RESEARCH ARTICLE Open Access Investigation of genetic ......The 1RS/1BL translocation is one of the...

RESEARCH ARTICLE Open Access

Investigation of genetic diversity and populationstructure of common wheat cultivars in northernChina using DArT markersLiYi Zhang1,2, DongCheng Liu1, XiaoLi Guo3, WenLong Yang1, JiaZhu Sun1, DaoWen Wang1, Pierre Sourdille4 andAiMin Zhang1*

Abstract

Background: In order to help establish heterotic groups of Chinese northern wheat cultivars (lines), Diversity arraystechnology (DArT) markers were used to investigate the genetic diversity and population structure of Chinesecommon wheat (Triticum aestivum L.).

Results: In total, 1637 of 7000 DArT markers were polymorphic and scored with high confidence among acollection of 111 lines composed mostly of cultivars and breeding lines from northern China. The polymorphisminformation content (PIC) of DArT markers ranged from 0.03 to 0.50, with an average of 0.40, with P > 80 (reliablemarkers). With principal-coordinates analysis (PCoA) of DArT data either from the whole genome or from the B-genome alone, all lines fell into one of two major groups reflecting 1RS/1BL type (1RS/1BL and non-1RS/1BL).Evidence of geographic clustering of genotypes was also observed using DArT markers from the A genome.Cluster analysis based on the unweighted pair-group method with algorithmic mean suggested the existence oftwo subgroups within the non-1RS/1BL group and four subgroups within the 1RS/1BL group. Furthermore, analysisof molecular variance (AMOVA) revealed highly significant (P < 0.001) genetic variance within and amongsubgroups and among groups.

Conclusion: These results provide valuable information for selecting crossing parents and establishing heteroticgroups in the Chinese wheat-breeding program.

BackgroundBread wheat (Triticum aestivum L.), an economicallyimportant cereal, is widely cultivated worldwide. Of thenearly 600 Mt of wheat harvested worldwide, about 80%is used as human food [1]. Wheat-breeding programsaround the world are working toward improved grainyield with better quality, disease-resistance and agro-nomic performance.Knowledge of the genetic diversity within a germplasm

collection is the basis for selection of crossing parents,establishing heterotic groups and has a significant impacton the improvement of crops. Therefore, assessment ofthe extent and nature of genetic variation in bread wheat

is important to breeding and genetic resource conserva-tion programs. As molecular markers have been devel-oped, they have been extensively explored for analysis ofgenetic diversity in common wheat; such markers includerestriction fragment length polymorphisms (RFLPs) [2,3],randomly amplified polymorphic DNA (RAPD) [4,5],amplified fragment length polymorphisms (AFLP) [6,7],and simple-sequence repeats (SSR) [8-12].The 1RS/1BL translocation is one of the most fre-

quently used alien introgressions in wheat-breeding pro-grams throughout the world [13,14]. In addition to itsadvantage in disease resistance (Sr31, Lr26, and Yr9)[15], the 1RS translocation is also useful for its positiveeffect on agronomic traits including yield performance,yield stability, and wide adaptation [16,17]. However, 1RScarries the Sec-1 locus coding for ε-secalin, which resultsin negative effects on bread-making quality, such as poormixing tolerance, superficial dough stickiness, and low

* Correspondence: [email protected] State Key Laboratory of Plant Cell and Chromosome Engineering,Institute of Genetics and Developmental Biology, Chinese Academy ofSciences, Beijing, ChinaFull list of author information is available at the end of the article

Zhang et al. BMC Genetics 2011, 12:42http://www.biomedcentral.com/1471-2156/12/42

© 2011 Zhang et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.

mailto:[email protected]

http://creativecommons.org/licenses/by/2.0

bread volume [18,19]. Some defects in noodle processingquality are also correlated with this translocation [20,21].Various molecular markers, including STS (Sequence-Tagged Site), SCAR (Sequence Characterized AmplifiedRegion), RAPD, and SSR, have been employed to detectthe 1RS/1BL translocation [22-24]Recently, diversity arrays technology (DArT) markers

were developed to discover and score genetic poly-morphic markers in the whole genome. This technologyis a sequence-independent and high-throughput method[25]. DArT markers have been applied to several speciesincluding cereals such as barley (Hordeum vulgare L.),wheat (Triticum aestivum L.), and durum wheat (Triti-cum durum L.). Not only the technology has been usedto create high-density genetic maps [26] and for associa-tion studies [27,28], but it is also expanding into thestudy of genetic diversity and population genetics[29-31]. Stodart et al. [30] compared AFLP, SSR, andDArT markers and found that DArT markers are suita-ble for estimation of genetic diversity in landrace culti-vars of bread wheat.China is the world’s most populous nation, accounting

