Smith, Jayden A. (2008) Dinuclear polypyridyl ruthenium(II)...
Transcript of Smith, Jayden A. (2008) Dinuclear polypyridyl ruthenium(II)...
This file is part of the following reference:
Smith, Jayden A. (2008) Dinuclear polypyridyl ruthenium(II) complexes as stereoselective probes of nucleic acid secondary
structures. PhD thesis, James Cook University.
Access to this file is available from:
http://eprints.jcu.edu.au/2082
Dinuclear Polypyridyl Ruthenium(II) Complexes as Stereoselective Probes of
Nucleic Acid Secondary Structures
Thesis submitted by
Jayden Aaron Smith B.Sc. (Hons)
March 2008
For the degree of Doctor of Philosophy
School of Pharmacy and Molecular Sciences
James Cook University
Townsville, Queensland, Australia
i
Statement of Access
I, the undersigned, author of this work, understand that James Cook University will make
this thesis available for use within the University Library and, via the Australian Digital Theses
network, for use elsewhere.
I understand that, as an unpublished work, a thesis has significant protection under the
Copyright Act and all users consulting this thesis will be required to sign the following
statement:
“In consulting this thesis I agree not to copy or closely paraphrase it in whole or in part
without the written consent of the author, and to make proper public acknowledgement for
any assistance which I have obtained from it.”
Beyond this, I do not want to place any restrictions on access to this thesis.
Jayden A. Smith
January 2008
ii
Statement of Sources
I declare that this thesis is my own work and has not been submitted in any form for another
degree or diploma at any university or other institution of tertiary education. Information
derived from the published or unpublished work of others has been acknowledged in the text
and a list of references is given.
Jayden A. Smith
January 2008
iii
Statement of Contribution of Others
The work reported in this thesis was conducted under the supervision of Prof. Richard
Keene, using the facilities in the Discipline of Chemistry at James Cook University.
DNA-binding NMR experiments were performed under the guidance of Assoc.-Prof. Grant
Collins (University of New South Wales, Australian Defence Force Academy) with assistance
from Dr. Damien Buck and Lt. Adam Turley, members of Assoc.-Prof. Grant’s research group.
Fluorescence assays were conducted in collaboration with Dr. Caitriona Spillane (JCU) and Dr.
Joy Morgan (JCU). Affinity chromatography experiments utilising the supramolecular helicates
were conducted in collaboration with Mr. Christopher Glasson and Prof. George Meehan
(JCU). Several complexes and ligands employed in the work were kindly supplied by other
collaborators, with their contributions fully acknowledged where appropriate in the text.
This work was funded by an Australian Research Council (ARC-DP) grant to Prof. Keene
and JCU Graduate Research Scheme grants to the candidate. Financial support for the candidate
was obtained from an Australian Postgraduate Award and funding during the compilation and
writing of the thesis was obtained from a JCU Doctorial Completion Award.
Jayden A. Smith
January 2008
iv
Acknowledgements
While the title page of this work lists only a single name (excepting, of course, one
‘James Cook’), the completion of this thesis would not have been possible without the many
and varied contributions of many and varied people.
First and foremost I would like to thank my supervisor Prof. Richard Keene. Throughout
the duration of my PhD (and the Honours year preceding it) he has provided me with the
perfect balance between guidance and autonomy; he has always been generous in his support –
even during the most trying of circumstances – while at the same time allowing me to pursue
my own tangents. His enthusiasm for chemistry is inspiring and I hope that at least some small
part of his knowledge has rubbed off on me (I know for certain I have learnt of a cheaper
alternative to the hammer-and-screwdriver method of defrosting a refrigerator). I was
privileged to have him as a supervisor, his baffling affection for Macs notwithstanding.
I must also extend my thanks to the rest of the Keene clan who have always been very
kind. I am very grateful for the efforts of Nicola and Martin as they entered Olympus Mons-
sized mounds of my references into the database, and I wish to offer special thanks to the late
Cheryl Keene, a most lovely, friendly woman who will be sorely missed.
