1

Sialic acid transport contributes to pneumococcal colonization

Carolyn Marion1, 2, Amanda M. Burnaugh1, 2, Shireen A. Woodiga1, Samantha J. King*1, 2

1Center for Microbial Pathogenesis, The Research Institute at Nationwide Children’s Hospital,

and 2Department of Pediatrics, The Ohio State University College of Medicine, Columbus, OH.

Running title: Sialic acid transport in pneumococcus

Corresponding author: Samantha J. King, Ph.D.

Department of Pediatrics, The Ohio State University College of Medicine, and The Research

Institute at Nationwide Children’s Hospital, Center for Microbial Pathogenesis

Room W511

700 Children’s Drive

Columbus, OH 43205-2696 USA

Phone: (614) 722-2912

Fax: (614) 722-2818

e-mail: samantha.king@nationwidechildrens.org

Key-words: Streptococcus pneumoniae, sialic acid, bacterial colonization, ABC transport

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.00832-10 IAI Accepts, published online ahead of print on 28 December 2010

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

2

Abstract 1

Streptococcus pneumoniae is a major cause of pneumonia and meningitis. Airway 2

colonization is a necessary precursor to disease, but little is known about how the bacteria 3

establish and maintain colonization. Carbohydrates are required as a carbon source for 4

pneumococcal growth and, therefore, for colonization. Free carbohydrates are not readily 5

available in the naso-oropharynx; however, N- and O-linked glycans are common in the 6

airway. Sialic acid is the most common terminal modification on N- and O-linked glycans, and 7

is likely encountered frequently by S. pneumoniae in the airway. Here we demonstrate that 8

sialic acid supports pneumococcal growth when provided as a sole carbon source. Growth on 9

sialic acid requires import into the bacterium. Three genetic regions have been proposed to 10

encode pneumococcal sialic acid transporters: one sodium solute symporter, and two ATP 11

binding cassette (ABC) transporters. Data demonstrate that one of these, satABC, is required 12

for transport of sialic acid. A satABC mutant displayed significantly reduced growth on both 13

sialic acid and the human glycoprotein, alpha-1. The importance of satABC for growth on 14

human glycoprotein suggests that sialic acid transport may be important in vivo. Indeed, the 15

satABC mutant was significantly reduced in colonization of the murine upper respiratory tract. 16

This work demonstrates that S. pneumoniae is able to use sialic acid as a sole carbon source 17

and that utilization of sialic acid is likely important during pneumococcal colonization. 18

19

Introduction 20

Streptococcus pneumoniae (pneumococcus) is responsible for over one million deaths per 21

year worldwide (42). Although asymptomatic, colonization of the naso-oropharynx is required 22

for the bacteria to cause disease (38). Relatively little is known about pneumococcal growth 23

and colonization of the airway. Carbohydrates provide a carbon source to the bacteria and are 24

therefore necessary for growth. Free carbohydrates are not readily available in the airway 25

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

3

where initial colonization occurs (24). Instead, carbohydrates are found in the form of glycan 26

modifications on human lipids and proteins. 27

28

S. pneumoniae express at least nine surface-associated glycosidases that modify host glycans 29

(for review, see (12)). The ability to deglycosylate host glycans could contribute to bacterial 30

survival by multiple mechanisms including but not limited to: providing a carbon source for 31

growth, modifying function of host clearance molecules, competing with other bacteria for a 32

niche, aiding in movement through the mucin layer and promoting adherence to epithelial cells 33

(3, 8, 14, 29, 33, 43). It was previously demonstrated that pneumococci sequentially 34

deglycosylate both N- and O-linked glycan structures (14, 18). We have demonstrated that S. 35

pneumoniae can grow on a human protein decorated with N-linked glycans and that this 36

growth is dependent on the ability of the bacteria to sequentially deglycosylate this structure 37

(3). The most common terminal carbohydrate present on N- and O-linked glycans is sialic acid, 38

which is cleaved by pneumococcal neuraminidase NanA. As sialic acid is the initial sugar 39

released during sequential deglycosylation, we hypothesize it will contribute to pneumococcal 40

growth in vivo. 41

42

Further supporting our hypothesis that sialic acid can be utilized for growth, S. pneumoniae is 43

predicted to encode required proteins for the catabolism of sialic acid (2). While the catabolic 44

enzymes appear to be conserved amongst many bacterial species, four distinct mechanisms 45

of sialic acid transport have been identified: the major facilitator superfamily, sodium solute 46

symporters, tripartite ATP-independent transporters, and ATP-binding cassette (ABC) 47

transporters (1, 2, 25-27, 30, 36). Through a bioinformatics approach, a putative sodium 48

solute symporter encoded by open reading frame SP1328 in strain TIGR4 was initially 49

predicted to be the primary pneumococcal sialic acid transporter (32, 35). Based on similarity 50

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

4

to known sialic acid transporter components, it was later suggested that putative permease 51

components of the ABC transporters SP1681-3 and SP1688-90 may also be involved in sialic 52

acid uptake (2). 53

54

Here, we show that S. pneumoniae can utilize sialic acid as a carbon source for growth. 55

Furthermore, using mutants in the three predicted transporters we identify the ABC transporter 56

encoded by SP1681-3 as the primary sialic acid transporter. This sialic acid transporter 57

contributes to growth on a human glycoprotein and colonization in vivo. Together, these data 58

suggest that sialic acid transport may be important for pneumococcal pathogenesis. 59

60

Materials and Methods 61

Bacterial strains, culture media, and chemicals. Parental and genetically modified strains of 62

S. pneumoniae utilized in this study are described in Table 1. Broth cultures were routinely 63

grown at 37°C in Todd-Hewitt broth (Becton, Dickinson, and Company) supplemented with 64

0.2% w/v yeast extract (Becton, Dickinson, and Company) (THY). C media with 5% yeast 65

extract (C+Y) pH 8.0 was used for transformations. Chemically defined medium (CDM) was 66

used for growth analyses and was supplemented with no sugar, 12 mM glucose, 12 mM sialic 67

acid, or 5 mg ml-1 alpha-1 glycoprotein (AGP), as indicated (15). S. pneumoniae was also 68

grown at 37°C and 5% CO2 overnight on tryptic soy agar plates (Becton, Dickinson, and 69

Company) spread with 5000 U of catalase (Worthington Biochemical Corporation) prior to 70

plating bacteria as well as on trypic soy agar plates supplemented with 5% sheep blood 71

(Becton, Dickinson, and Company). Bacteria were selected on tryptic soy agar plates that 72

contained streptomycin (200 µg ml-1), kanamycin (500 µg ml-1), chloramphenicol (2.5 µg ml-1) 73

or neomycin (20 µg ml-1), as appropriate. 74

75

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

5

Unless otherwise specified, all chemicals, substrates, and enzymes were purchased from 76