for 20% of the global population. Crop yield has alwaysbeen a primary concern of agronomists in China. North-ern wheat production plays an important role in China’sfood production. Production in the major growing areaof northern China, represents 45-53% of wheat acreage,and accounts for 47-61% of the total production [32].Since 1RS translocations were introduced to China inthe early 1970s, they have been widely used in wheat-breeding programs [33]. In some major wheat-growingarea of northern China, 1RS/1BL translocations are pre-sent in 50 ~ 70% of all wheat cultivars [34]. Therefore,information about the genetic diversity and the distribu-tion of 1RS/1BL translocations within Chinese germ-plasm is very important for improving wheat yield withbetter quality in Chinese northern breeding programs.To help establish heterotic groups of Chinese northern

wheat cultivars (lines), we assessed the genetic diversityin a collection of cultivars from northern China usingDArT markers and diversity analysis. We also usedDArT data to investigate the distribution of 1RS/1BLlines within the northern cultivars.

ResultsPolymorphism of DArT markersScanning with about 7000 DArT markers resulted in2264 polymorphic loci, of which 1362 markers wereassigned to the 21 wheat chromosomes. Each DArTmarker was subjected to an ANOVA-based statisticalanalysis to estimate its quality, described as a P-value(the between-allelic-states variance of the relative targethybridization intensity as a percentage of the total var-iance). In general, markers with P-values above 80 were

scored very reliably, according to Triticarte Pty. Ltd.Finally, 1637 DArTs were selected with P-values > 80,1009 markers of them had genetic locations on thewheat chromosomes. Most of the 1009 DArTs werelocated on the B genome (566), followed by the A (290)and D genomes (88). Similarly, these DArTs wereunevenly distributed among the seven homologousgroups of common wheat chromosomes. Group 1 har-bored the largest number (241), followed by group 3(182), group 6 (141), group 7 (138), group 2 (133),group 5 (91), and group 4 (83).Polymorphism information content (PIC) values, com-

puted for the 1637 polymorphic markers, ranged from0.03 to 0.50 (the maximum value for a biallelic marker),with a mean value of 0.40. DArT allele frequencies ran-ged from 0.22 to 0.78 (mean = 0.43 ± 0.13) and showeda near-normal distribution. The DArT markers usedshowed different levels of genetic diversity; Nei’s geneticdiversity [35] ranged from 0.11 to 0.51, with an averageof 0.40 for all markers. As this index is equivalent to thePIC index, these results also provide an estimate of thediscriminatory power of each DArT locus.

Population structure on the whole-genome levelPCoA analysis was used to examine population structurein the collection, using the 1637 DArT markers (P >80%) distributed throughout the entire genome. A two-dimensional scatter plot of the 111 wheat genotypes,shown in Figure 1, reveals two clear groups. The first(PCo-X) and second (PCo-Y) principal coordinatesaccounted for 8.9% and 6.4% of the variation, respec-tively. The right-hand group proved to be highly clus-tered around the PCo-X axis with no obvious separationof cultivars (lines) originating from different geographicregions. In contrast, the left-hand group was spreadwidely along both the PCo-X and PCo-Y axes. Mostgenotypes from Hebei province was located in the upperleft quadrant, some genotypes from Shandong clusteredin the upper right quadrant, and some from Beijing fall-ing into the lower left quadrant.

Between-population differencesLinkage disequilibrium analysis was performed to investi-gate differences between the two groups. As a result, 136DArT markers on chromosome 1B showed significantLD between DArT markers and the “group locus” withan average r2 value of 0.69 (P < 0.001; range: 0.1 to 1).Among these markers, 11 showing complete LD (r2 = 1with P = 0) were observed on chromosome 1BS. Consid-ering the possible existence of 1RS/1BL translocations inChinese cultivars (lines), the primers specific for 1RS ofrye were subsequently used to scan all cultivars (lines);this demonstrated that our collection was distinctly sepa-rated based on 1RS/1BL and non-1RS/1BL translocations


of 11

with a few exceptions (see Additional file 1). As shown inFigure 1, the right-hand group was composed of 47 non-1RS/1BL lines, and the left-hand group of 61 1RS/1BLlines. Four 1RS/1BL lines, i.e., cv. Xiaoyan986, Liang-xin68, Yanyou361, and Shen99369, were scatteredbetween the two groups. Only one 1RS/1BL line(Luyuan212) fell within the 1BS/1BL cluster.

