RNA interference-based functional dissection of the 17q12 amplicon in breast cancer reveals...
-
Upload
jessica-kao -
Category
Documents
-
view
212 -
download
0
Transcript of RNA interference-based functional dissection of the 17q12 amplicon in breast cancer reveals...
RNA Interference-Based Functional Dissectionof the 17q12 Amplicon in Breast Cancer RevealsContribution of Coamplified Genes
Jessica Kao and Jonathan R. Pollack*
Departmentof Pathology,Stanford University,Stanford,California
DNA amplification is a frequent occurrence in cancer genomes. While tumor amplicons may harbor known oncogenes ‘‘driv-
ing’’ amplification, amplicons rarely comprise only single genes. The potential functional contribution of coamplified genes
remains largely unexplored. In breast cancer, 20–30% of tumors exhibit amplification within chromosome band 17q12, con-
taining the ERBB2 oncogene. Analysis of array-based comparative genomic hybridization and expression profiling data indicate
that the minimum region of recurrent amplification (i.e., the amplicon ‘‘core’’) at 17q12 includes two other genes, GRB7 and
STARD3, which exhibit elevated expression when amplified. Western blot analysis confirms overexpression of each at the
protein level in breast cancer cell lines SKBR3 and BT474 harboring amplification. In these cell lines (but not in control MCF7
breast cancer cells lacking 17q12 amplification), targeted knockdown of ERBB2 expression using RNA interference (RNAi)
methods results in decreased cell proliferation, decreased cell-cycle progression, and increased apoptosis. Notably, targeted
knockdown of either GRB7 or STARD3 also leads to decreased cell proliferation and cell-cycle progression, albeit to a lesser
extent compared with ERBB2 knockdown. We conclude that the amplification and resultant overexpression of genes coam-
plified with ERBB2 at 17q12 can contribute to proliferation levels of breast cancer cells. Our findings validate the utility of
RNAi in the functional interrogation of tumor amplicons, and provide evidence for a contribution of coamplified genes to tu-
mor phenotypes. VVC 2006 Wiley-Liss, Inc.
INTRODUCTION
Breast cancer is the second leading cause of can-
cer death in women in the United States, affecting
�1 in 8 women over the course of their lifetime
(Ries et al., 2005). Clinicopathological parameters
such as tumor size, grade, stage, estrogen receptor
(ER) positivity, and lymph node involvement have
been used to predict tumor recurrence and guide
the selection of therapies (Subramaniam and Isaacs,
2005). More recently, tumors exhibiting amplifica-
tion and overexpression of ERBB2 (HER2/NEU), a
member of the epidermal growth factor receptor
(EGFR) family of receptor tyrosine kinases, have
been shown responsive to directed therapy targeting
ERBB2 (Slamon et al., 2001). Defining additional
pathogenetic lesions may provide new targets for
molecularly directed therapies.
DNA amplification, leading to the deregulated
expression of oncogenes, is one such class of patho-
genetic lesion occurring frequently in breast cancer
(Knuutila et al., 1998). Many localized amplicons
harbor known oncogenes ‘‘driving’’ DNA amplifica-
tion, including FGFR1 (8p11), MYC (8q24), CCND1(11q13), MDM2 (12q13), ERBB2 (17q12), and ZNF217(20q13) (Courjal et al., 1997; Nonet et al., 2001).
Other localized amplicons contain as yet uncharac-
terized driver oncogenes. Regardless, a common
feature of localized amplicons is that they seldom
contain just a single gene. This observation has
led to speculation that the retained amplification
of coamplified genes (i.e., those neighboring the
presumptive driver oncogene) might contribute to
tumor phenotypes, thereby providing selective
growth advantage to tumor cells (Schuuring et al.,
1992). Indeed, such speculation is fueled by obser-
vations that nearly half of all amplified genes ex-
hibit elevated expression (Hyman et al., 2002; Pol-
lack et al., 2002).
However, the true functional contribution of co-
amplified genes has remained largely unknown, in
part because of the laboriousness of traditional ap-
proaches of study, requiring individually cloning,
transfecting, and characterizing candidate genes in
heterologous cell culture systems (e.g., NIH/3T3
*Correspondence to: Jonathan R. Pollack, M.D., Ph.D., Departmentof Pathology, Stanford University School of Medicine, 269 CampusDrive, CCSR-3245A, Stanford, CA 94305-5176, USA.E-mail: [email protected]
Received 22 December 2005; Accepted 18 April 2006
DOI 10.1002/gcc.20339
Published online 17 May 2006 inWiley InterScience (www.interscience.wiley.com).
Supported by: NIH; Grant number: CA97139.
Abbreviations: array CGH, array-based comparative genomichybridization; RNAi, RNA interference; siRNA, small interferingRNA.
VVC 2006 Wiley-Liss, Inc.