Sigma Chemicals. 77

78

Construction of mutants. Unmarked, in-frame deletions of the putative sialic acid 79

transporters were generated using the Janus cassette selection system (31). This method 80

requires two rounds of transformations. The first round introduces an engineered cassette 81

conferring kanamycin resistance and streptomycin sensitivity (rpsL+) into a streptomycin 82

resistant (Smr) parental strain. Regions flanking the gene(s) of interest were amplified with 83

primers 1 and 2, and 4 and 6, then sequentially joined to the Janus cassette using modified 84

splicing by overlap extension (SOE) (3, 10). A high fidelity proofreading polymerase, Pfx-50, 85

(Invitrogen) was used throughout to minimize PCR-generated errors and all genomic DNA was 86

prepared essentially as described previously (41). All Janus constructs were transformed into 87

pneumococci and transformants were selected on kanamycin and confirmed by PCR with 88

primers 7 and 8, which flank the mutant construct. All primer sequences can be found in Table 89

2. 90

91

The second round of transformation replaced the Janus cassette with a DNA construct 92

consisting of the fragments flanking the region to be deleted; these fragments were generated 93

with primers 1 and 3, and 5 and 6 and joined by SOE PCR. Introduction of this construct 94

restores kanamycin sensitivity and streptomycin resistance. Transformants were confirmed by 95

PCR with primers 7 and 8 and genetic sequencing of this same region confirmed that no 96

spurious mutations had been introduced during generation of the mutants. As opacity can also 97

affect pneumococcal colonization and glycosidase expression all mutants were confirmed as 98

being of the same opacity as that of their parental strains (13, 40). 99

100

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

6

All mutants have been genetically reconstituted by reintroducing the deleted region into the 101

same genetic location in the same orientation through two additional rounds of genetic 102

transformation: one to reintroduce the cassette and the second to restore the original parental 103

region. Growth of all strains was tested in rich medium to ensure that the mutation did not 104

introduce generalized growth defects. 105

106

The glycosidase NanA is predicted to be encoded in a single gene transcript (32). Therefore, 107

an insertion-deletion mutation was constructed as previously described (13, 14). 108

109

RNA extraction and reverse transcriptase PCR. The Janus system of mutant generation is 110

designed to generate unmarked mutants; however, as the genes encoding the predicted ABC 111

transporters are predicted to be in operons, we demonstrated the mutants had no effect on 112

transcription of the distal genes by reverse transcriptase PCR. RNA extraction was conducted 113

using a modified RNeasy extraction protocol (Qiagen). Bacteria were grown in THY to OD600 = 114

0.3 ± 0.01. Each 5 ml culture was centrifuged and resuspended in 500 µl of 10 mM Tris, 50 115

mM EDTA (pH 8) and cells were lysed by addition of 30 µl of sodium N-lauroyl sarcosinate 116

(20% w/v) with incubation for 10 min at 37°C. Concentrated samples were combined with 2 ml 117

of Tri-Reagent (MRC Inc.) and allowed to stand at room temperature for 5 min. A 400 µl 118

aliquot of chloroform was added to each sample followed by gentle shaking for 15 s and then 119

allowed to stand at room temperature for an additional 3 min. After centrifugation at 4000 x g 120

at 4°C for 15 min, the aqueous layer was removed and 1 volume of 75% ethanol was added 121

and mixed by pipetting. Samples were then processed on RNeasy mini columns (Qiagen), 122

eluted into 30 µl of RNAse-free water and quantified on a Nanodrop spectrophotometer. 123

124

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

7

After DNAse I treatment (Invitrogen), 1 µg of RNA was used for cDNA synthesis with 125

SuperScript II reverse transcriptase (Invitrogen) according to the manufacturer’s specifications. 126

Parallel samples lacking reverse transcriptase were processed and served as a negative 127

control for each sample to ensure purity of RNA isolation. cDNA and no reverse transcriptase 128

negative control samples were tested by PCR; primers 9 and 10 were designed in the 129

immediate downstream gene to the relevant mutations, and primers RT.F and RT.R are within 130

a control housekeeping gene, aroE (Table 2). Products were visualized by agarose gel 131

electrophoresis and ethidium bromide staining. 132

133

Dialysis of human alpha-1 glycoprotein (AGP). Dialysis was conducted in order to remove 134

any free sugar from AGP as previously described (3). The Slide-A-Lyzer dialysis cassette 135

(10,000 molecular weight cutoff) was used according to the instructions of the manufacturer 136

(Pierce). Human AGP was reconstituted at 10 mg ml-1 in distilled water (dH2O) and dialyzed 137

against 2 L of dH2O at 4°C for 2 h and then overnight in fresh, prechilled dH2O (2 L). Samples 138

were concentrated using Slide-A-Lyzer concentrating solution (Pierce) according to the 139

instructions provided, and the protein was then extracted, diluted to the original volume, filter 140

sterilized, and stored at 4°C. 141

142

Growth Assays. Growth assays were conducted essentially as described previously by our 143

laboratory (3). S. pneumoniae strains were grown in THY medium to an OD600 of 0.6 ± 0.005, 144

representative of exponential growth, and 1 ml was washed and resuspended in 130 µl of 1:1 145

phosphate buffered saline (PBS):catalase (3x104 U ml-1). 20 µl of bacterial suspension or 146

PBS/catalase (no bacteria control) was added to 180 µl of CDM supplemented with the 147

appropriate carbon source (12 mM glucose, 12 mM sialic acid, or 5 mg ml-1 AGP). Medium 148

supplemented with glucose (12 mM) was used as a positive control in all experiments to 149

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

8

confirm the viability of strains. Medium supplemented with no sugar served as a negative 150

control in all experiments. Plates were incubated at 37oC in a BIO-TEK Synergy HT plate 151

reader for at least 60 h and OD600 was measured every 20 min. 152

153

Data were corrected for path-length and the averages from triplicate no-sugar medium controls 154

were subtracted from values for experimental wells. Results for triplicate wells were then 155

averaged, and this value was considered as one datum point for further analysis. Data from at 156

least three independent experiments were averaged, and the 95% confidence interval was 157

calculated for each time point. 158

159

To determine if the growth of bacterial inoculums on rich media contributed to the delay 160

observed in growth on sialic acid, as compared to glucose, we prepared inoculums from 161

bacteria grown on sialic acid. Bacteria were prepared and grown on sialic acid in a 96-well 162

plate as described above. When strains reached a path-length corrected OD600 of 0.3, 163

bacteria were harvested from the wells, pooled, washed in PBS and resuspended in 1:1 164

PBS:catalase. To ensure a fair comparison of growth between conditioned and non-165

conditioned bacteria it is important to use essentially identical bacterial inoculums. To achieve 166

this goal a range of dilutions of the conditioned bacteria recovered from the plate was used to 167

inoculate fresh sialic acid media. Enumeration of inoculums allowed selection of wells 168

containing inoculums closest to but not exceeding the original inoculums. 169

170

Neuraminidase activity assay. Neuraminidase activity was measured using a fluorimetric 171

assay (16). The fluorogenic substrate 2’-(4-methyl-umbelliferyl)-a-D-N acetylneuraminic acid 172