Population structure based on different wheat genomesDifferences in the genetic structure among the threegenomes, A (290), B (566), and D (88), were investigatedfor relationships among these cultivars (lines).PCoA analysis based on genotype data from the 290

DArT markers on genome A showed that our collectionwas roughly divided into three groups according to geo-graphical origin (Figure 2). The majority of cultivars(lines) from Beijing grouped together, whereas anothergroup mainly contained cultivars from Shandong

province. Cultivars (lines) from Henan province wereclustered together at the junction of the Beijing andShandong groups. However, cultivars (lines) originatingfrom Hebei province did not separate out, and werescattered among the three groups.Similarly, PCoA analysis was performed based on gen-

otype data from the 566 DArTs on genome B. A clearseparation of 1RS/1BL and non-1RS/1BL lines wasobserved with the sole exception of Luyuan212, whichwas consistent with the result obtained using DArTsfrom the whole genome. Similarly, the four 1RS/1BLlines were distributed between the two groups and closeto the 1BS/1BL groups (Figure 3).PCoA analysis based on the 88 DArT markers on the D

genome showed a different profile. The separation wasnot based on geographical origin or 1RS/1BL transloca-tions. All cultivars (lines) fell into two distinct groups: alarge group comprising 88 lines and a small group of the

Shen 99369

Yanyou361Yanyou361

Liangxin 68

1BS/1BLXiaoyan 986

Luyuan212

1RS/1BL

Figure 1 Distribution of varieties in two-dimensional PCoA space based on DArT data at the whole-genome level. Non-1RS/1BL lines arein green type, and 1RS/1BL lines are in red.


of 11

remaining 23 lines. The components of the small groupmainly originated from Shandong and Beijing (Figure 4).In the same way, LD analysis performed to investigatethe relationship between the two groups, showed that 20DArTs on chromosome 1D presented significant LDbetween the marker and the “group locus” with an aver-age r2 value of 0.95 (P < 0.001)

Genetic relationships among wheat cultivarsThe Jaccard genetic distance coefficients (d) rangedfrom 0 to 0.76, with an overall mean of 0.55. The great-est distance was observed between the cultivars cv.Shi01-Z056 and Jinmai60. The d-values did not differgreatly between cultivars (lines) with different origins

(0.51 for cultivars from Beijing and 0.56 for those fromHebei). A consensus dendrogram obtained fromUPGMA of d was constructed and is shown in Figure 5.Again, a clear separation of 1BL/1RS and non-1BL/1RStypes was observed. Two clear sizable (>5 genotypes)subgroups (SG1 and SG2) within the group formed bynon-1RS/1BL lines can be distinguished. SG1 was com-posed of lines from all regions, whereas the lines withinSG2 were primarily from Shandong province. Withinthe 1RS/1BL branch of the tree, genotypes fell into foursubgroups (SG3-SG6). SG3 consists of 27 cultivars thatwere predominantly from the Hebei province, whereasSG4 primarily contained 30 cultivars that were exclu-sively from the Beijing region. The final two subgroups

Figure 2 Distribution of varieties in two-dimensional PCoA space (A genome).


of 11

(SG5 and SG6) mainly consisted of cultivars from Hei-bei province.

Analysis of molecular variance (AMOVA)As described above, six important subgroups were iden-tified in the cluster analysis, and these were used to per-form an AMOVA on the collection of lines. Thecollection was considered to be composed of two groups(based on 1RS-type) and six subgroups. Highly signifi-cant (P < 0.001) genetic variance was observed withinand among subgroups and among groups (Table 1). Thevariance within subgroups accounted for the largest por-tion (72.2%) of total variance, whereas 9.3% of the var-iance was observed among groups, and differencesamong subgroups contributed 18.5% of the total

variance. The estimated fixation index (FST) value of0.28 suggests that this germplasm was highly differen-tiated. Subgroup pairwise FST results showed that thelowest (0.11) and the highest (0.42) FST values were pre-sent between subgroups 4 and 5 and between subgroups2 and 3, respectively (Table 2).

