RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute,...

25
RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology (BIOTEC), Thailand

Transcript of RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute,...

Page 1: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

RExPrimerPongsakorn Wangkumhang, M.Sc.

Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology (BIOTEC), Thailand

Page 2: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Motivations• de facto Primer3 program has limitations• Graphical user interface for visualizing gene

structure is crucial for the resequencing primer design

• Existing primer designing tools do not consider▫ SNP-in-Primer

mis-matching problem▫ Pseudogene form

mis-priming problem▫ Structural variation (CNV)

mismatching (deletion) and mis-priming (duplication)

Page 3: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Generic steps for primer design

•Identify target sequence▫Genome sequence, intron/exon boundaries

•Design primers▫Use de facto Primer3

•Check for Specificity▫Use BLAST, primerBLAST or UCSC In-Silico

PCR

Page 4: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

What are the tools out there?

• PrimerZ [Tsai et al, 2007 ]• EasyExonPrimer [Wu and Munroe, 2006 ]• MutScreener [Yao et al, 2006 ]• VariantSEQr [Applied Biosystem, 2005]• ELXR [Schageman et al, 2004]• SNPbox [Weckx , 2004]• ExonPrimer (ihg2.helmholtz-muenchen.de/ihg/ExonPrimer.html)• Genomic Primer (www-fgg.eur.nl/kgen/primer/Genomic_Primers.html)

Page 5: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Software FunctionalityPrimerZ

MutScreener

EasyExonPrimer

VariantSEQr

ELXRSNPbox

ExonPrimer

Genomic Primer

Sequence information retrievals

and annotations + + + - + + - -Promoter

resequencing ++ ++ - ++ - ++ - -Continuous genomic DNA resequencing - ++ - - - ++ - -

Combining two short exons as one

template - + - - - - ++ -Overlapping primers

for large exons ++ ++ ++ ++++ - ++ -

Redesign + - - - - - - -++ : Very good + : Available with limitation- : Not available

Page 6: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Problems to be solved!!•Mis-matching (No amplification due to

variation in primer)▫SNP-in-primer▫Insertion/deletion (indel) polymorphisms▫Copy number variation (CNV)

•Mis-priming (Non-target homology seq. binding) ▫Structural complexity of the genome ▫Pseudogene forms▫Chromosome segmental duplications▫Repetitive elements (e.g. SINES, LINES,

satellite sequences, etc.)

Page 7: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Why RExPrimer (features must have)•DNA Resequencing/SNP genotyping

primer design•Integrated to Human genome database,

variation databases•Intuitive and comprehensive visualization

for avoiding unwanted regions at first•Re-designable to escape previous

unwanted regions

Page 8: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

RExPrimer Workflow

Page 9: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Case Study : CYP2D6 Resequencing

• Cytochrome P450 2D6 gene• Important drug metabolizing enzyme• Ethnic-specific resequencing/genotyping CYP2D6 is

crucial for medical treatments• Highly polymorphic i.e. SNPs, CNVs and Pseudogenes• Pseudogenes, CYP2D7P and CYP2D8P, share 98%

homology with CYP2D6

Page 10: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Case Study: CYP2D6 Resequencing

SNP Genotyping

DNA Resequencing

Page 11: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

SNP Genotyping

DNA ResequencingCYP2D6

Case Study: CYP2D6 Resequencing

Page 12: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Gene location of CYP2D6 and its pseudogenes

Case Study: CYP2D6 Resequencing

Page 13: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Gene location of CYP2D6 and its pseudogenesChromosome mapping of CYP2D6 and its pseudogenes

Case Study: CYP2D6 Resequencing

Page 14: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Gene location of CYP2D6 and its pseudogenesChromosome mapping of CYP2D6 and its pseudogenes

Multiple sequence alignment of CYP2D6 and its pseudogenes

CYP2D6 gene

Case Study: CYP2D6 Resequencing

pseudogenes

Page 15: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Case Study: CYP2D6 Resequencing

Page 16: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Example Scenario: CYP2D6 Resequencing

CYP2D6 gene

pseudogenes

CNVs

Page 17: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

2191

8000..2191

9500

Example Scenario: CYP2D6 Resequencing

219126902191292

0

Page 18: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Example Scenario: CYP2D6 Resequencing

CYP2D6 gene

pseudogenes

CNVs

Page 19: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

RExPrimer Results

Page 20: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Experimental Validation

Name Sequence 5'→ 3'

CYP2D6_1F GGCCTACCCTGGGTAAGGGCCTGGAGCAGGA

CYP2D6_1R CTCAGCCTCAACGTACCCCTGTCTCAAATGCG

CYP2D6_2F GAGACTCCTCGGTCTCTCG

CYP2D6_2R TAATGCCTTCATGGCCACGCG

CYP2D6_3F AGGCCTTCCTGGCAGAGATGAAG

CYP2D6_3R CCCCTGCACTGTTTCCCAGA

CYP2D6_4F CCAGCCACCATGGTGTCTTTG

CYP2D6_4R GCCTCAACGTACCCCTGTCTC

CYP2D6_5F GTACCCCTGTCTCAAATGCG

CYP2D6_5R GTAAGGGCCTGGAGCAGGA

Purpose

whole gene amplification

exon 1-2 amplification

exon 9 amplification

exon 3-5 PCR amplification

exon 6-8 amplification

Page 21: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Amplification Results

Whole gene amplicon of CYP2D6 gene amplificationfrom 5 diff samples

4.6 kb

468 bp

624 bp 860 bp 1180 bp

1 2 3 4 5

Exon 1-2

Exon 3-5

Exon 6-8

Exon 9

100 bp M

1

2 Nested PCR yieldsexon 1-9 amplicon

Page 22: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Conclusions

RExPrimer is successful at :• designing resequencing primers; specific to the

target gene • Guiding/assisting users to make the PCR

experimental design• All-in-one graphic user-interface of

gene structure view alignment true/pseudogenes SNP from several ethnics CNVs

• www4a.biotec.or.th/rexprimer

Page 23: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Future Work

Currently adding more organisms to the RExPrimer platform

Bovine Porcine Mouse Canine Chicken Horse Chimpanzee

Page 24: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Acknowledgements

• Jittima Piriyapongsa• Chumpol Ngamphiw• Anunchai Assawamakin• Payiarat Suwannasri• Uttapong Ruangrit• Sissades Tongsima• Philip J. Shaw • BIOTEC• Siriraj Hospital, Mahidol

University

Page 25: RExPrimer Pongsakorn Wangkumhang, M.Sc. Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology.

Thank you for your attention

Questions?