(MUAN) was resuspended in 0.25 M sodium acetate buffer (pH 7) at 0.35% (wt/vol) and stored 173

in aliquots at -20°C. After cultures were grown to an OD600 of 0.2 ± 0.01 in CDM 174

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

9

supplemented with 5 mg ml-1 AGP, bacteria were toluene lysed. 10 µl of MUAN was mixed 175

with 10 µl of bacterial lysate and incubated at 37°C for 5 min. The reaction was stopped by the 176

addition of 1.5 ml of 50 mM sodium carbonate buffer pH 9.6. The fluorescence was detected 177

using a BIO-TEK Synergy HT plate reader at an excitation wavelength of 366 nm and an 178

emission wavelength of 446 nm. The average fluorescence of controls with media alone was 179

subtracted from the sample readings. Experiments were conducted three times in triplicate; 180

significance was determined by a two-tailed Student’s t-test, and a P-value below 0.05 was 181

considered significant. 182

183

Southern blot. Distribution of SP1328 was assessed via Southern blot analysis. Each 2 µg 184

sample of genomic DNA was digested with the restriction enzyme EcoRV (Fisher Scientific) for 185

2 h at 37°C. Samples were resolved on a 1% agarose gel and visualized by ethidium bromide 186

staining to ensure that DNA was digested and present in each lane. The Turboblotter rapid 187

alkaline transfer system (Whatman) was used according to the manufacturer’s instructions to 188

transfer digested DNA to a polyvinylidine fluoride membrane. DNA was crosslinked to the 189

membrane via UV radiation. The DNA probe was generated via PCR using primers C.9 and 190

C.10 (Table 2) and labeled using the ECL Direct Nucleic Acid Labeling and Detection System 191

(GE Life Sciences). Hybridization was conducted as per the manufacturer’s instructions and 192

followed by autoradiography to detect DNA binding. 193

194

Sialic acid transport assay. Cultures of parental and mutant S. pneumoniae strains were 195

grown in THY broth to an OD600 of 0.6 ± 0.01. Each sample was pelleted, washed in PBS and 196

concentrated in CDM without sugar to an OD600 = 2.0. CDM containing sialic acid was 197

prepared such that [3H]-sialic acid (American Radiolabeled Chemicals Inc.) accounted for 1% 198

total sialic acid. Triplicate 90 µl aliquots were first incubated for 3 min at 37°C to acclimate. 199

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

10

CDM medium containing sialic acid was then added to the culture to achieve a final 200

concentration of 2.5 µM. After incubation at 37°C for the designated time, reactions were 201

terminated by filtration through 0.22 µm filters (Millipore). Filters were washed 3 times with 2 202

ml CDM without sugar. After air-drying the filters, 10 ml of 30% ScintiSafe LCS Cocktail 203

(Fisher Scientific) was added to each sample. Incorporated sialic acid was measured in a 204

Packard Tri-Carb Liquid Scintillation Analyzer. Average measurements conducted with heat-205

killed bacteria were subtracted from each value. Data were normalized to label incorporated 206

per 107 cells. Time course experiments were conducted twice in triplicate. All other transport 207

experiments were conducted three times in triplicate. Where applicable, significance was 208

determined by a two-tailed Student’s t-test and a P-value below 0.05 was considered 209

significant. 210

211

Murine colonization. Nasopharyngeal colonization was performed as described previously 212

(19). Groups of 10, 6 to 8 week-old female C57BL/6 mice (Jackson Laboratory) were 213

inoculated intranasally with 1 x 108 mid-log-phase organisms of 1121 Smr, 1121 ∆satABC, 214

1121 ∆SP1688-90, 1121 ∆satABC ∆SP1688-90, or 1121 ∆nanA. After 5 days, the density of 215

colonization was assessed by upper respiratory tract lavage and quantitative culture of 216

recovered organisms on tryptic soy agar supplemented with neomycin. The animal data are 217

presented as the mean colony forming units ml-1 ± SEM (standard error of the mean). 218

Significance was assessed by a two-tailed Student’s t-test; a P-value below 0.05 was 219

considered significant. 220

221

Results 222

S. pneumoniae can utilize sialic acid as a sole carbon source. We have previously 223

demonstrated the ability of S. pneumoniae to remove sialic acid from both N- and O-linked 224

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

11

glycans via neuraminidase cleavage (3, 14, 18). As sialic acid is found terminally positioned 225

on glycoconjugates, S. pneumoniae likely encounters sialic acid frequently in the airway (7). 226

Release of sialic acid may thus provide S. pneumoniae with a source of carbohydrates 227

necessary for growth. To first test whether sialic acid could be used as a sole carbon source, 228

bacteria were grown in CDM supplemented with sialic acid. Sialic acid was able to support 229

significant pneumococcal growth (OD600=0.4), although, this growth was delayed and to a 230

lower final optical density than growth in glucose at the same molar concentration (Fig. 1). 231

Conditioning bacteria in sialic acid media resulted in a reduction, but not elimination, of the 232

time taken to achieve the maximal optical density (data not shown). These data suggest that 233

the delay in growth on sialic acid is in part due to the prior growth of the bacteria in rich media. 234

235

To determine whether sialic acid can support the growth of diverse pneumococcal strains, 236

recent clinical isolates of different serotypes and genetic backgrounds (Table 1) were tested for 237

their ability to utilize sialic acid as a sole carbon source (data not shown). While growth rate 238

and maximal OD600 achieved varied, each strain tested grew on sialic acid, suggesting that the 239

ability to utilize sialic acid is conserved. In order for S. pneumoniae to utilize sialic acid as a 240

nutrient source, the bacteria must have a mechanism for import of the carbohydrate; however, 241

no pneumococcal sialic acid transporter has yet been identified. 242

243

Proposed pneumococcal sialic acid transporters. Based on annotation of the TIGR4 244

genome, three distinct genetic regions have been suggested to encode sialic acid transporters: 245

a predicted sodium solute symporter SP1328, and two predicted ABC transporters SP1681-3, 246

and SP1688-90 (Fig. 2) (2, 27, 32, 35). Of these, the predicted sodium solute symporter 247

(SP1328) was previously proposed to be the primary transporter (35). However, the open 248

reading frame SP1328 is absent in at least half of pneumococcal strains (23, 35). By Southern 249

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

12

blot analysis, strain 1121, and 4 of 5 recent clinical isolates tested were shown to lack 250

homologs to SP1328, and yet were all able to maintain growth upon sialic acid (Fig. 1, data not 251

shown). These data suggest that SP1328 is not the primary sialic acid transporter; therefore, 252

initial efforts focused on determining the role of the two putative ABC transporters. 253

254

The open reading frames SP1681-3 and SP1688-90 are predicted to encode components of 255

ABC transporters (Fig. 2) (32). Unlike the predicted symporter, both loci are considered to be 256

part of the pneumococcal core genome (20). Presence of open reading frames SP1681-3 and 257