DiscussionDArT markersIn this study, we demonstrated the power of DArT mar-kers for investigating population structure and geneticdiversity in common wheat; these markers will be usefulin integrating this work with future objectives and mar-ker-based results in the wheat-breeding program. DArTmarkers proved cost effective and ideally suited to high-

Shen 99369

Yanyou 361

Liangxin 68Liangxin 68

Luyuan212Xiaoyan 986

Figure 3 Distribution of varieties in two-dimensional PCoA space (B genome).


of 11

throughput parallel analysis that was not dependent onin-house infrastructure. These results will be crossapplicable with many other projects in wheat that arealso using DArT-based markers. Furthermore, whenDArT clone sequences are available, these will provideaccess to other methods for marker design and fororthology-based comparison among species. A recentanalysis of DArT clone sequences in oat showed thatover one-third of these markers contain DNA sequenceswith strong homology to functionally annotated genes[36].DArT markers in the present study showed an average

PIC of 0.40, which suggests that they are sufficientlyinformative. The polymorphic DArT markers in oursamples were frequently present on the B genome, butseldom occurred on the D genome, in keeping with therelative lack of polymorphic DArT markers found in

this genome by Akbari et al. (2006). This agrees withthe fact that the B genome presents the highest level ofpolymorphism, whereas the D genome shows the lowestlevel among the wheat ABD genomes [37-39].

IRS/1BL translocation in Chinese cultivarsSTS, SCAR, RAPD, and SSR molecular markers havebeen employed to detect the 1RS/1BL translocation [24].DArT markers are dominant, and their polymorphism isbased on SNPs and INDELs at restriction enzyme clea-vage sites and restriction fragments [31]. DArT markerswere shown in this study to be a very powerful tool fordetecting 1RS/1BL translocation. PCoA results, based ondata from 1637 DArTs from the entire genome, agreedwith those obtained by 1RS-specific markers [40] with anexception of Luyuan212. When the DArTs on chromo-some 1B that contributed to separating the translocation

Figure 4 Distribution of varieties in two-dimensional PCoA space (D genome).


of 11

lines were removed, the separation was no longerobserved, and the profile was similar to that correspond-ing to the A genome (Figure not shown). In comparisonwith other molecular markers, DArT was a usefulmethod not only for distinguishing 1RS/1BL lines, butalso for possibly identifying the origins or the size oftranslocation fragments. In this study, several 1RS/1BL

lines were observed scattered between the 1RS/1BL andnon-1BS/1BL groups, two of which were derived fromShandong province. This result suggests that these linesare likely to carry 1RS with different sizes of 1RS seg-ments or different origins of the 1RS chromosome [24].Further work including cytological observations is neededto confirm this possibility.

SHANNONGl025 SHIQIN08-0483 08CHUNGUANG23 CA0175 GAOCHENG8901 SHILUAN02-1 HENG98112 PH85-16 SHANNONGYOUMAI3

SHANYOU225 ZHOUYOU10-2 BAINONG4330

1BS/1BL

SG1

BAINONG4330 HENG97-5049 XINGMAI18 ZHENGNONG35-2 DEYOU996 SHANNONGRUAN943

XIAOYAN986 ZHENG005 ZHENGZHOU18 SHI99-6123 ND3519 AM5214 LUYUAN212 ND3383 TAISHAN008 JING411 1BS/1BLJING411

JING9428 CA0548 RS526 WAIMAIGAILIANG-

ZHONGYOU9507 IG4022 NONGDA211 SN1931 YUMAI57 LANKAO906 984121 LIANGXING99 BINGMAI8 LIANGXING66 SHEN99369

SG2

N943

SHEN99369 JINAN17 XF2899 SHANNONG05-066 YANNONG21 YANYOU361 JIMAI6079 ZHOUYUAN9369 LIANGXING68 SHI02-6207 SHANNONG1801 JIMAI20-HB JIMAI20-SD HAN4587 LAIZHOU3279 HEN4399

SG3

HEN4399 JI96-5008 HENG0628 YUNMAI127 HENG5 HAN7086 HAN02-4080 HAN04-8062 JINGDONG8 YANFU188 JINMAI60 HENONG2552 HENONG1150 HENONG5246 HENONGKANG117 SHANNONGDAPH01-

1RS/1BLSG4

SHANNONGDAPH01 SHI4185 ND3236-3 ND3291B ND3291R SHAN623 F4370-1 ND3308 ND3197 SHILUAN5206 ND3243 SHIL4058 XIAOYAN22 07-ZHONG36 07-ZHONG38 DENGHAI5348

SG5

DENGHAI5348TAISHAN9818

CA0477 BAINONG64 988044 04TAIAN-4 HUAIMAI0226 09189-1-2-1 WEICAI17 LAIZHOU127 SN1741 ZHOU12 ZHOUMAI18 DENGHAI5049 DONG8131 YUN97169

SG6

Coefficient0.39 0.55 0.70 0.85 1.00

ZHENG366 HENG5229 BAOMAI6 SHIMAI15 HENONG604 KENONG199 SHIXIN616 SHI01-Z056 HENGZA4

Figure5 Dendrogram representing the relationships among the 111 Chinese wheat cultivars. That was revealed by UPGMA clusteranalysis based on Jaccard genetic distances. Non-1RS/1BL lines are in black type, and 1RS/1BL lines are in grey.

