.

It is likely that cer sites interact as condensed nucleoproteincomplexes and the formation of these complexes would beassisted by appropriate sequence-dependent DNA flexibility.A region adjacent to the left-hand boundary of cer has beenshown to function by virtue of its flexibility rather than itsprecise DNA sequence (Summers and Sherratt, 1988). Thisregion is essential for cer-mediated dimer resolution but notfor topologically unconstrained recombination mediated by

314

the type II hybrid, which suggests it has a role in theformation of a complex between the left-hand part of thesite and the products of the xerA and xerB genes.How closely is xerA xerB-independent recombination

between type II sites related to cer-mediated dimerresolution? The observation that the smallest functional typeII site includes the cer crossover region (and by implication,the recombinase binding site) suggests a close relationship.It is also significant that the xerC gene product is essentialfor recombination mediated by both cer and the type IIhybrid. Furthermore, we have found that the low level ofplasmid fusion mediated by wild-type cer is independent ofxerA and xerB (H.Kaur and D.K.Summers, unpublisheddata) and so resembles recombination by the type II hybrid.We cannot, however, totally rule out the possibility that anindependent chromosomal gene encodes a recombinasewhich has a low level of activity with wild-type cer sites(irrespective of their topological relationship) and that the2-bp deletion in the type II hybrid generates a site withincreased affinity for this recombinase.The stability of plasmids containing hybrid sites is

consistent with previous observations of a correlationbetween plasmid multimerization and instability. It has beensuggested previously (Summers and Sherratt, 1984) thatplasmid-free segregants arise from a sub-population of cellswith a reduced number of segregating units as a result ofrunaway multimerization. For a plasmid containing the typeII site in a xer± background, the unconstrained recom-bination pathway produces multimers, but the simultaneousactivity of the constrained pathway counteracts this processand the plasmid is stable. Deletion of the left-hand end ofthe site (or mutation of the xerA gene) inactivates the con-strained pathway, increases the proportion of multimers andmakes the plasmid unstable. Instability is still less than mightbe expected with such a high proportion of multimers,presumably because the unconstrained pathway constantly

D.K.Summers

(a)

cer-mediated recombination

interconverts the various plasmid forms, so preventing thepersistence of clones of cells with an above-averageproportion of multimers.

Materials and methodsBacterial strains and plasmidsAll strains are derivatives ofE coli K12 strain AB1 157 (Bachmann, 1972).DS941 is AB1 157 recFlacI lacZ del.M 15. JC8679 (ABI l57recBCsbcA)was obtained from A.J.Clark. Strains carrying chromosomal mutationsxerA3, xerBI and xerCI are TnS insertion derivatives of DS941 and wereobtained from D.Sherratt. Plasmids used were pUC8, pUC9 (Messing andVieira, 1982), pKS45 1, pKS490 (Summers and Sherratt, 1988) and pEV87(Hakkaart et al., 1984). pKS3888 is a pUC8 derivative containing a cersite deleted for sequences to the left of the Sau3A site at coordinate 3888.The construction and use of other plasmids is described in the text.

Media and bacterial transformationFor routine growth of bacteria we used L-broth (Kennedy, 1971) and L-agar. Where appropriate, ampicillin (50 Ag/ml) was added to media. Plasmidtransformation of calcium-chloride-treated cells was by the method of Cohenand Hsu (1972).

Purification of plasmid dimersPlasmids were transformed into JC8679, in which generalized recombinationgenerates a high proportion of plasmid multimers (Fishel et al., 1981).Transformant colonies were patched onto L-agar plates and plasmid DNAwas purified by the method of Holmes and Quigley (1981). Plasmid DNAwas run on a 0.85% agarose gel and dimer bands identified by comparisonwith markers of known mol. wt. The plasmid dimer band was cut out ofthe gel, agarose removed by the Geneclean procedure (BIO 101 Inc) andtransformed into DS941xerA (for dimers containing cer or type-I-hybridsites) or DS941xerC (for dimers containing the type-II-hybrid site).Transformants were screened on a gel to check that they contained onlyplasmid dimers.