SP1688-90 was confirmed in strain 1121 and five recent clinical isolates by PCR amplification 258

(Table 1, data not shown). These genes exist in proximity to the genes encoding the two 259

characterized neuraminidases, NanA and NanB, as well as a predicted sugar kinase 260

(SP1675), a predicted N-acetylneuraminate lyase (SP1676), and a predicted N-261

acetylmannosamine-6-phosphate 2-epimerase (SP1685) (32). Together, this evidence 262

suggests that one or both of these predicted ABC transporters are involved in sialic acid 263

utilization. 264

265

SP1681-3 (satABC) is required for growth on sialic acid. In order to test whether SP1681-266

3 or SP1688-90 contribute to growth on sialic acid, unmarked deletions were constructed, 267

resulting in strains 1121 ∆1681-3, 1121 ∆1688-90, and 1121 ∆1681-3 ∆1688-90. Mutations 268

were confirmed by both PCR and sequencing and determined to lack polar effects by reverse-269

transcriptase PCR (data not shown). Data suggest that only one of these regions, SP1681-3, 270

contributed to growth on sialic acid (Fig. 3). As such, 1121 ∆1681-3, but not 1121 ∆SP1688-271

90, showed a significant reduction in growth (maximum OD600 < 0.1) compared to the parental 272

strain 1121 Smr. The double mutant showed no additional reduction in growth, suggesting that 273

no additive effect of the two transporters existed (data not shown). All mutant strains were 274

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

13

genetically reconstituted, and each reconstituted strain grew as efficiently as the parent on 275

sialic acid (data not shown). These data suggest that SP1681-3 encodes the primary sialic 276

acid transporter in S. pneumoniae, and henceforth is referred to as the sialic acid transporter, 277

satABC. In this locus, satA (SP1683) is predicted to encode a substrate binding protein, while 278

satB (SP1682) and satC (SP1681) are predicted to encode permease components. 279

280

satABC is required for transport of sialic acid. To directly test whether satABC encodes a 281

sialic acid transporter, uptake assays utilizing radiolabeled sialic acid were conducted. A time 282

course experiment with the parental strain was conducted first to demonstrate temporal 283

increase in uptake of [3H] sialic acid (Fig. 4A). From this experiment, a ten-minute incubation 284

time was selected for subsequent experiments. When compared to the parent strain, 1121 285

∆satABC was significantly reduced in uptake of [3H] sialic acid (Fig 4B). While SP1688-90 286

showed no growth defect on sialic acid, it remained possible that this predicted transporter was 287

still responsible for some uptake of sialic acid. However, the SP1688-90 mutant strain showed 288

no statistically significant reduction in transport of sialic acid under these conditions and the 289

double mutant showed no significant reduction in transport compared to the satABC single 290

mutant (Fig. 4B). These data demonstrate that satABC encodes the primary transporter for 291

sialic acid under these conditions. 292

293

The SP1328 predicted symporter does not contribute to sialic acid transport. Although 294

1121 lacks the predicted sodium solute symporter, it remained possible that SP1328 295

contributes to transport of sialic acid when present. To test this, we measured the uptake of 296

[3H] sialic acid in the TIGR4 strain which contains all three candidate transporters. TIGR4 297

∆satABC showed a significant reduction in sialic acid transport which could be restored in the 298

genetically reconstituted strain, TIGR4 ∆satABC /satABC+ (Fig. 4C). A TIGR4 ∆satABC 299

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

14

∆SP1688-90 ∆SP1328 triple mutant had no greater reduction compared to the satABC mutant, 300

which suggests that neither SP1688-90 nor SP1328 contribute to sialic acid import under these 301

assay conditions. Overall transport in the TIGR4 background was lower than for 1121; this is 302

consistent with the delayed growth and lower maximal OD achieved when TIGR4 is grown on 303

sialic acid as a sole carbon source (data not shown). Together, these data suggest that 304

satABC encodes the primary sialic acid transporter in multiple strain backgrounds. 305

306

satABC contributes to growth on human glycoprotein. While the data presented 307

demonstrate that SatABC transports sialic acid, we wanted to test whether this transport 308

contributed to growth on human glycoprotein. We have previously shown that S. pneumoniae 309

can grow on a model human glycoprotein, AGP (3). AGP is decorated with complex N-linked 310

glycans containing terminal sialic acid, galactose, and N-acetylglucosamine. These three 311

carbohydrates can be sequentially cleaved by pneumococcal exoglycosidases (neuraminidase 312

NanA, beta-galactosidase BgaA, and N-acetylglucosaminidase StrH) and used for growth. 313

Mutation of any of these exoglycosidases results in a reduction in growth (3). Thus, sialic acid 314

released by neuraminidase and transported by SatABC likely contributes to growth of S. 315

pneumoniae. We therefore hypothesized that the inability to transport sialic acid would result 316

in a reduction, but not elimination of growth on AGP. 317

318

When 1121 Smr and the satABC mutant were grown on AGP, a significant reduction in growth 319

on AGP was seen for 1121 ∆satABC (Fig. 5); growth was restored in the 1121 320

∆satABC/satABC+ reconstituted strain (data not shown). As was the case with growth on free 321

sialic acid, 1121 ∆1688-90 was not significantly reduced in growth on AGP and the double 322

mutant showed no further reduction compared to 1121 ∆satABC (Fig. 5 and data not shown), 323

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

15

suggesting that SP1688-90 does not contribute to growth on AGP under these experimental 324

conditions. 325

326

As the transport of a substrate into the cell often upregulates utilization pathways, it was 327

possible that 1121 ∆satABC may express lower neuraminidase levels than 1121 Smr (6, 11). 328

A reduction in neuraminidase expression would reduce cleavage of sialic acid, which would 329

restrict other pneumococcal glycosidases from releasing underlying carbohydrates for growth. 330

To determine if less efficient cleavage of carbohydrates from AGP significantly contributed to 331

the reduced growth of 1121 ∆satABC, the neuraminidase activity of bacteria growing on AGP 332

(OD600 = 0.3) was determined. No significant difference in neuraminidase activity between the 333

mutant and parental strain was observed (data not shown). This supports the original 334

hypothesis that the inability to utilize sialic acid results in a reduction in growth on AGP. As 335

glycoconjugates are likely used as a carbon source during colonization, these data suggest 336

that sialic acid utilization contributes to growth in the airway. 337

338

satABC contributes to airway colonization. Although no reduction in colonization was 339

observed in a ∆nanA mutant compared to the parental strain, it remained possible that 340

transport of sialic acid may still contribute to colonization (data not shown). Indeed, 341

significantly fewer bacteria were recovered from the upper respiratory tract of mice inoculated 342

with 1121 ∆satABC when compared to those inoculated with 1121 Smr, suggesting that sialic 343

acid transport contributes to colonization (Fig. 6). In contrast, 1121 ∆1688-90 showed no 344

significant attenuation in vivo and there was no statistically significant difference in colonization 345

between 1121 ∆satABC and 1121 ∆satABC ∆1688-90. Although we cannot rule out that 346