Table 1 Analysis of molecular variance for 111 wheat cultivars in northern China

Source of variation d.f. Sum of squares Variance components V%

Among 1RS-type groups 1 3191.44 29.35 9.36

Among subgroups within 1RS-type groups 4 4515.87 57.98 18.49

Within subgroups 103 23310.76 226.32 72.15

Total 108 32018.07 313.66

Fixation index (FST) = 0.28


of 11

Additional information was revealed by DArT markersbased on the different genomes used. Our collectionwas approximately grouped by geographical regionwhen using data from DArTs on the A genome. Culti-vars formed three groups: Beijing, Henan, and Shan-dong. This clustering result may be explained by thepresence of some important development genes on theA genome, which may be involved in selection for adap-tation to local environments. For example, chromosome5A is known to carry a number of genes affecting adapt-ability and productivity, such as the vernalizationrequirement gene Vrn-A1, one of the main determinantsof the winter/spring growth-habit polymorphism [41]. Inaddition, the ear morphology gene q, the frost-resistantgene Fr1 [42], and a QTL response to environmentalstress [43] have all been located on the long arm of 5A.Therefore, cultivars bred in similar ecological zones mayhave similar adaptability and therefore group together.However, the cultivars from Hebei province overlappedwith those from other regions; this may be explained bythe fact that Hebei province is located at the junction ofthese three areas, and therefore, the Hebei cultivars(lines) may show extensive genetic diversities. In ourcollection, Hebei’s genotypes were more diverse thanthose from the other regions at the A-genome level; thedecreasing order of average genetic diversity was Hebei(0.59) > Shandong (0.57) > Henan (0.56) > Beijing(0.53). PCoA analysis performed using data produced bya set of DArT markers assigned to the B genome ofcommon wheat produced a similar result to that basedon the whole genome. This is fully explained by the factthat our collection was clustered based on markers spe-cific to translocation of 1RS/1BL on chromosome 1B. Inaddition, significantly different clusters were observed inthe PCoA profile of DArT markers on the D genome;23 cultivars (lines) that split from the others weremainly composed of genotypes from Shandong and Beij-ing. Through LD analysis, we found that this separationdepended on the 20 DArT markers on chromosome 1D.However, the distribution of DArT markers on the Dgenome is largely skewed toward chromosome 1D(nearly half, 39/88). These deviated markers are likely tolead to such a clustering, but future cytological analysis

will be required to determine the reason for the 1RS/1DL translocation.As reported by Zhang et al [34], 1RS/1BL transloca-

tion accounts for up to 50-70% of all wheat cultivars insome major wheat-growing area of China. In our study,the results from UPGMA cluster and PCoA analysisrevealed that 63.6% (64/111) of wheat cultivars (lines)were 1RS/1BL lines. The distribution of 1RS/1BL trans-location was different in the Northern China. Theincreasing order of percentage of 1RS/1BL lines wasBeijing (46%, 11/24) < Shandong (47%, 15/32) < Henan(50%, 7/14) < Hebei (73%, 24/33) in our collection. Only25% of genotypes from Dezhou in Shandong provincewere 1RS/1BL translocation lines, while all cultivars(lines) from Baoding (6) and Handan (4) in Hebei pro-vince were 1RS/1BL lines (Additional file 1). As men-tioned above, Hebei’s genotypes showed more geneticdiversity than those from the other regions. The intro-duction of 1RS/1BL increased the genetic diversity butbrought in some inferior traits, because the ε-secalincoded by Sec-1 locus on 1RS results in negative effectson bread-making and noodle processing quality. Withthe improvement of living standards in China, thedemand for high-quality wheat has been growing; thus,improving wheat quality has recently become an impor-tant goal of the Chinese wheat-breeding program. Infor-mation about the genetic diversity and the distributionof 1RS/1BL translocations within a germplasm collectionis very important for establishing heterotic groups andimproving breeding efficiency. To obtain high-qualitycultivars (lines), Chinese breeders should avoid selectingcrossing parents from the same 1RS/1BL group.

ConclusionsOur studies demonstrated that DArT markers are apowerful tool for investigating population structure andgenetic diversity in common wheat. We separated 111Chinese wheat cultivars (lines) into two distinct groupsbased on whether they carry 1RS or non-1RS segmentsusing DArT markers from both the whole genome andthe B genome. Our analysis resulted in three geographi-cal groups of cultivars at the A genome level: Beijing,Shandong, and Henan. This information is very impor-tant for wheat breeding in China.