My time in the Keene lab has been made an enjoyable one thanks to the remarkable
people that I have worked alongside during the course of my studies. I especially wish to thank
my good friends Dr. Caitriona Spillane and Ms. Elizabeth Fellows, both of whom managed to
keep me chronically amused during their stints in the lab. Triona, in addition to her invaluable
contributions to my studies, could always be counted on for a well-timed juice break,
hilariously-pronounced word, or fashion advice; Liz’s laboratory musical numbers were well
worth the cost of admission (despite verging on being a safety hazard) and our regular lunches
while I was preparing this thesis helped me avoid the refectory and thus maintain my mental
and gastrointestinal well-being. Considerable credit must also be given to Dr. Deanna
D’Alessandro for helping show newbies (including me) the ropes of the lab, and Dr. Joy
Morgan for her guidance and assistance in my work. Additionally, I’d like to thank the many
other students who passed through the Keene lab during the past 4-5 years, especially the
Smiths, Jessica and Kirsten (no relation, to me or each other).
Outside of the Keene lab a number of individuals must be singled out for specific
contributions towards my studies: Mr. Chris Glasson and his supervisor Prof. George Meehan
v
for taking a chance with BADASS chromatography; A/Prof. Bruce Bowden for his assistance
in local NMR matters; Ms. Sally Hunter for facilitating my brief foray into the dark arts of
biochemistry (and for her baked goods); and Mr. Curtis Elcoate for organising regular, stress-
relieving Xbox tournaments (with free booze) and for his (usually unsolicited) organic
chemistry advice. Thanks, too, to all the other denizens of DB21 that I have befriended over the
years, especially the drunken rabble of TGTFT. I wish to express my gratitude to all of the
academic, technical and administrative staff in the School that have made my time here both
productive and enjoyable: in no particular order save that in which they were typed, I’d like to
thank A/Prof. Michael Ridd, Dr. Murray Davies, Dr. Brian McCool, Dr. Ken Adams, Prof.
David Yellowlees, Dr. Sherryl Robertson, Mr. Brian Foster, Dr. Steve Gheller, Ms. Sonia Dalla
Pozza, Mr. Randy Johnson, Mr. David Jusseaume, Dr. Moira McCann, Ms. Maree Hines, Ms.
Sharryn Gleeson, Ms. Alexis Hiles, Dr. Gerald Münch, Prof. Jim Burnell, and Ms. Veronica
Graham (to whom I still owe a lunch). I’d also like to thank A/Prof. Ian Atkinson for his
extensive input into an ill-fated molecular mechanics investigation.
I am also greatly indebted to ‘our man in Canberra’, A/Prof. Grant Collins, for his
expertise, ideas, and editorial input, as well as his hospitality on the several occasions that I was
fortunate enough to visit ADFA. While the cancellation of Buffy the Vampire Slayer saved him
from acquiring a hernia by lugging my TV around during my post-Honours trips to Canberra,
I’m sure he would have gladly done so – with a smile – had I imposed. I’d also like to thank Dr.
Damian Buck and Lt. Adam Turley, members of Grant’s group, for their assistance in NMR
and molecular modeling experiments.
Finally, I’d like to thank my family for their support – especially my parents. Their
support over the past 27-and-a-bit years has been more than I could ever ask for and I will be
eternally grateful to them for it. I hope to be able to repay even a small amount of their kindness
someday (although that isn’t an invitation to come live with me when you retire).
Ironically, Captain James Cook himself offered no assistance over the past 4 years. Some
would point to the fact that even if he had managed to overcome the small obstacle of having
been devoured by irate Hawaiians, his advanced age would prevent him from providing
anything significant in the way of intellectual or physical aid. Codswallop. When I reach the
grand old age of 280 years (nicely preserved by the many litres of organic solvent I’ve no doubt
absorbed through my skin) they’ll have to pry the test tube out of my cold, undead hands.