GENES, CHROMOSOMES & CANCER 45:761–769 (2006)
mouse fibroblasts). RNA interference (RNAi) me-
thods, based on the transfection of synthetic siRNAs
(small interfering RNAs) effecting the sequence-
specific post-transcriptional silencing of targeted
genes (Tuschl and Borkhardt, 2002), provide a
potentially more rapid alternative for screening
the function of candidate genes within the context
of cancer cell lines harboring DNA amplification.
Here, we apply RNAi methods to explore the
contribution of coamplified genes to breast tumor
phenotypes, focusing on the 17q12 amplicon harbor-
ing ERBB2 in breast cancer. Our findings validate
an RNAi-based strategy for functionally dissecting
DNA amplicons, and provide evidence that coam-
plified genes can indeed contribute to tumor pheno-
types.
MATERIALS AND METHODS
Microarray Data Analysis
cDNA microarray-based comparative genomic
hybridization (CGH) and expression-profiling data
for breast cancer cell lines and primary breast
tumors were previously published (Pollack et al.,
2002). To define a minimum core amplicon at
17q12-21, well-measured (intensity/background �1.4)
tumor/normal array CGH fluorescence ratios for
cDNA probes were ordered by chromosome map
position, assigned using the NCBI genome assem-
bly accessed through the UCSC genome browser
(NCBI Build 35). For genes represented by multi-
ple cDNA probes, the average fluorescence ratio
was used. For expression profiling data, ‘‘mean-cen-
tered’’ ratios (i.e., reported for each gene relative to
its mean expression across samples) were used.
Cell Culture
Breast cancer cell lines SKBR3, BT474, and
MCF7 were obtained from the American Type Cul-
ture Collection (Manassas, Virginia). Cell lines were
maintained at 378C in complete media of RPMI
1640 (Invitrogen), 10% fetal bovine serum (FBS),
50 U/ml penicillin, and 50 U/ml streptomycin. ‘‘Low
serum’’ experiments were performed by plating cells
into the above media with 2% FBS.
Small Interfering RNAs
Synthetic 21-nt siRNAs were designed and syn-
thesized to target ERBB2, GRB7, and STARD3
(Qiagen, Valencia, California). A siRNA targeting
the gene luciferase (LUC), not encoded in the
human genome, was used as a control (Qiagen).
Before use, siRNAs were reconstituted in annealing
buffer per manufacturer’s instructions at 20 lM,
heated to 908C for 1 min, incubated at 378C for
1 hr, and then stored at �808C. Sequences of siR-NAs are listed in Table 1.
Cell Transfection
For cell transfection, 350,000 cells were seeded
per 6-well plate well, and transfected using TransIT-
TKO reagent (Mirus Bio, Madison, Wisconsin) ex-
actly according to the manufacturer’s protocol. Cells
were transfected with a final concentration of 30 nM
siRNA for 18 hr, subsequently replaced with com-
plete growth media (or media with 2% FBS for low-
serum experiments).
Quantitative RT-PCR
Post-transfection (24 hr), total RNA was prepared
by the TRIzol method according to the manufac-
turer’s instructions (Invitrogen, Carlsbad, CA) and
quantified by UV spectrophotometry. Q-RT-PCR
was performed using the one-step QuantiTect
SYBR Green RT-PCR Kit (Qiagen) and PCR prod-
ucts quantified using an ABI PRISM 7700 Sequence
Detection System (Applied Biosystems, Foster City,
CA). Briefly, PCR primers (Table 2) were designed
using Primer3 software (Rozen and Skaletsky, 2000),
with one primer of each pair spanning an exon–
exon junction to prevent amplification from contam-
inating genomic DNA. Q-RT-PCR was carried out
in a final volume of 25 ll, containing 200 ng RNA,
13 SYBR green mix, 0.25 U RT, and 0.1 lM each
primer, under the following conditions: 508C 30 min,
958C 15 min, followed by 40 cycles each of 958C
TABLE 1. siRNA Sequences
Gene targeted Target sequence
LUC (control) 50 CGTACGCGGAATACTTCGA 30
GRB7 50 CCCAACAAGCTTCGAAATGGA 30
ERBB2 50 AAGCCTCACAGAGATCTTGAA 30
ERBB2 (second siRNA) 50 AATGGCTCAGTGACCTGTTTT 30
STARD3 50 AACCCCCGTGTTTGCACCTTT 30
STARD3 (second siRNA) 50 AATCCTTTGCAGGGTCTGACA 30
TABLE 2. Quantitative RT-PCR Primers
Gene Primer sequence
GAPDH-F 50 CAATGACCCCTTCATTGACC 30
GAPDH-R 50 GATCTCGCTCCTGCAAGATG 30
GRB7-F 50 CTTGTTGGGCTTGACACAGP 30
GRB7-R 50 GCCTGGAGGAAGAAGACAAA 30
ERBB2-F 50 CTGTGCCCGAGTGTGCTA 30
ERBB2-R 50 GTCCCCATCAAAGCTCTCC 30
STARD3-F 50 AAGGTCATCCTCTCTGAGCTG 30
STARD3-R 50 GCARGATACCATCGCTCCTC 30
Genes, Chromosomes & Cancer DOI 10.1002/gcc
762 KAO AND POLLACK
15 sec, 558C 30 sec, and 728C 30 sec. GAPDH
mRNAwas quantified as an internal standard. Melt-
ing curve analysis was performed from 60–908C to
maximize PCR product specificity; data for GRB7and ERBB2 were acquired at 76.68C and for STARD3at 808C. All Q-RT-PCR reactions were performed in
triplicate, and the comparative CT method (Livak
and Schmittgen, 2001) was used to calculate relative
mRNA levels normalized to GAPDH.