Hakkaart,M.J.J., van den Elzen,P.J.M., Veltkamp,E. and Nijkamp,H.J.J.(1984) Cell, 36, 203-209.

Fishel,R.A., James,A.A. and Kolodner,R. (1981) Nature, 294, 184-186.Holmes,D.S. and Quigley,M. (1981) Anal. Biochem., 114, 193-197.Johnson,R.C., Bruist,M.F., Glaccum,M.B. and Simon,M.I. (1984) Cold

Spring Harbor Symp. Quant. Biol., 49, 751-760.Kennedy,C.K. (1971) J. Bacteriol, 108, 10-19.Krasnow,M.A. and Cozzarelli,N.R. (1983) Cell, 32, 1313-1324.Lim,D., Oppenheim,J.D., Eckhardt,T. and Maas,W.K. (1987) Proc. Natl.

Acad. Sci. USA, 84, 6697-6701.Messing,J. and Vieira,J. (1982) Gene, 19, 269-276.Morisato,D. and Kleckner,N. (1987) Cell, 51, 101-111.Norrander,J., Kempe,T. and Messing,J. (1983) Gene, 26, 101-106.Plasterk,R.H.A. and van de Putte,P. (1985) Biochim. Biophys. Acta, 782,

111-119.Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA,

74, 5463-5467.Sherratt,D.J., Summers,D.K., Stirling,C. and Stewart,G. (1986) In

Alacevic,M., Hranveli,D., Toman,Z. (eds), 5th International Symposiumon the Genetics of Industrial Microorganisms.

Spengler,S.J., Stasiak,A. and Cozzarelli,N.R. (1985) Cell, 42, 325-334.Summers,D.K. and Sherratt,D.J. (1984) Cell, 36, 1097-1103.Summers,D.K. and Sherratt,D.J. (1988) EMBO J., 7, 851-858.Summers,D., Yaish,S., Archer,J. and Sherratt,D. (1985) Mol. Gen. Genet.,

201, 334-338.Wiater,L.A. and Grindley,D.F. (1988) EMBO J., 7, 1907-1911.

Received on September 26, 1988; revised on November 2, 1988

In vitro manipulationsConditions for enzymic cleavage and ligation of DNA were thoserecommended by the suppliers.

DNA sequencingFragments were cloned into M 13 mpl8 or mpl9 (Norrander et al., 1983)and sequenced by a modification of the chain termination technique of Sangeret al. (1977) using reagents from the Sequenase kit (United StatesBiochemical Corporation).

Measurement of plasmid stabilityA single colony of the test strain was picked from a selective plate, inoculatedinto 10 ml L-broth (containing ampicillin to select against plasmid-free cells)and incubated overnight at 37°C. This culture was diluted 10-6-fold intoL-broth and grown into stationary phase. The cycle of dilution and growthwas performed 10 times. Each cycle constituted 20 generations. From eachstationary phase culture, samples were diluted and spread onto antibiotic-free agar. The resulting colonies were tested for plasmid content by astarch/iodine plate for ,B-lactamase production (Boyko and Ganschow, 1982).

AcknowledgementsI wish to ffiank Helen Withers for her expert technical assistance and AmandaPickup and Mark Dingle for their pioneering work in the generation of hybridsites. The work was supported by an award from the Nuffield Foundationand by a Project Grant from the Medical Research Council of Great Britain.

ReferencesBachmann,B.J. (1972) Bacteriol Rev., 36, 525-557.Boocock,M.R., Brown,J.L. and Sherratt,D.J. (1987) In Kelly,T.J. andMcMacken,R. (eds), DNA Replication and Recombination. Liss, NewYork, pp 703-718.

Boyko,W.L. and Ganschow,R.E. (1982) Anal. Biochem., 122, 85-88.Chan,P.T., Ohmori,H., Tomizawa,J. and Leibowitz,J. (1985) J. Biol.

Chem., 260, 8925-8935.Cohen,S.N. and Hsu,L. (1972) Proc. Natl. Acad. Sci. USA, 69, 2110-2114.Craigie,R. and Mizuuchi,K. (1986) Cell, 45, 793-800.

315