SP1688-90 is important at other times during infection or that its role is human-specific, these 347

data suggest that SP1688-90 does not contribute to airway colonization. Collectively, these 348

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

16

data demonstrate that satABC, and presumably transport of sialic acid, is important for 349

colonization of the naso-oropharynx. 350

351

Discussion 352

Data here demonstrate that sialic acid can be used as a sole carbon source for growth. 353

Several bacteria that are able to colonize the human airway or gut mucosa have been shown 354

to utilize sialic acid as a carbon source, including H. influenzae, and multiple streptococcal and 355

bifidobacteria strains (4, 5, 28, 34, 37). Growth of S. pneumoniae on free sialic acid appeared 356

less efficient than growth on the same molar concentration of glucose under our experimental 357

conditions. While the reason for this remains unknown, it may relate to the differences in the 358

carbohydrate structures, or mechanisms of transport. Even though growth on sialic acid may 359

be less efficient than other carbohydrates, because it is often the first carbohydrate 360

encountered on glycoconjugates it is likely used as a carbon source in the airway. 361

362

Growth on sialic acid is dependent upon satABC which encodes an ABC transporter. The 363

absence of satABC resulted in reduced bacterial growth on a human glycoprotein and reduced 364

colonization in a mouse model, suggesting that this genetic locus and therefore transport of 365

sialic acid are important for human airway colonization. Previous studies have suggested co-366

regulation of the operon containing satABC and nanA; as nanA encodes the neuraminidase 367

that cleaves terminal sialic acid from host glycoconjugates, these data suggest the cleavage 368

and utilization of sialic acid is a coordinated process (13). 369

370

Despite this, a nanA mutant showed no reduction in colonization in the same model, although 371

a role for NanA in murine colonization has previously been demonstrated (17, 21). The reason 372

for this discrepancy is unclear, but data here are consistent with our previous colonization 373

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

17

modeling with nanA mutants in other strain backgrounds (13, 14). These results may indicate 374

that SatABC has additional unidentified substrates or that sialic acid is being made available to 375

pneumococcus by some other mechanism. It is possible that host protein turnover or 376

neuraminidases from other sources, including the host, other bacterial cohabitants of the 377

niche, or pneumococcus itself (NanB), may each contribute to sialic acid availability that is 378

independent of NanA. 379

380

The SatABC transporter is a member of the ABC transport superfamily. Although other ABC 381

transporters are predicted to import sialic acid, the only other characterized ABC transporter 382

responsible for sialic acid import is SatABCD in Haemophilus ducreyi (25). ABC importers 383

require two nuclear binding domains (ATPases), two transmembrane domains (permeases) 384

and a substrate-binding domain that confers specificity (9, 22). The genetic organization of 385

satABC in pneumococcus notably lacks predicted ATPases. While transport components are 386

typically organized within a single operon, there are other examples of streptococcal species 387

lacking ATPases in operon organization (39). Our data show that the SatABC transporter is 388

functional for uptake and utilization of sialic acid, and thus require that the ATPases be 389

encoded elsewhere. 390

391

The functions of the other two predicted sialic acid transporters remain unknown. Despite 392

SP1688-90 and SP1328 being located within the same operons as nanB and nanC, 393

respectively, we could demonstrate no role for either in sialic acid transport under our assay 394

conditions. These data suggest that the additional predicted transporters are either specific for 395

other substrates or contribute to sialic acid transport under other conditions. SP1688-90 is 396

considered part of the core pneumococcal genome and as such is likely essential for some 397

aspect of pathogenesis. In contrast, the gene encoding the predicted symporter (SP1328) is 398

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

18

not part of the core genome (20). SP1328 is encoded within a 20 kb region that correlates with 399

invasive disease; although, how each gene product within this region contributes to this is 400

unknown (20). The absence of this region in some strains demonstrates that SP1328 cannot 401

be essential for human colonization (23). Furthermore, our data demonstrate that this locus is 402

not essential for invasive disease as neither of our clinical isolates recovered from blood 403

possess this genomic region (Table 1). 404

405

The human glycoprotein AGP contains N-linked glycans with sialic acid, galactose, and N-406

acetylglucosamine that can be sequentially cleaved by pneumococcal glycosidases (14). Here 407

we show that sialic acid released from AGP is imported via SatABC and utilized as a carbon 408

source for growth. For these experiments, a limiting concentration of AGP was used; given the 409

solubility of AGP, higher concentrations of AGP could not be tested. This leaves open the 410

possibility that sialic acid is not utilized for growth in vivo where pneumococcus presumably 411

encounters an excess of glycoconjugates. However, the significant reduction of the satABC 412

mutant in murine colonization supports the hypothesis that sialic acid is used as a carbon 413

source in vivo. 414

415

In summary, we have demonstrated that S. pneumoniae is able to utilize sialic acid as a sole 416

carbon source and have identified satABC as encoding an ABC transporter specific for sialic 417

acid. Furthermore, we have shown that import of sialic acid by SatABC contributes to 418

colonization in the airway. 419

420

Acknowledgements 421

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

19

This work was supported by the American Heart Association Predoctoral Fellowship 422

10PRE3490014 (CM) and the National Institute of Allergy and Infectious Diseases grant 423

1R01AI076341 (SJK). 424

425

We thank Dr. Robert Munson Jr. for his assistance with design of the transport assays.426

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

20

427

References 428

1. Allen, S., A. Zaleski, J. W. Johnston, B. W. Gibson, and M. A. Apicella. 2005. Novel 429

sialic acid transporter of Haemophilus influenzae. Infect Immun 73:5291-5300. 430

2. Almagro-Moreno, S., and E. F. Boyd. 2009. Insights into the evolution of sialic acid 431

catabolism among bacteria. BMC Evol Biol 9:118. 432

3. Burnaugh, A. M., L. J. Frantz, and S. J. King. 2008. Growth of Streptococcus 433

pneumoniae on human glycoconjugates is dependent upon the sequential activity of 434

bacterial exoglycosidases. J Bacteriol 190:221-230. 435

4. Byers, H. L., K. A. Homer, and D. Beighton. 1996. Utilization of sialic acid by Viridans 436

streptococci. J Dent Res 75:1564-1571. 437

5. Byers, H. L., K. A. Homer, E. Tarelli, and D. Beighton. 1999. N-acetylneuraminic acid 438

transport by Streptococcus oralis strain AR3. J Med Microbiol 48:375-381. 439

6. Chan, P. F., K. M. O'Dwyer, L. M. Palmer, J. D. Ambrad, K. A. Ingraham, C. So, M. 440

A. Lonetto, S. Biswas, M. Rosenberg, D. J. Holmes, and M. Zalacain. 2003. 441

Characterization of a novel fucose-regulated promoter (PfcsK) suitable for gene 442

essentiality and antibacterial mode-of-action studies in Streptococcus pneumoniae. J 443