vi
Abstract
This thesis reports on the nucleic acid-binding properties of a series of dinuclear
polypyridylruthenium(II) complexes of the general form [{Ru(pp)2}2(µ-BL)]4+ {where pp =
2,2′-bipyridine (bpy), 4,4′-dimethyl-2,2′-bipyridine (Me2bpy), 5,5′-dimethyl-2,2′-bipyridine
(5,5′-Me2bpy), 1,10-phenanthroline (phen), and 4,7-dimethyl-1,10-phenanthroline (Me2phen);
BL = 2,2′-bipyrimidine (bpm), 1,4,5,8,9,12-hexaazatriphenylene (HAT), 1,4,5,12-
tetraazatriphenylene (4,7-phenanthrolino-5,6:5′,6′-pyrazine; ppz), 2,3-bis(2-pyridyl)pyrazine
(2,3-dpp), and 2,5-bis(2-pyridyl)pyrazine (2,5-dpp)}. These complexes encompass three
general geometries as governed by their bridging ligands – “linear” (bpm), “angular” (HAT,
ppz, 2,3-dpp) and “stepped-parallel” (2,5-dpp) – and incorporate a systematic variation of
terminal ligand hydrophobicity and bulk. The stereoisomers of each complex were isolated by
means of cation-exchange chromatography and characterisation was achieved using 1H NMR
and CD spectroscopy.
Fluorescent Intercalator Displacement (FID) assays were used to survey to relative binding
affinities of this array of complexes to a library of oligonucleotides incorporating a variety of
different duplex, bulge, hairpin loop and quadruplex-forming sequences. Notable trends were
observed with respect to terminal ligand identity (increased hydrophobicity typically correlated
to stronger binding), bridging ligand identity (the “angular” class of complex was usually the
strongest binding), and stereochemistry (the meso diastereoisomer of a given complex typically
demonstrated the greatest affinity). Additionally, the metal complexes generally demonstrated a
heightened affinity for more open oligonucleotide structures such as bulges and loops, as well
as AT-rich duplex sequences.
A small number of discrepancies were noted in the results of the FID assays wherein the
relative order of binding affinity implied by the FID assay contradicted that suggested by other
experiments (NMR, equilibrium dialysis, affinity chromatography). These discrepancies were
rectified by replacing the intercalating dye used in the assay (ethidium bromide) with the minor
groove-binder DAPI (4′,6-diamidino-2-phenylindole), the binding mode of which more closely
resembles that of the metal complexes being investigated.
Electronic absorption titration experiments conducted with several of the complexes and
calf thymus DNA confirmed the correlations between ligand identity and stereochemistry seen
vii
in the FID (and modified DAPI-displacement) assays. Intrinsic binding constants obtained from
these titrations were within the range of mid-104 to low-105 M-1, consistent with previously
published values for dinuclear complex-calf thymus DNA interactions. Analogous titrations
using yeast tRNA yielded binding constants of a similar magnitude, but in these experiments no
clear relationship was evident between the nature of a given complex and its binding affinity.
One- and two-dimensional NMR experiments were used to probe in greater detail several
of the more notable metal complex-oligonucleotide interactions (as implied by the results of the
FID assays). These experiments confirmed the minor groove-binding nature of this genre of
metal complex and reaffirmed the oligonucleotide selectivities implied by the FID assays.
[{Ru(bpy)2}2(µ-bpm)]4+ and [{Ru(Me2bpy)2}2(µ-bpm)]4+ were found to bind poorly to a duplex
control sequence {d(CCGGAATTCCGG)2} and relatively weakly to the analogous sequence
possessing a single-base bulge {d(CCGAGAATTCCGG)2} and an octadecanucleotide
containing a four-base hairpin loop {d(CACTGGTCTCTACCAGTG)}, all consistent with the
affinities demonstrated by these particular complexes in the FID experiments. Conversely, the
meso diastereoisomers of [{Ru(phen)2}2(μ-HAT)]4+ and [{Ru(Me2phen)2}2(μ-HAT)]4+
confirmed their strong affinities to a six-base hairpin loop sequence
{d(CACTGGTCTCTCTACCAGTG)}. Each complex bound strongly to the stem-loop
interface of the icosanucleotide as evidenced by selective broadening of T-methyl and aromatic
resonances corresponding to protons within the loop/stem-loop interface. The extent of
broadening observed in these NMR experiments, coupled with the performance of each
complex in the FID assays, suggests a stronger yet less selective interaction by the Me2phen-
version of the complex. This significant broadening of both the icosanucleotide and metal
complex spectra prohibited a thorough NOESY characterisation of the binding, but the few
NOE signals that were obtained confirmed binding of the complexes at the stem-loop interface
and facilitated the construction of molecular models of each interaction.