Western Blot
Post-transfection (72 hr), cells were lysed in 13RIPA Lysis buffer (Upstate/Chemicon, San Francisco,
CA) to which had been added 13 complete protease
inhibitor (Roche, Indianapolis, IN), 0.1 mM sodium
orthovanadate, 1 mM sodium fluoride, and 1 mM
PMSF, and protein was quantified using the BCA
assay (Pierce, Rockford, IL). For Western blot, 20 lgprotein lysate was electrophoresed on a 4–15% Tris/
glycine polyacrylamide gradient gel (Bio-Rad, Her-
cules, CA) and transferred to PVDF membrane
(Bio-Rad). After blocking in TBS-T buffer (20 mM
Tris-HCl (pH 7.4), 0.15 M NaCl, and 0.1% Tween
20) with 5% dry milk for 30 min, blots were incu-
bated sequentially with primary antibody for 90 min
and HRP-conjugated secondary antibody for 45 min,
each at room temperature in TBS-T buffer. Primary
antibodies were used as follows: anti-HER2/NEU
mouse monoclonal antibody (1:2,500, NeoMarkers,
Foster City, CA), anti-GRB7 rabbit polyclonal anti-
body (1:1,000, Santa Cruz Biotechnologies, Santa
Cruz, CA), anti-STARD3 mouse monoclonal antibody
(1:1,000, kind gift from Dr. M.C. Rio (Moog-Lutz
et al., 1997)), and anti-a-tubulin mouse monoclo-
nal antibody (1:1,000 for loading control, Santa
Cruz Biotechnology). Secondary antibodies used
were as follows: HRP-conjugated anti-mouse IgG
(1:20,000, Pierce), and HRP-conjugated anti-rabbit
IgG (1:20,000, Pierce). Detection was carried out
using the ECL kit (Amersham Biosciences, Piscat-
away, NJ), and quantification by densitometry
using Image J software (Abramoff et al., 2004).
Cell Proliferation Assay
Post-transfection (24, 48, and 72 hr), cell prolif-
eration was quantified by colorimetry based on the
metabolic cleavage of the tetrazolium salt WST-1
in viable cells, according to the manufacturer’s
protocol (Roche). Briefly, WST-1 reagent was added
at 1/10th the culture volume and incubated at 378Cfor 30 min. Absorbance was then measured at 450 nm
with reference to 650 nm using a Spectra Max 190
plate reader (Molecular Devices, Sunnyvale, CA).
Transfections were performed in triplicate and av-
erage (61 SD) OD reported.
Cell-Cycle Analysis
Post-transfection (72 hr), cell-cycle distribution
analysis was performed by flow cytometry using
the BrdU-FITC Flow kit (BD Biosciences, San Jose,
CA) per the manufacturer’s instructions. Briefly, cells
were incubated with 10 uM BrdU at 378C for 4 hr,
then cells were fixed and permeabilized with Cyto-
fix/Cytoperm buffer (BD Biosciences). Cellular DNA
was treated with DNase at 378 for 1 hr to expose
incorporated BrdU, then cells were stained with
anti-BrdU FITC antibody (to quantify incorporated
BrdU) and 7-aminoactinomycin D (7-AAD; to quan-
tify total DNA content). Ten thousand events were
scored by FACSCalibur (BD Biosciences) and ana-
lyzed using CellQuest software (BD Biosciences).
For SKBR3 studies, transfections were performed in
duplicate and average (61 SD) cell-cycle fractions
reported.
Apoptosis Assay
Post transfection (72 hr), apoptosis was quantified
by fluorescence microscopy of nuclear morphology,
after staining with ethidium bromide (EB) and acri-
dine orange (AO) (Cohen, 1993). Briefly, floating
cells and trypsinized adherent cells were pooled and
resuspended in 25 ll complete growth media, and
1 ll of a mixture of 100 lg/ml each EB and AO
added. Cells were examined using an Olympus BX
61 microscope fitted with a triple-pass fluorescence
filter using the 403 objective. Apoptotic cells were
scored as those with highly condensed or fragmented
chromatin. Transfections were performed in tripli-
cate, 200 cells were counted per transfection, and
average (61 SD) percent apoptosis reported.