Materials and methodsPlant materialsA set of 111 common wheat cultivars and breeding lineswas selected to represent the germplasm use in northernChina during the last decade. These cultivars (lines)were high quality or high yield, including 24 from theNorthern winter wheat region (Beijing region), 87 fromthe Yellow-Huai winter wheat region (Hebei, Henan,Shandong, Shaanxi, Shanxi, and Jiangsu provinces).

Table 2 Population pairwise FST values

Subgroup 1 2 3 4 5

1

2 0.18

3 0.36 0.42

4 0.20 0.33 0.30

5 0.20 0.23 0.29 0.11

6 0.25 0.32 0.40 0.19 0.13


of 11

A complete listing of these genotypes is provided inAdditional file 1.

DArT genotyping and 1RS/1BL detectionDNA was extracted from young leaf tissue from a singleplant of each genotype using the protocol recommendedby Triticarte Pty. Ltd. (http://www.triticarte.com.au). Atotal of 111 DNA samples were sent to Triticarte forDArT analysis using the common wheat PstI(TaqI) v3.0array, which comprises 19,000 clones known to be poly-morphic for about 7000 markers in a wide range ofwheat cultivars, and about 3500 markers have beenassigned to chromosomes using nulli-tetrasomic (NT)lines derived from Chinese Spring [39].1RS/1BL lines were detected with five 1RS-specific

insertion-site-based polymorphism (ISBP) markers [40].The five primer pairs are listed in Table 3. PCR was per-formed according to the protocol described in Bartoset al.[40].

Statistical analysesThe polymorphism information content (PIC) valueswere calculated for each DArT marker using the formulaPIC = 1 - ∑ (Pi)2, where Pi is the proportion of the popu-lation carrying the ith allele [44]. Nei’s genetic diversity isdefined as the probability that two randomly chosen hap-lotypes are different in the sample and was estimated

with the formula H =n

(n + 1)

(1− ∑k

i=1 p2i

)[35,45].

A binary matrix was produced from the DArT data byscoring fragments as 1 or 0 for the presence or absenceof a specific marker allele, respectively. Because DArTmarkers were scored as dominant, no attempt was madeto identify loci harboring heterogeneous or heterozygousalleles. Consistent 0/1 data matrices were used as inputfor genetic diversity and population structure analysis.NTSYSpc (version 2.0) analysis software was used toperform principal-coordinates analysis (PCoA) using agenetic similarity matrix based on the Jacard geneticsimilarity index (sij)[46]. The Jacard coefficient (sij) mea-sures the asymmetric information on binary variablesand is computed according to the following formula: sij= p/(p+q+r), where p = number of bands present inboth individuals (i and j), q = number of bands presentin i and absent in j, r = number of bands present j and

absent in i. Based on decomposition of any multidimen-sional distance metric, PCoA analysis is similar to themore familiar principal-components analysis (PCA),which is based on Euclidean coordinates. The NTSYSpcanalysis software was also used to construct anunweighted pair-group method with algorithmic mean(UPGMA) dendrogram.Linkage disequilibrium analysis was performed to

investigate differences between the two groups. Eachclassified group was defined as a “locus,” with the culti-vars (lines) in one group scored as “0” and those inanother group scored as “1.” Linkage disequilibrium(LD) between pairs of polymorphic loci was evaluatedusing the software package TASSEL1.9.4 (http://www.maizegenetics.net/). LD was estimated using the squaredallele frequency correlation (r2), which is a measurementof the correlation between a pair of variables [47].In addition, analysis of molecular variance (AMOVA)

was used to estimate the genetic structure amonggroups and subgroups of cultivars. This method workson a distance matrix between samples in order to mea-sure the genetic structure of the population fromwhich the samples are drawn. It was carried out usingARLEQUIN v3.11 [48] to estimate genetic variancecomponents and to partition the total variance withinand among subgroups and among groups. The signifi-cance of variance components was tested using 1000permutations. The fixation index (FST), which isa measure of population differentiation and geneticdistance, based on genetic polymorphism data, wascomputed.

Additional material

Additional file 1: Common wheat cultivars and lines in northernChina used in this study. Additional file provides information ofcultivars (lines), including its origin and pedigrees, cultivated in Chinesewheat region, and carrying or not 1RS/1BL translocation. In the table,symbols ‘+’ and ‘-’ indicate the presence and absence of 1RS/1BL,respectively.