NMR experiments were also used to investigate the unexpectedly-favourable association
meso-[{Ru(phen)2}2(μ-ppz)]4+ and the duplex oligonucleotide sequence
d(ATATATATATAT)2. Again, both the metal complex and oligonucleotide spectra exhibited
significant broadening upon interaction, suggesting moderate-to-strong binding. Furthermore,
several resonances corresponding to terminal phenanthroline ligand protons underwent large
upfield shifts. NOESY spectra revealed many strong NOE interactions between the terminal
ligands of the complex and minor groove sugar resonances, assisting the development of a
viii
binding model. The high selectivity of meso-[{Ru(phen)2}2(μ-ppz)]4+ for AT-rich regions of
duplex DNA was confirmed using a restriction enzyme inhibition assay wherein the metal
complex was found to interfere with the action of a restriction endonuclease that cuts double-
stranded DNA at the center of a TATA sequence.
The impressive selectivity inherent in many of these oligonucleotide-metal complex
interactions has been exploited in the development of a DNA-based affinity chromatography
technique for the highly efficient separation of different polypyridylruthenium(II) complexes,
as well as the stereoisomers of individual complexes. Separations requiring effective column
lengths in excess of 30 m on a cation-exchange column have been replicated using a column
length of less than 5 cm. This technique has proven useful in qualitatively establishing relative
binding affinities between complexes and a variety of oligonucleotides (duplex and non-
duplex), and was one of the tools used to confirm the validity of the DAPI-modified fluorescent
dye-displacement assay.
These studies demonstrate the utility of this genre of rigid dinuclear metal complexes as
sequence- and structure-selective probes of nucleic acids. Honing and targeting this selectivity
to specific biologically-relevant targets through a rational choice of ligands, functionality and
stereochemistry may potentially yield a new generation of more efficacious diagnostic and
therapeutic agents.
ix
Table of Contents
Statement of Access....................................................................................................................... iStatement of Sources..................................................................................................................... ii Statement of Contribution............................................................................................................ iii Acknowledgements...................................................................................................................... iv Abstract ...................................................................................................................... vi Table of Contents ...................................................................................................................... ix
CHAPTER 1 – INTRODUCTION ..............................................................1
1.1 PREAMBLE .................................................................................................................... 2 1.2 NUCLEIC ACIDS ............................................................................................................ 2
1.2.1 Function ............................................................................................................... 2 1.2.2 Structure............................................................................................................... 4 1.2.3 Conformations...................................................................................................... 8 1.2.4 Non-Duplex Structures ...................................................................................... 14
1.2.4.1 Bulges............................................................................................................. 14 1.2.4.2 Internal Loops ................................................................................................ 23 1.2.4.3 Hairpin Loops ................................................................................................ 24 1.2.4.4 Multiplexes ..................................................................................................... 32 1.2.4.5 Junctions ........................................................................................................ 35 1.2.4.6 Tertiary Structures ......................................................................................... 36
1.3 SMALL MOLECULE-NUCLEIC ACID INTERACTIONS..................................................... 37 1.3.1 General Comments............................................................................................. 37 1.3.2 Modes of Interaction .......................................................................................... 37 1.3.3 Selectivity of Interaction.................................................................................... 42
1.4 POLYPYRIDYLRUTHENIUM COMPLEX-NUCLEIC ACID INTERACTIONS......................... 46 1.4.1 Mononuclear Complexes ................................................................................... 46 1.4.2 Dinuclear Complexes......................................................................................... 55
1.5 REFERENCES ............................................................................................................... 64 CHAPTER 2 – SYNTHESIS AND STEREOCHEMICAL
PURIFICATION OF DINUCLEAR RUTHENIUM COMPLEXES..................................................................84
2.1 INTRODUCTION ............................................................................................................ 85