RESULTS
Defining the Amplicon Core at 17q12
To define the minimum amplicon core at 17q12,
we first inspected our previous cDNA microarray-
based CGH data (Pollack et al., 2002) for gene
amplification at this locus. Six of 10 breast cancer
cell lines (BT474, MDA361, SKBR3, UACC-812,
UACC-893, ZR75-30) and 8 of 44 primary breast
tumors exhibited localized high-level DNA amplifi-
cation at 17q12. The minimum region of recurrent
amplification included three arrayed genes, ERBB2,GRB7, and STARD3, and each of the three exhibited
elevated mRNA levels when amplified (Fig. 1).
ERBB2 (HER2/NEU) is a bona fide pathogenic
oncogene in breast cancer (Reese and Slamon, 1997),
Genes, Chromosomes & Cancer DOI 10.1002/gcc
763FUNCTIONAL DISSECTION OF 17q12 AMPLICON
and a target of directed therapies such as the anti-
body-based therapeutic trastuzamab (Herceptin)
(Slamon et al., 2001). Nonetheless, amplification of
GRB7, a SH2-domain adapter protein that inter-
acts with ERBB2 (Stein et al., 1994), and STARD3(MLN64; (Moog-Lutz et al., 1997)), which stimu-
lates steroidogenesis (Watari et al., 1997), might
contribute to cancer phenotypes. Before exploring
this hypothesis, we first validated that DNA am-
plification with elevated mRNA levels was associ-
ated with increased protein levels for each of the
genes. For our analysis, we selected to study SKBR3
and BT474 breast cancer cell lines harboring ampli-
fication at 17q12-21, and MCF7 as a control breast
cancer cell line without amplification at this locus.
Western blot demonstrated markedly elevated
expression of ERBB2 (185 kDa), GRB7 (54 kDa),
and STARD3 (50 kDa) in SKBR3 and BT474 lines
compared with MCF7 (Fig. 2A).
Validating siRNA-Mediated Knockdown of ERBB2,
GRB7, and STARD3
Our strategy to assess the contribution of amplified
genes to cancer phenotypes was to separately trans-
fect synthetic siRNAs to knock down the expression
of each of the amplified genes via RNAi, and then
to monitor altered cancer-relevant phenotypes in
Figure 1. Defining the amplicon core at 17q12. Shown are DNAcopy number ratios quantified by array CGH for six breast cancer celllines (above) and eight primary breast tumors (below) harboring17q12-21 amplification. Genes are ordered by their position along thechromosome segment, and height of bars indicates the level of amplifi-cation (log2 ratio scales shown). The tumor amplicon has distinctboundaries in each specimen; the minimum region of recurrent amplifi-cation (i.e., the amplicon ‘‘core’’), highlighted in gray, includes STARD3,ERBB2, and GRB7. Parallel DNA microarray-based expression-profilingidentifies the subset of amplified genes exhibiting elevated expressionwhen amplified (gene names in bold text); gray text indicates poorlymeasured mRNA levels.
Figure 2. Validation of protein overexpression and RNAi knock-down. A: Western blot analysis of ERBB2, GRB7, and STARD3 indi-cates proteins are overexpressed in cell lines harboring 17q12 amplifi-cation (SKBR3 and BT474) compared to nonamplified line MCF7. B:Western blot analysis confirms siRNA-mediated knockdown of ERBB2,GRB7, and STARD3 in each of the three cell lines assayed. a-Tubulinserves as a loading control.
Genes, Chromosomes & Cancer DOI 10.1002/gcc
764 KAO AND POLLACK
cell culture. We first sought to validate effective knock-
down of mRNA levels by Q-RT-PCR (not shown),
and of protein levels by Western blot (Fig. 1B), in
comparison to transfection of a control siRNA tar-
geting the irrelevant gene LUC. Two of three differ-
ent siRNAs targeting ERBB2 were effectual in
knocking down both mRNA and protein levels, with
the most effective resulting in residual ERBB2 pro-
tein levels of 29%, 6%, and 3% in SKBR3, BT474,
and MCF7, respectively. For GRB7, only one of six
different siRNAs assayed significantly reduced mRNA
and protein levels, with 28%, 8%, and 36% residual
GRB7 protein levels in SKBR3, BT474, and MCF7.
For STARD3, two of three siRNAs effectively de-
creased mRNA and protein levels, with the most
efficient leaving 3% and 12% residual STARD3
protein levels in SKBR3 and BT474; protein levels
in MCF7 were too low to accurately quantify re-
duction. For subsequent experiments, unless other-
wise specified we used the most effective siRNA
(Table 1) to target each amplified gene.