AcknowledgementsThis work was supported by the National Basic Research Program of China(2009CB118300), the 863 program (2009AA101102, 2006AA10Z1B2) andGuizhou province governor’s project for outstanding science & technologyand education personnel ((2010)103).

Table 3 List of 1RS-specific ISBP markers

Marker Left primer Right primer Annealing temp. (°C)

ora013 TGTTATATGAGCGCGAACCA GCAGAAGTTGGGCGTGTACT 62

ora014 AACTCCGAATCGTTGGGATA CCGTCGTCCCAAAATAGTGT 62

ora015 GCCGTCGTCTTCCTGAATAG ACCAAGATGAGCACCAAACC 62

ora016 TCCGTCCCCGTCTCCGTC ATAAGCCGTGCAAGTCGCC 62

ora017 TGACAAATTGGTTCGCAAGGGG GCAGCCGTCCACAGACATATAG 62


of 11

http://www.triticarte.com.au

http://www.maizegenetics.net/

http://www.maizegenetics.net/

http://www.biomedcentral.com/content/supplementary/1471-2156-12-42-S1.XLS

Author details1The State Key Laboratory of Plant Cell and Chromosome Engineering,Institute of Genetics and Developmental Biology, Chinese Academy ofSciences, Beijing, China. 2Guizhou Institute of Dryland Crops, GuizhouAcademy of Agricultural Sciences, Guiyang, China. 3College of BiologicalSciences, China Agricultural University, Beijing, China. 4UMR INRA-UBPAmélioration et Santé des Plantes, Clermont-Ferrand Cedex 2, France.

Authors’ contributionsLZ carried out the molecular genetic studies, performed the statisticalanalysis and drafted the manuscript. DL and XG participated in the design ofthe study. JS carried out the field test. WY participated in the moleculargenetic studies. DW, SP and AZ contributed to revisions for the final draft.AZ conceived of the study, and participated in its design and coordination.All authors read and approved the final manuscript.

Received: 6 October 2010 Accepted: 11 May 2011Published: 11 May 2011

References1. FAO (Food and Agriculture Organization): [http://faostat.fao.org/].2. Lubbers EL, Gill KS, Cox TS, Gill BS: Variation of Molecular Markers among

Geographically Diverse Accessions of Triticum-Tauschii. Genome 1991,34:354-361.

3. Paull JG, Chalmers KJ, Karakousis A, Kretschmer JM, Manning S, Langridge P:Genetic diversity in Australian wheat varieties and breeding materialbased on RFLP data. Theor Appl Genet 1998, 96:435-446.

4. Joshi CP, Nguyen HT: RAPD (Random Amplified Polymorphic DNA)Analysis Based Intervarietal Genetic-Relationships among HexaploidWheats. Plant Science 1993, 93:95-103.

5. Lynch M, Milligan BG: Analysis of Population Genetic-Structure with RAPDMarkers. Molecular Ecology 1994, 3:91-99.

6. Roy JK, Lakshmikumaran MS, Balyan HS, Gupta PK: AFLP-based geneticdiversity and its comparison with diversity based on SSR, SAMPL, andphenotypic traits in bread wheat. Biochem Genet 2004, 42:43-59.

7. Akond MA, Watanabe N, Furuta Y: Exploration of genetic diversity amongXinjiang Triticum and Triticum polonicum by AFLP markers. J Appl Genet2007, 48:25-33.

8. Fu YB, Peterson GW, Yu JK, Gao L, Jia J, Richards KW: Impact of plantbreeding on genetic diversity of the Canadian hard red spring wheatgermplasm as revealed by EST-derived SSR markers. Theor Appl Genet2006, 112:1239-1247.

9. Reif JC, Zhang P, Dreisigacker S, Warburton ML, van Ginkel M, Hoisington D,Bohn M, Melchinger AE: Wheat genetic diversity trends duringdomestication and breeding. Theor Appl Genet 2005, 110:859-864.

10. Roussel V, Leisova L, Exbrayat F, Stehno Z, Balfourier F: SSR allelic diversitychanges in 480 European bread wheat varieties released from 1840 to2000. Theoretical and Applied Genetics 2005, 111:162-170.

11. Roder MS, Wendehake K, Korzun V, Bredemeijer G, Laborie D, Bertrand L,Isaac P, Rendell S, Jackson J, Cooke RJ, Vosman B, Ganal MW: Constructionand analysis of a microsatellite-based database of European wheatvarieties. Theor Appl Genet 2002, 106:67-73.