2.1.1 Background ......................................................................................................... 85 2.1.2 Polypyridylruthenium Complexes ...................................................................... 86 2.1.3 Chromatography ................................................................................................. 90 2.1.4 Applications ........................................................................................................ 92 2.1.5 Present Studies .................................................................................................... 93
x
2.2 EXPERIMENTAL............................................................................................................ 94 2.2.1 Materials ............................................................................................................. 94 2.2.2 Physical Measurements....................................................................................... 94 2.2.3 Synthetic Procedures........................................................................................... 95
2.2.3.1 Microwave Syntheses ...................................................................................... 95 2.2.3.2 Cation-Exchange Column Chromatography .................................................. 95 2.2.3.3 Synthesis of Mononuclear Precursors ............................................................ 97 2.2.3.4 Synthesis of Dinuclear Complexes.................................................................. 98
2.3 RESULTS & DISCUSSION ............................................................................................ 104 2.3.1 Synthesis ........................................................................................................... 104 2.3.2 Chromatography ............................................................................................... 105 2.3.3 NMR Spectroscopy........................................................................................... 111
2.3.3.1 General Comments........................................................................................ 111 2.3.3.2 Terminal Ligands .......................................................................................... 112 2.3.3.3 Linear-bridged Complexes............................................................................ 113 2.3.3.4 Angular-bridged Complexes ......................................................................... 114 2.3.3.5 Stepped Parallel-bridged Complexes ........................................................... 119
2.3.4 Electronic Absorption Spectroscopy................................................................. 122 2.4 SUMMARY.................................................................................................................. 124 2.5 REFERENCES .............................................................................................................. 126
CHAPTER 3 – FLUORESCENCE AND ELECTRONIC ABSORPTION SPECTROSCOPY INVESTIGATIONS INTO THE DNA-BINDING PROPERTIES OF DINUCLEAR RUTHENIUM COMPLEXES ..........................................131
3.1 INTRODUCTION .......................................................................................................... 132
3.1.1 Methods of Investigating Metal Complex-Nucleic Acid Interactions.............. 132 3.1.2 The Fluorescent Dye Displacement Assay ....................................................... 135 3.1.3 Present Studies .................................................................................................. 136
3.2 EXPERIMENTAL.......................................................................................................... 136 3.2.1 Materials ........................................................................................................... 136 3.2.2 Physical Measurements..................................................................................... 138 3.2.3 Fluorescent Intercalator Displacement (FID) Assay......................................... 138 3.2.4 Fluorescent Minor Groove-Binder Displacement Assay.................................. 139 3.2.5 Electronic Absorption Titrations....................................................................... 140
3.3 RESULTS & DISCUSSION ............................................................................................ 140 3.3.1 Overview of the FID Assay .............................................................................. 140 3.3.2 General Trends Observed in the FID Assay ..................................................... 141
3.3.2.1 Terminal Ligands .......................................................................................... 141 3.3.2.2 Bridging Ligands .......................................................................................... 143 3.3.2.3 Stereoisomers ................................................................................................ 146 3.3.2.4 Oligonucleotides ........................................................................................... 148 3.3.2.5 Notable Specific Interactions ........................................................................ 151
3.3.3 Discrepancies in the FID Assay........................................................................ 152
xi
3.3.4 Modification of the FID Assay to Use DAPI.................................................... 155 3.3.5 Quantitation of Binding Affinity by Absorption Spectroscopy........................ 157
3.4 CONCLUSIONS............................................................................................................ 164 3.5 REFERENCES .............................................................................................................. 166
CHAPTER 4 – NMR SPECTROSCOPY INVESTIGATIONS INTO THE
DNA-BINDING PROPERTIES OF DINUCLEAR RUTHENIUM COMPLEXES 171
4.1 INTRODUCTION .......................................................................................................... 172
4.1.1 NMR as a Tool for Studying Nucleic Acids..................................................... 172 4.1.2 NMR Investigations of Groove-Binding Dinuclear Species ............................ 173 4.1.3 Present Studies .................................................................................................. 178