Characterizing Altered Cancer-Relevant
Phenotypes in Cell Culture
If coamplification of GRB7 and STARD3 contrib-
ute to tumorigenesis, then knocking down their
expression by RNAi in cells harboring amplifica-
tion might revert cancer-relevant phenotypes. We
first characterized the effect of siRNA-mediated
knockdown on cell proliferation, quantified on
days 1, 3, and 5 following siRNA transfection using
the WST-1 assay. Targeted knockdown of ERBB2
led to significant inhibition of cell proliferation in
both SKBR3 and BT474 cells (P < 0.001; Student’s
t test) (Fig. 3A), comparable to reported results
using anti-ERBB2 antibody (Lewis et al., 1993) or
more recently RNAi (Choudhury et al., 2004; Faltus
et al., 2004). In contrast, no significant decrease in
proliferation was observed in MCF7 cells that do
not carry amplification at 17q12. Although targeted
knockdown of GRB7 and STARD3 had no effect
on cell proliferation in control MCF7 cells, knock-
down of each resulted in decreased cell prolifera-
tion in both SKBR3 and BT474 cells (Fig. 3A); for
the former, the effect was more pronounced and
reproducible when cells were grown in low serum
(2% FBS), so subsequent studies of SKBR3 were
performed in low serum. Although proliferation
was not reduced to levels seen with ERBB2 knock-
down, reductions were nonetheless significant in
both SKBR3 and BT474 cell lines for both GRB7
(P < 0.05 and P < 0.01, respectively) and STARD3
(P < 0.01) knockdown.
MCF7 cells do not carry 17q12 amplification,
and therefore, presumably do not rely on increased
levels of ERBB2, GRB7, and STARD3 to affect
tumorigenesis. Thus, RNAi-mediated knockdown
of these genes in MCF7 cells did not reduce cell
proliferation and therefore supports the specificity
of the siRNA effect. Nonetheless, to further rule
out ‘‘off-target’’ effects (Jackson et al., 2003), we
knocked down ERBB2 and STARD3 expression in
BT474 cells using for each a second siRNA (Table 1)
targeting distinct sequences within the genes, and
found comparable reductions in cell proliferation
(not shown). A similar assessment could not be
performed for GRB7, since a second effective siRNA
could not be identified among six surveyed.
The reduced cell proliferation following knock-
down of ERBB2, GRB7, or STARD3 might result
from decreased cell-cycle progression, increased
cell death (apoptosis), or both. To distinguish among
these possibilities, we quantified DNA synthesis by
BrdU incorporation, and apoptosis by nuclear mor-
phology using an EB and AO staining assay, 72 hr
post-transfection. Knockdown of ERBB2 in SKBR3
and BT474 cells resulted in reduced S-phase frac-
tion (9-fold and 10-fold reduction, respectively) with
a G0/G1 accumulation (Fig. 3C). Likewise, targeting
of GRB7 and STARD3 led to reduced S-phase frac-
tion in SKBR3 cells (2.1-fold and 1.3-fold, respec-
tively) and BT474 cells (1.7-fold and 1.3-fold,
respectively), suggesting that reduced cell prolifera-
tion was at least in part attributable to decreased
cell-cycle progression. Knockdown of ERBB2 in
SKBR3 and BT474 cells also led to increased apo-
ptosis (P < 0.01; Fig. 3B). However, no such effect
on apoptosis was observed accompanying knockdown
of either GRB7 or STARD3 in SKBR3 or BT474
cells (Fig. 3B); nor for SKBR3 did we observe dis-
proportionally (i.e., compared to targeting LUC)
increased apoptosis when experiments were carried
out in the presence of 10 nM (�LD25) of the cyto-
toxic drug cisplatin (not shown).
Assessing Additive Effects of Targeting Multiple
Amplified Targets
Since targeting GRB7 and STARD3 each led to
reduced cell proliferation, albeit to a lesser extent
compared to targeting ERBB2, we wondered whether
targeting combinations of GRB7, STARD3, and
ERBB2 might provide additive effects, with impli-
cations for directed therapies. To test this idea, we
cotransfected BT474 cells with siRNA pools tar-
geting GRB7/STARD3, ERBB2/GRB7, or ERBB2/
STARD3, and then assayed cell proliferation on
days 1, 3, and 5 post-transfection. Although targeting
Genes, Chromosomes & Cancer DOI 10.1002/gcc
765FUNCTIONAL DISSECTION OF 17q12 AMPLICON
Figure 3. Effects of siRNA-mediated knockdown on cancer relevantphenotypes. A: Cell proliferation quantified by WST-1 assay on days 1, 3,and 5 post-transfection. Cell lines transfected and genes targeted by siR-NAs are indicated. Transfections were performed in triplicate and mean(61 SD) ODs plotted. Note, the decreased growth observed in control(LUC)-transfected SKBR3 cells is attributable to a �2-fold decreasedS-phase fraction and a �2-fold increased apoptotic fraction consequent
to reduced serum (data not shown). B: Apoptosis quantified by fluores-cence microscopy of nuclear morphology on day 3 post-transfection.Transfections were performed in triplicate and mean (61 SD) percent ap-optosis plotted. C: Cell-cycle analysis quantified on day 3 post-transfec-tion by flow cytometry following BrdU incorporation. Fraction of cells inG1, S, and G2/M is indicated. Insets show representative FACS plots forexperiments targeting LUC (left) and ERBB2 (right) in SKBR3 cells.
