S Takashima et al. Nature 000 , 1-5 (2008) doi:10.1038/nature07156

1
S Takashima et al. Nature 000, 1-5 (2008) doi:10.1038/nature07156 Proliferating cells of the Drosophila hindgut are confined to a morphologically and molecularly defined zone (HPZ).

description

Proliferating cells of the Drosophila hindgut are confined to a morphologically and molecularly defined zone (HPZ). S Takashima et al. Nature 000 , 1-5 (2008) doi:10.1038/nature07156. - PowerPoint PPT Presentation

Transcript of S Takashima et al. Nature 000 , 1-5 (2008) doi:10.1038/nature07156

Page 1: S Takashima et al. Nature 000 , 1-5 (2008) doi:10.1038/nature07156

S Takashima et al. Nature 000, 1-5 (2008) doi:10.1038/nature07156

Proliferating cells of the Drosophila hindgut are confined to amorphologically and molecularly defined zone (HPZ).

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

doi:10.1038/nature05150 LETTERS

doi:10.1038/nature05150 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo12

GI Motility online (May 2006) | doi:10.1038/gimo12

GI Motility online (May 2006) | doi:10.1038/gimo46

GI Motility online (May 2006) | doi:10.1038/gimo46

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

doi:10.1038/nature06481 LETTERS

doi:10.1038/nature06481 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo6

GI Motility online (May 2006) | doi:10.1038/gimo6

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/ncomms1280 molecular dynamics of single ...

DOI: 10.1038/ncomms1280 molecular dynamics of single ...

doi:10.1038/nature12886 Neanderthal from the Altai ...

doi:10.1038/nature12886 Neanderthal from the Altai ...

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt

SUPPLEMENTARY INFORMATION - media.nature.com · doi: 10.1038/nmat4795 1 1 s 1)

SUPPLEMENTARY INFORMATION - media.nature.com · doi: 10.1038/nmat4795 1 1 s 1)