4.2 EXPERIMENTAL.......................................................................................................... 180 4.2.1 Materials ........................................................................................................... 180 4.2.2 Physical Measurements..................................................................................... 180 4.2.3 NMR Procedures............................................................................................... 180
4.2.3.1 Oligonucleotide Preparation ........................................................................ 181 4.2.3.2 NMR Titrations ............................................................................................. 181 4.2.3.3 Determination of Binding Constants ............................................................ 182
4.2.4 Molecular Modelling ........................................................................................ 182 4.2.5 Restriction Endonuclease Inhibition Assay ...................................................... 183
4.2.5.1 Preparing the TATA Box Sequence Oligonucleotide.................................... 183 4.2.5.2 Digesting the Oligonucleotide ...................................................................... 184 4.2.5.3 Running the Gel ............................................................................................ 185
4.3 RESULTS & DISCUSSION ............................................................................................ 185 4.3.1 Assignment of Metal Complex Resonances ..................................................... 185 4.3.2 Assignment of Oligonucleotide Resonances .................................................... 185 4.3.3 Binding of HAT-Bridged Species to Duplex and Bulge-DNA ........................ 190 4.3.4 Binding of HAT-Bridged Species to a 4-Base Hairpin Loop ........................... 193 4.3.5 Binding of HAT-Bridged Species to a 6-Base Hairpin Loop ........................... 193 4.3.6 Binding of ppz-Bridged Species to an AT Duplex ........................................... 202 4.3.7 Inhibition of Restriction Enzyme Activity at a TATA Box.............................. 207
4.4 CONCLUSIONS & FUTURE DIRECTIONS ...................................................................... 209 4.5 REFERENCES .............................................................................................................. 212
CHAPTER 5 – SEPARATION OF METAL COMPLEX
STEREOISOMERS USING DNA-AFFINITY CHROMATOGRAPHY...................................................217
5.1 INTRODUCTION .......................................................................................................... 218
5.1.1 Affinity Chromatography.................................................................................. 218 5.1.2 DNA as a Chromatographic Medium ............................................................... 218
xii
5.1.3 Present Studies .................................................................................................. 220 5.2 EXPERIMENTAL.......................................................................................................... 220
5.2.1 Materials ........................................................................................................... 220 5.2.2 Physical Measurements..................................................................................... 220 5.2.3 Synthesis of Metal Complexes.......................................................................... 221 5.2.4 Chromatography ............................................................................................... 221
5.3 RESULTS & DISCUSSION ............................................................................................ 224 5.3.1 Separation of Different Complexes .................................................................. 224 5.3.2 Separation of Diastereoisomers ........................................................................ 225 5.3.3 Resolution of Enantiomers................................................................................ 226 5.3.4 Scale-Up of the Technique................................................................................ 229 5.3.5 [Ru(phen)3]2+ Sequence Selectivity .................................................................. 230 5.3.6 [Ru2(qtpy)3]4+ Sequence Selectivity.................................................................. 232 5.3.7 Validating the DAPI-Displacement Fluorescence Assay ................................. 233 5.3.8 Resusability of the Medium.............................................................................. 236
5.4 CONCLUSIONS & FUTURE DIRECTIONS ...................................................................... 236 5.5 REFERENCES .............................................................................................................. 238
CHAPTER 6 – EPILOGUE ...................................................................241 APPENDIX A – LIGAND STRUCTURES...................................................................................... 247 APPENDIX B – NMR SPECTRA ................................................................................................ 253 APPENDIX C – ELECTRONIC ABSORPTION SPECTRA ............................................................. 265 APPENDIX D – FID DATA ........................................................................................................ 277 APPENDIX E – ELECTRONIC ABSORPTION TITRATIONS ........................................................ 298 APPENDIX F – OLIGONUCLEOTIDE NMR ASSIGNMENTS....................................................... 320 APPENDIX G – PUBLICATIONS & PRESENTATIONS................................................................. 323