Genes, Chromosomes & Cancer DOI 10.1002/gcc
766 KAO AND POLLACK
GRB7 and STARD3 together provided an additive
effect (P< 0.05), targeting either together with ERBB2
provided only minimal (and not reproducible) increased
reduction in cell proliferation compared to targeting
ERBB2 alone (Fig. 4).
DISCUSSION
Using RNAi methods to knock down the ex-
pression of amplified genes, we have shown here
that in some cell contexts genes coamplified to-
gether with ERBB2 at 17q12 contribute to cancer-
relevant phenotypes. Specifically, we have found
that knockdown of GRB7 and STARD3 expression
leads to reduced cell proliferation, which appears to
result at least in part from decreased cell-cycle pro-
gression. Therefore, we infer that overexpression of
these genes due to amplification contributes to the
elevated proliferation rates that characterize SKBR3
and BT474 cells. Indeed, preliminary experiments
using other breast cancer cell lines with 17q12
amplification (e.g., ZR75-30) demonstrate the same
to hold true (data not shown). Although previously
speculated (Stein et al., 1994; Akiyama et al., 1997;
Moog-Lutz et al., 1997; ), this is to our knowledge
the first experimental support for a functional contribu-
tion of coamplified genes within the 17q12 amplicon.
GRB7 is an SH2-domain containing adapter pro-
tein that has been shown to interact with EGFR
and ERBB2 (Han et al., 2001). Amplification and
overexpression of GRB7 may enhance signaling
through EGFR-family receptor pathways in some
contexts. STARD3 functions in cholesterol traffick-
ing (Strauss et al., 2003), and has been shown to
stimulate steroidogenesis (Watari et al., 1997) where
breast tumor growth is often responsive to steroids
(Flototto et al., 2001). While plausible then, the
mechanisms through which GRB7 and STARD3
overexpression promote cell proliferation remain to
be elucidated. The differential effect of GRB7 and
STARD3 knockdown observed in BT474 compared
with that in SKBR3 cells (where the effect is more
reproducibly observed in suboptimal growth condi-
tions using low serum) also remains to be investi-
gated, but might be attributable to differences in the
residual levels of expressed protein, or to differences
in the genetic/epigenetic alterations of the cell lines.
Our findings indicate that combined targeting of
ERBB2/GRB7 or ERBB2/STARD3 provides little
additive effect on reducing proliferation levels be-
yond targeting ERBB2 alone, at least in the context
of BT474 cells. This finding underscores the promi-
nent role of the ERBB2 oncogene within this ampli-
con, and from a practical standpoint suggests that
therapies directed against GRB7 and STARD3
would likely provide little if any additional benefit
over targeted ERBB2 therapies alone for patients
with tumors carrying 17q12 amplification. Nonethe-
less, there may be utility for such therapies in ERBB2
therapy (e.g., trastuzamab)-resistant cases.
Our study has addressed the role of two coam-
plified genes (GRB7 and STARD3) that we had
defined by our array CGH data to reside within the
core amplicon at 17q12, and for which antibodies
were available to confirm protein knockdown by
RNAi. The intent was to test the possibility that
coamplified genes might contribute to tumor pheno-
types, rather than to carry out a comprehensive
functional analysis of the 17q12 amplicon. Recent
data from our own laboratory (unpublished) and
others (Kauraniemi et al., 2003) indicate that the
core amplicon at 17q12 includes, besides GRB7,ERBB2 and STARD3, four additional annotated
genes (TCAP, PNMT, PERLD1, C17orf37), of whichthree (PNMT, PERLD1, C17orf37) when amplified
exhibit elevated mRNA levels by RT-PCR (Kaura-
niemi et al., 2003) or DNA microarray (our unpub-
lished data). Additional experiments are required to
assess the functional contribution, if any, of these
other coamplified genes.
It is notable that we succeeded in knocking
down all three targeted genes despite high levels
of DNA amplification (�10- to 15-fold) and over-
Figure 4. Effect of targeting multiple amplified targets. Cell prolifer-ation quantified by WST-1 assay on days 1, 3, and 5 post-transfection.Cell lines transfected and gene combinations targeted by siRNAs are in-dicated. Transfections were performed in triplicate and mean (61 SD)ODs plotted.