Bacteriol 185:2051-2058. 444

7. Chen, X., and A. Varki. 2010. Advances in the biology and chemistry of sialic acids. 445

ACS Chem Biol 5:163-176. 446

8. Dalia, A. B., A. J. Standish, and J. N. Weiser. 2010. Three surface exoglycosidases 447

from Streptococcus pneumoniae, NanA, BgaA, and StrH, promote resistance to 448

opsonophagocytic killing by human neutrophils. Infect Immun 78:2108-2116. 449

9. Holland, I. B., and M. A. Blight. 1999. ABC-ATPases, adaptable energy generators 450

fuelling transmembrane movement of a variety of molecules in organisms from bacteria 451

to humans. J Mol Biol 293:381-399. 452

10. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering 453

hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. 454

Gene 77:61-68. 455

11. Iyer, R., N. S. Baliga, and A. Camilli. 2005. Catabolite control protein A (CcpA) 456

contributes to virulence and regulation of sugar metabolism in Streptococcus 457

pneumoniae. J Bacteriol 187:8340-9. 458

12. King, S. J. 2010. Pneumococcal modification of host sugars: a major contributor to 459

colonization of the human airway? Mol Oral Microbiol 25:15-24. 460

13. King, S. J., K. R. Hippe, J. M. Gould, D. Bae, S. Peterson, R. T. Cline, C. Fasching, 461

E. N. Janoff, and J. N. Weiser. 2004. Phase variable desialylation of host proteins that 462

bind to Streptococcus pneumoniae in vivo and protect the airway. Mol Microbiol 54:159-463

171. 464

14. King, S. J., K. R. Hippe, and J. N. Weiser. 2006. Deglycosylation of human 465

glycoconjugates by the sequential activities of exoglycosidases expressed by 466

Streptococcus pneumoniae. Mol Microbiol 59:961-974. 467

15. Kloosterman, T. G., J. J. Bijlsma, J. Kok, and O. P. Kuipers. 2006. To have 468

neighbour's fare: extending the molecular toolbox for Streptococcus pneumoniae. 469

Microbiology 152:351-359. 470

16. Lock, R. A., J. C. Paton, and D. Hansman. 1988. Purification and immunological 471

characterization of neuraminidase produced by Streptococcus pneumoniae. Microb 472

Pathog 4:33-43. 473

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

21

17. Manco, S., F. Hernon, H. Yesilkaya, J. C. Paton, P. W. Andrew, and A. Kadioglu. 474

2006. Pneumococcal neuraminidases A and B both have essential roles during infection 475

of the respiratory tract and sepsis. Infect Immun 74:4014-4020. 476

18. Marion, C., D. H. Limoli, G. S. Bobulsky, J. L. Abraham, A. M. Burnaugh, and S. J. 477

King. 2009. Identification of a pneumococcal glycosidase that modifies O-linked 478

glycans. Infect Immun 77:1389-1396. 479

19. McCool, T. L., and J. N. Weiser. 2004. Limited role of antibody in clearance of 480

Streptococcus pneumoniae in a murine model of colonization. Infect Immun 72:5807-481

5813. 482

20. Obert, C., J. Sublett, D. Kaushal, E. Hinojosa, T. Barton, E. I. Tuomanen, and C. J. 483

Orihuela. 2006. Identification of a candidate Streptococcus pneumoniae core genome 484

and regions of diversity correlated with invasive pneumococcal disease. Infect Immun 485

74:4766-4777. 486

21. Orihuela, C. J., G. Gao, K. P. Francis, J. Yu, and E. I. Tuomanen. 2004. Tissue-487

specific contributions of pneumococcal virulence factors to pathogenesis. J Infect Dis 488

190:1661-1669. 489

22. Pedersen, P. L. 2005. Transport ATPases: structure, motors, mechanism and 490

medicine: a brief overview. J Bioenerg Biomembr 37:349-357. 491

23. Pettigrew, M. M., K. P. Fennie, M. P. York, J. Daniels, and F. Ghaffar. 2006. 492

Variation in the presence of neuraminidase genes among Streptococcus pneumoniae 493

isolates with identical sequence types. Infect Immun 74:3360-3365. 494

24. Phillips, N. J., C. M. John, L. G. Reinders, B. W. Gibson, M. A. Apicella, and J. M. 495

Griffiss. 1990. Structural models for the cell surface lipooligosaccharides of Neisseria 496

gonorrhoeae and Haemophilus influenzae. Biomed Environ Mass Spectrom 19:731-497

745. 498

25. Post, D. M., R. Mungur, B. W. Gibson, and R. S. Munson, Jr. 2005. Identification of a 499

novel sialic acid transporter in Haemophilus ducreyi. Infect Immun 73:6727-6735. 500

26. Roy, S., C. W. Douglas, and G. P. Stafford. 2010. A novel sialic acid utilization and 501

uptake system in the periodontal pathogen Tannerella forsythia. J Bacteriol 192:2285-502

2293. 503

27. Severi, E., A. H. Hosie, J. A. Hawkhead, and G. H. Thomas. 2010. Characterization 504

of a novel sialic acid transporter of the sodium solute symporter (SSS) family and in vivo 505

comparison with known bacterial sialic acid transporters. FEMS Microbiol Lett 304:47-506

54. 507

28. Severi, E., G. Randle, P. Kivlin, K. Whitfield, R. Young, R. Moxon, D. Kelly, D. 508

Hood, and G. H. Thomas. 2005. Sialic acid transport in Haemophilus influenzae is 509

essential for lipopolysaccharide sialylation and serum resistance and is dependent on a 510

novel tripartite ATP-independent periplasmic transporter. Mol Microbiol 58:1173-1185. 511

29. Shakhnovich, E. A., S. J. King, and J. N. Weiser. 2002. Neuraminidase expressed by 512

Streptococcus pneumoniae desialylates the lipopolysaccharide of Neisseria meningitidis 513

and Haemophilus influenzae: a paradigm for interbacterial competition among 514

pathogens of the human respiratory tract. Infect Immun 70:7161-7164. 515

30. Steenbergen, S. M., C. A. Lichtensteiger, R. Caughlan, J. Garfinkle, T. E. Fuller, 516

and E. R. Vimr. 2005. Sialic Acid metabolism and systemic pasteurellosis. Infect Immun 517

73:1284-1294. 518

31. Sung, C. K., H. Li, J. P. Claverys, and D. A. Morrison. 2001. An rpsL cassette, janus, 519

for gene replacement through negative selection in Streptococcus pneumoniae. Appl 520

Environ Microbiol 67:5190-5196. 521

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

22

32. Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. 522

Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. 523

Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. 524

R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R. Utterback, C. L. 525

Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, 526

I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter, B. A. Dougherty, D. A. 527

Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome sequence 528

of a virulent isolate of Streptococcus pneumoniae. Science 293:498-506. 529

33. Uchiyama, S., A. F. Carlin, A. Khosravi, S. Weiman, A. Banerjee, D. Quach, G. 530

Hightower, T. J. Mitchell, K. S. Doran, and V. Nizet. 2009. The surface-anchored 531