Genes, Chromosomes & Cancer DOI 10.1002/gcc
767FUNCTIONAL DISSECTION OF 17q12 AMPLICON
expression. Our findings support the general utility
of a strategy using RNAi to rapidly screen candi-
date oncogene(s) within localized tumor amplicons.
Notably, using RNAi to knock down the expression
of oncogene candidates in cultured cells harboring
amplification likely provides a more physiologically
appropriate context for studying gene function, in
comparison to the more traditional approach of over-
expressing candidate oncogenes in heterologous
nontumorigenic cells such as murine fibroblasts.
For RNAi studies, while assayable phenotypes in
cell culture (e.g., proliferation, apoptosis, migra-
tion, invasion, anchorage-independent growth) are
somewhat limited, in principle a similar approach
could be used to assess altered tumor growth in
vivo using murine xenografts or transgenic models.
While the transient transfection of synthetic siR-
NAs, as performed here, has provided a quick
screen for certain cell culture phenotypes, stable
and even inducible knockdown (Amarzguioui et al.,
2005) would be more suitable for lengthier assays
and in vivo studies.
Breast tumors harbor frequent high-level amplifi-
cation at other loci with known oncogenes, includ-
ing 8p12 (FGFR1), 8q24 (MYC), 11q13 (CCND1),12q13 (MDM2), and 20q13 (ZNF217) (Courjal et al.,1997; Nonet et al., 2001), as well as many amplified
sites with as yet no known oncogene (Hyman et al.,
2002; Pollack et al., 2002). Such amplicons rarely
contain single genes. This observation might
reflect physical properties of genome hotspots for
amplification, for example preferred sites of break-
age-fusion-bridge (BFB) cycles (Gisselsson, 2003).
Alternatively, our findings for the 17q12 amplicon
support the competing hypothesis that many or
most such tumor amplicons comprise several genes
because the coamplification of multiple genes pro-
vides selective advantage through contributions to
tumorigenic phenotypes. Additional studies are re-
quired to assess the generalizability of our findings
to other tumor amplicons.
ACKNOWLEDGMENTS
We wish to thank Dr. Marie-Christine Rio (IGMBC,
France) for providing anti-STARD3 antibody. We
also thank the members of the Pollack lab for help-
ful discussion.
REFERENCES
Abramoff MD, Magelhaes PJ, Ram SJ. 2004. Image processing withImageJ. Biophotonics Int 11:36–42.
Akiyama N, Sasaki H, Ishizuka T, Kishi T, Sakamoto H, Onda M,Hirai H, Yazaki Y, Sugimura T, Terada M. 1997. Isolation of a
candidate gene, CAB1, for cholesterol transport to mitochondriafrom the c-ERBB-2 amplicon by a modified cDNA selectionmethod. Cancer Res 57:3548–3553.
Amarzguioui M, Rossi JJ, Kim D. 2005. Approaches for chemicallysynthesized siRNA and vector-mediated RNAi. FEBS Lett 579:5974–5981.
Choudhury A, Charo J, Parapuram SK, Hunt RC, Hunt DM,Seliger B, Kiessling R. 2004. Small interfering RNA (siRNA)inhibits the expression of the Her2/neu gene, upregulates HLAclass I and induces apoptosis of Her2/neu positive tumor celllines. Int J Cancer 108:71–77.
Cohen JJ. 1993. Apoptosis. Immunol Today 14:126–130.Courjal F, Cuny M, Simony-Lafontaine J, Louason G, Speiser P,
Zeillinger R, Rodriguez C, Theillet C. 1997. Mapping of DNAamplifications at 15 chromosomal localizations in 1875 breasttumors: Definition of phenotypic groups. Cancer Res 57:4360–4367.
Faltus T, Yuan J, Zimmer B, Kramer A, Loibl S, Kaufmann M,Strebhardt K. 2004. Silencing of the HER2/neu gene by siRNAinhibits proliferation and induces apoptosis in HER2/neu-overex-pressing breast cancer cells. Neoplasia 6:786–795.
Flototto T, Djahansouzi S, Glaser M, Hanstein B, Niederacher D,Brumm C, Beckmann MW. 2001. Hormones and hormone antag-onists: Mechanisms of action in carcinogenesis of endometrialand breast cancer. Horm Metab Res 33:451–457.
Gisselsson D. 2003. Chromosome instability in cancer: How, when,and why? Adv Cancer Res 87:1–29.
Han DC, Shen TL, Guan JL. 2001. The Grb7 family proteins:Structure, interactions with other signaling molecules and poten-tial cellular functions. Oncogene 20:6315–6321.
Hyman E, Kauraniemi P, Hautaniemi S, Wolf M, Mousses S,Rozenblum E, Ringner M, Sauter G, Monni O, Elkahloun A,Kallioniemi OP, Kallioniemi A. 2002. Impact of DNA amplifica-tion on gene expression patterns in breast cancer. Cancer Res 62:6240–6245.
Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J,Mao M, Li B, Cavet G, Linsley PS. 2003. Expression profilingreveals off-target gene regulation by RNAi. Nat Biotechnol 21:635–637.
Kauraniemi P, Kuukasjarvi T, Sauter G, Kallioniemi A. 2003. Ampli-fication of a 280-kilobase core region at the ERBB2 locus leadsto activation of two hypothetical proteins in breast cancer. AmJ Pathol 163:1979–1984.
Knuutila S, Bjorkqvist AM, Autio K, Tarkkanen M, Wolf M, Monni O,Szymanska J, Larramendy ML, Tapper J, Pere H, El-Rifai W,Hemmer S, Wasenius VM, Vidgren V, Zhu Y. 1998. DNA copynumber amplifications in human neoplasms: Review of compara-tive genomic hybridization studies. Am J Pathol 152:1107–1123.
Lewis GD, Figari I, Fendly B, Wong WL, Carter P, Gorman C,Shepard HM. 1993. Differential responses of human tumor celllines to anti-p185HER2 monoclonal antibodies. Cancer ImmunolImmunother 37:255–263.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expressiondata using real-time quantitative PCR and the 2(-Delta Delta C(T))Method. Methods 25:402–408.
Moog-Lutz C, Tomasetto C, Regnier CH, Wendling C, Lutz Y,Muller D, Chenard MP, Basset P, Rio MC. 1997. MLN64 exhibitshomology with the steroidogenic acute regulatory protein (STAR)and is over-expressed in human breast carcinomas. Int J Cancer71:183–191.
Nonet GH, Stampfer MR, Chin K, Gray JW, Collins CC, Yaswen P.2001. The ZNF217 gene amplified in breast cancers promotesimmortalization of human mammary epithelial cells. Cancer Res61:1250–1254.
Pollack JR, Sorlie T, Perou CM, Rees CA, Jeffrey SS, Lonning PE,Tibshirani R, Botstein D, Borresen-Dale AL, Brown PO. 2002.Microarray analysis reveals a major direct role of DNA copy num-ber alteration in the transcriptional program of human breasttumors. Proc Natl Acad Sci USA 99:12963–12968.
Reese DM, Slamon DJ. 1997. HER-2/neu signal transduction inhuman breast and ovarian cancer. Stem Cells 15:1–8.
Ries LAG, Eisner MP, Kosary CL, Hankey BF, Miller BA, Clegg L,Mariotto A, Feuer EJ, Edwards BK. 2005. SEER Cancer StatisticsReview, 1975–2002. Bethesda, MD: National Cancer Institute.
Rozen S, Skaletsky H. 2000. Primer3 on the WWW for generalusers and for biologist programmers. Methods Mol Biol 132:365–386.
Schuuring E, Verhoeven E, Mooi WJ, Michalides RJ. 1992. Identifi-cation and cloning of two overexpressed genes, U21B31/PRAD1and EMS1, within the amplified chromosome 11q13 region inhuman carcinomas. Oncogene 7:355–361.
Genes, Chromosomes & Cancer DOI 10.1002/gcc
768 KAO AND POLLACK
Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V,Bajamonde A, Fleming T, Eiermann W, Wolter J, Pegram M,Baselga J, Norton L. 2001. Use of chemotherapy plus a monoclonalantibody against HER2 for metastatic breast cancer that overex-presses HER2. N Engl J Med 344:783–792.
Stein D, Wu J, Fuqua SA, Roonprapunt C, Yajnik V, D’Eustachio P,Moskow JJ, Buchberg AM, Osborne CK, Margolis B. 1994. TheSH2 domain protein GRB-7 is co-amplified, overexpressed andin a tight complex with HER2 in breast cancer. EMBO J 13:1331–1340.
Strauss JF, III, Kishida T, Christenson LK, Fujimoto T, Hiroi H.2003. START domain proteins and the intracellular trafficking of
cholesterol in steroidogenic cells. Mol Cell Endocrinol 202:59–65.
Subramaniam DS, Isaacs C. 2005. Utilizing prognostic and predictivefactors in breast cancer. Curr Treat Options Oncol 6:147–159.
Tuschl T, Borkhardt A. 2002. Small interfering RNAs: A revolution-ary tool for the analysis of gene function and gene therapy. MolInterv 2:158–167.
Watari H, Arakane F, Moog-Lutz C, Kallen CB, Tomasetto C,Gerton GL, Rio MC, Baker ME, Strauss JF, III. 1997. MLN64contains a domain with homology to the steroidogenic acute reg-ulatory protein (StAR) that stimulates steroidogenesis. Proc NatlAcad Sci USA 94:8462–8467.
Genes, Chromosomes & Cancer DOI 10.1002/gcc
769FUNCTIONAL DISSECTION OF 17q12 AMPLICON