NanA protein promotes pneumococcal brain endothelial cell invasion. J Exp Med 532

206:1845-1852. 533

34. Vimr, E., C. Lichtensteiger, and S. Steenbergen. 2000. Sialic acid metabolism's dual 534

function in Haemophilus influenzae. Mol Microbiol 36:1113-1123. 535

35. Vimr, E. R., K. A. Kalivoda, E. L. Deszo, and S. M. Steenbergen. 2004. Diversity of 536

microbial sialic acid metabolism. Microbiol Mol Biol Rev 68:132-153. 537

36. Vimr, E. R., and F. A. Troy. 1985. Identification of an inducible catabolic system for 538

sialic acids (nan) in Escherichia coli. J Bacteriol 164:845-853. 539

37. Ward, R. E., M. Ninonuevo, D. A. Mills, C. B. Lebrilla, and J. B. German. 2007. In 540

vitro fermentability of human milk oligosaccharides by several strains of bifidobacteria. 541

Mol Nutr Food Res 51:1398-1405. 542

38. Watt, J. P., K. L. O'Brien, S. Katz, M. A. Bronsdon, J. Elliott, J. Dallas, M. J. Perilla, 543

R. Reid, L. Murrow, R. Facklam, M. Santosham, and C. G. Whitney. 2004. 544

Nasopharyngeal versus oropharyngeal sampling for detection of pneumococcal carriage 545

in adults. J Clin Microbiol 42:4974-4976. 546

39. Webb, A. J., K. A. Homer, and A. H. Hosie. 2008. Two closely related ABC 547

transporters in Streptococcus mutans are involved in disaccharide and/or 548

oligosaccharide uptake. J Bacteriol 190:168-178. 549

40. Weiser, J. N., R. Austrian, P. K. Sreenivasan, and H. R. Masure. 1994. Phase 550

variation in pneumococcal opacity: relationship between colonial morphology and 551

nasopharyngeal colonization. Infect Immun 62:2582-2589. 552

41. Whatmore, A. M., V. A. Barcus, and C. G. Dowson. 1999. Genetic diversity of the 553

streptococcal competence (com) gene locus. J. Bacteriol. 181:3144-3154. 554

42. World Health Organization. 2008. The global burden of disease: 2004 update. 555

43. Yesilkaya, H., S. Manco, A. Kadioglu, V. S. Terra, and P. W. Andrew. 2008. The 556

ability to utilize mucin affects the regulation of virulence gene expression in 557

Streptococcus pneumoniae. FEMS Microbiol Lett 278:231-235. 558

559

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

23

560

Figure legends 561

Figure 1. Sialic acid supports S. pneumoniae growth. 1121 Smr was grown on chemically 562

defined medium for 60 h supplemented with 12 mM sialic acid, or 12 mM glucose as the sole 563

carbon source. Growth was measured by the optical density at 600 nm. Data points are the 564

mean of three independent experiments performed in triplicate. Gray shading indicates a 95% 565

confidence interval. 566

Figure 2. Schematic of regions encoding known and putative neuraminidases and 567

transporters as found in S. pneumoniae strain TIGR4. Arrows indicate open reading frames. 568

Neuraminidases are depicted in gray and predicted transporter components are depicted in 569

black. Open reading frames predicted to be involved in sialic acid utilization are labeled as 570

follows: sugar kinase nanK, N-acetylneuraminate lyase nanA (note this is distinct from 571

neuraminidase nanA), and N-acetylmannosamine-6-phosphate 2-epimerase nanE. 572

Figure 3. satABC (SP1681-3) is required for efficient growth on sialic acid. 1121 Smr and 573

mutants were grown for 60 h on chemically defined medium supplemented with 12 mM sialic 574

acid as the sole carbon source. Growth was measured by the optical density at 600 nm. Data 575

points are the mean of three independent experiments performed in triplicate. Gray shading 576

indicates a 95% confidence interval. 577

Figure 4. satABC is required for transport of sialic acid. 1121 Smr and mutants were 578

incubated for the designated amount of time in chemically defined media supplemented with 579

2.5 µM sialic acid containing 1% [3H]-sialic acid. Following incubation, bacteria were filtered, 580

washed, and radioactivity associated with cells was measured using a scintillation counter. (A) 581

Data is a representative of two time course experiments with strain 1121 Smr conducted in 582

triplicate. (B + C) Data are averages from parental and mutant strains from three independent 583

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

24

experiments performed in triplicate. Standard deviation is depicted. Statistical significance was 584

tested by a two-tailed Student’s t-test; * indicates P≤0.05. 585

Figure 5. satABC contributes to growth on a human glycoprotein. 1121 Smr and mutants 586

were grown for 60 h on chemically defined medium supplemented with 5 mg ml-1 alpha-1 587

glycoprotein as the sole carbon source. Growth was measured by the optical density at 600 588

nm. Data points are the mean from three independent experiments performed in triplicate. 589

Gray shading indicates a 95% confidence interval. 590

Figure 6. satABC contributes to pneumococcal colonization. Groups of 10 mice received 591

intranasal inoculation with 1 x 108 CFU of mutant or parental strain (1121 Smr). Five days after 592

inoculation, mice were sacrificed by carbon dioxide asphyxiation. Nasal lavage fluid was 593

collected and bacterial titers assessed. The gray dashed line indicates the limit of detection. 594

The mean and standard error of the mean are depicted. Statistical significance was tested by 595

a two-tailed Student’s t-test; * indicates P≤0.05. 596

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

25

Table 1: Strains of Streptococcus pneumoniae used in this study

Strain Name Serotype Characteristics/genotypea

Site of

isolationb

Source or reference

1121 23F Clinical isolate McCool et. al. (2002)

1121 Smr 23F Lys56→Thr in RpsL [rpsL(K56T)] conferring Sm

r Marion et. al. (2009)

1121 ∆satABC 23F ∆satABC rpsL(K56T) (Smr) This study

1121 ∆satABC/satABC+ 23F ∆satABC/satABC

+ , rpsL(K56T) (Sm

r) This study

1121 ∆1688-90 23F ∆1688-90 rpsL(K56T) (Smr) This study

1121 ∆1688-90/1688-90+ 23F ∆1688-90/1688-90

+, rpsL(K56T) (Sm

r) This study

1121 ∆satABC ∆1688-90 23F ∆satABC ∆1688-90 rpsL(K56T) (Smr) This study

1121 ∆satABC ∆1688-90/ satABC

+ 1688-90

+ 23F

∆satABC ∆1688-90/

satABC

+ 1688-90

+, rpsL(K56T) (Sm

r) This study

1121 ∆nanA 23F ∆nanA (Cmr), rpsL(K56T) (Sm

r) This study

TIGR4 4 Clinical isolate Tettelin et al. (2001)

TIGR4 Smr 4 Lys56→Thr in RpsL [rpsL(K56T)] conferring Sm

r Bender et. al. (2006)

TIGR4 ∆satABC 4 ∆satABC rpsL(K56T) (Smr) This study

TIGR4 ∆satABC/satABC+ 4 satABC, rpsL(K56T) (Sm

r) This study

TIGR4 ∆1328 4 ∆SP1328 rpsL(K56T) (Smr) This study

TIGR4 ∆satABC ∆1688-90 ∆1328 4 ∆satABC ∆1688-90 ∆1328 rpsL(K56T) (Smr) This study

C06_18 22F Clinical isolate blood Burnaugh et al. (2008)

C06_29 15B/C Clinical isolate BAL Burnaugh et al. (2008)

C06_31 23F Clinical isolate BAL Burnaugh et al. (2008)

C06_57 6A/B Clinical isolate BAL Burnaugh et al. (2008)

C06_58 19A Clinical isolate blood Burnaugh et al. (2008)

a Sm

r indicates resistance to streptomycin.

b BAL indicates bronchioalveolar lavage/aspirate.

+ indicates the genetic mutation has been reconstituted to wild type.

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

26

Table 2: Primers used in this study

Group Number Primer sequence (5' → 3') a Location (accession number)

satABC A.1 CTATATGTTGTTCACGCATTC 1505216-1505236 (AE007317)

A.2 CATTATCAATTAAAAATCAAACGGTCATCCATCACTCTCCTCTGT1 1504642-1504662 (AE007317)

A.3 GCATACCCTCCATTTTGTAGATCATCCATCACTCTCCTCTGT2 1504642-1504662 (AE007317)

A.4 GGAAAGGGGCCCAGGTCTCTACAAAATGGAGGGTATGC3 1501066-1501086 (AE007317)

A.5 TCTACAAAATGGAGGGTATGC 1501066-1501086 (AE007317)

A.6 GAATGCTACTGCCTCGTCTTTGA 1500702-1500724 (AE007317)

A.7 TTTGCAGGTCGTTTCTC 1505403-1505419 (AE007317)

A.8 TATTCTCATTTCTCTACCTC 1500451-1500470 (AE007317)

A.9 GCCTTTGAGGCGACAGC 1652124-1652146 (AE007317)

A.10 ACACGATGCCCCACTTCTTTCTG 1652408-1652433 (AE007317)

SP1688-90 B.1 TGGTAATCGATTGTTTGGG 1513786-1513804 (AE007317)

B.2 CATTATCAATTAAAAATCAAACGGTTTTTCATCGTTCTTCTCTTTC1 1513451-1513472 (AE007317)

B.3 CCTTCTTTCGTCTACTTCACAGTTTTTCATCGTTCTTCTCTTTC4 1513451-1513472 (AE007317)

B.4 GGAAAGGGGCCCAGGTCCTGTGAAGTAGACGAAAGAAGG3 1510314-1510335 (AE007317)

B.5 CTGTGAAGTAGACGAAAGAAGG 1510314-1510335 (AE007317)

B.6 GAAGCTGGTCTAGAAAATAAATAA 1509913-1509936 (AE007317)

B.7 GTTTAGGAACTTATGTGGGAGTA 1513885-1513907 (AE007317)

B.8 GGATTTGATAAGGGAATAGTTGA 1509625-1509647 (AE007317)

B.9 GTGTATTTTCAACTGCCTGTCC 1509872-1509893 (AE007317)

B.10 ATGCGAATGAATTAAACTATGGTC 1510202-1510225 (AE007317)

SP1328 C.1 GCAACAATGCGTCAAAATCCTC 1254113-1254134 (AE005672)

C.2 CATTATCCATTAAAAATCAAACGGTAGATACCTGCAACCAACAC1 1253572-1253591 (AE005672)

C.3 AACTTGAATCCGCTTTAATTTCTAGATACCTGCAACCAACAC5 1253572-1253591 (AE005672)

C.4 AAGCATAAGGAAAGGGGCCCGAAATTAAAGCGGATTCAAGTT3 1252127-1252148 (AE005672)

C.5 GAAATTAAAGCGGATTCAAGTT 1252127-1252148 (AE005672)

C.6 TTCTTCAAAAGTCACCAACATA 1251714-1251735 (AE005672)

C.7 CAGCTATCCCACCTATTTATTT 1254259-1254280 (AE005672)

C.8 AGTTTTTTAACAGTTTCATCATT 1251664-1251686 (AE005672)

C.9 GTGATTCTGATTAGTGGTGTC 1253070-1253090 (AE005672)

C.10 ACAGCTGTTGGAGGAAGGA 1252270-1252288 (AE005672)

aroE RT.F TGCAGTTCARAAACATWTTCTAA 1232187-1232203 (AE007317)

RT.R TGCTAGCCCATCATATTCGTTTGTTG 1231725-1231747 (AE007317)

Janus J.F CCGTTTGATTTTTAATGGATAATG 7-30 (AY334019)

J.R GGGCCCCTTTCCTTATGCTT 247511-247527 (AE005672)

a Underlining indicates reverse complement sequence of primer J.F

( 1 ) A.5

( 2 ) J.R

( 3 ), B.5

( 4 ) and C.5

(5).

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

27

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Optical D

ensity 6

00 n

m

0.9

0.7

0.8

0.6

0.5

0.4

0.3

0.2

0.1

0

-0.1 Time (hours)12 24 36 48 60

12 mM sialic acid12 mM glucose

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

predicted transport component

neuraminidase

1 kb

nanC

SP1331 SP1324

SP1674SP1693

nanBnanA nanA nanKnanE

nanA nanKnanE

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

0.5

0.4

0.3

0.2

0.1

0

-0.1

Op

tical de

nsity 6

00

nm

Time (hours)

12 24 36 48 60

1121 Smr

1121 ∆satABC

1121 ∆1688-90

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

nM

[3H

] sia

lic a

cid

/ 1

07 C

FU

**

1121 Sm

r

1121 ∆satA

BC

1121 ∆SP1688-90

1121 ∆satA

BC ∆SP1688-90

1121 ∆satA

BC /satA

BC+

B

nM

[3H

] sia

lic a

cid

/ 1

07 C

FU

**

TIGR4 Sm

r

TIGR4 ∆

satABC

TIGR4 ∆satA

BC∆SP1688-90 ∆

SP1328

TIGR4 ∆

satABC /s

atABC

+

C

A

nM

[3H

] sia

lic a

cid

/ 1

07 C

FU

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

0.6

0.5

0.4

0.3

0.2

0.1

0

-0.1

Op

tical de

nsity 6

00

nm

Time (hours)

12 24 36 48 60

1121 Smr

1121 ∆satABC

1121 ∆1688-90

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Lo

g C

FU

/mL

101

102

103

104

105

106

1121 Sm

r

1121 ∆satA

BC

1121 ∆SP1688-90

1121 ∆satA

BC

∆SP1688-90

**

on February 15, 2018 by guest

http://iai.asm.org/

Dow

nloaded from