12. Huang Q, Borner A, Roder S, Ganal W: Assessing genetic diversity ofwheat (Triticum aestivum L.) germplasm using microsatellite markers.Theor Appl Genet 2002, 105:699-707.

13. Rabinovich SV: Importance of wheat-rye translocations for breedingmodern cultivars of Triticum aestivum L. (Reprinted from Wheat:Prospects for global improvement, 1998). Euphytica 1998,100:323-340.

14. Schlegel R, Korzun V: About the origin of 1RS.1BL wheat-rye chromosometranslocations from Germany. Plant Breeding 1997, 116:537-540.

15. Mago R, Miah H, Lawrence GJ, Wellings CR, Spielmeyer W, Bariana HS,McIntosh RA, Pryor AJ, Ellis JG: High-resolution mapping and mutationanalysis separate the rust resistance genes Sr31, Lr26 and Yr9 on theshort arm of rye chromosome 1. Theor Appl Genet 2005, 112:41-50.

16. Burnett CJ, Lorenz KJ, Carver BF: Effects of the 1B/1R translocation inwheat on composition and properties of grain and flour. Euphytica 1995,86:159-166.

17. Kim W, Johnson JW, Baenziger PS, Lukaszewski AJ, Gaines CS: Agronomiceffect of wheat-rye translocation carrying rye chromatin (1R) fromdifferent sources. Crop Science 2004, 44:1254-1258.

18. Johnson JM, Griffey CA, Harris CH: Comparative effects of 1BL/1RStranslocation in relation to protein composition and milling and bakingquality of soft red winter wheat. Cereal Chem 1999, 76:467-472.

19. Graybosch RA: Uneasy unions: Quality effects of rye chromatin transfersto wheat. J Cereal Sci 2001, 33:3-16.

20. Liu L, Zhou Y, Liu JJ, He ZH, Yang J: Effect of Allelic Variation at the Glu-1and Glu-3 Loci and Presence of 1BL/1RS T ranslocation on Pan Breadand Dry White Chinese Noodle Quality. Scientia Agricultura Sinica 2004,34:8.

21. Liu JJ, He ZH, Pena RJ, Zhao ZD: Effect of 1BL/1RS Translocation on GrainQuality and Noodle Quality in Bread Wheat. Acta Agronomica Sinica 2004,30:5.

22. Weng Y, Azhaguvel P, Devkota RN, Rudd JC: PCR-based markers fordetection of different sources of 1AL.1RS and 1BL.1RS wheat-ryetranslocations in wheat background. Plant Breeding 2007, 126:482-486.

23. Chai JF, Zhou RH, Jia JZ, Liu X: Development and application of a newcodominant PCR marker for detecting 1BL center dot 1RS wheat-ryechromosome translocations. Plant Breeding 2006, 125:302-304.

24. Tang HJ, Yin GH, Xia XC, Feng JJ, Qu YY, He ZH: Evaluation of MolecularMarkers Specific for 1BL·1RS Translocation and Characterization of 1RSChromosome in Wheat Varieties from Different Origins. Acta AgronomicaSinica 2009, 35:2107-2115.

25. Wenzl P, Carling J, Kudrna D, Jaccoud D, Huttner E, Kleinhofs A, Kilian A:Diversity Arrays Technology (DArT) for whole-genome profiling ofbarley. Proc Natl Acad Sci USA 2004, 101:9915-9920.

26. Semagn K, Bjornstad A, Skinnes H, Maroy AG, Tarkegne Y, William M:Distribution of DArT, AFLP, and SSR markers in a genetic linkage map ofa doubled-haploid hexaploid wheat population. Genome 2006,49:545-555.

27. Zhang LY, Marchand S, Tinker NA, Belzile F: Population structure andlinkage disequilibrium in barley assessed by DArT markers. Theor ApplGenet 2009, 119:43-52.

28. Crossa J, Burgueno J, Dreisigacker S, Vargas M, Herrera-Foessel SA,Lillemo M, Singh RP, Trethowan R, Warburton M, Franco J, Reynolds M,Crouch JH, Ortiz R: Association analysis of historical bread wheatgermplasm using additive genetic covariance of relatives andpopulation structure. Genetics 2007, 177:1889-1913.

29. Raman H, Stodart BJ, Cavanagh C, Mackay M, Morell M, Milgate A, Martin P:Molecular diversity and genetic structure of modern and traditionallandrace cultivars of wheat (Triticum aestivum L.). Crop Pasture Sci 2010,61:222-229.

30. Stodart BJ, Mackay MC, Raman H: Assessment of molecular diversity inlandraces of bread wheat (Triticum aestivum L.) held in an ex situcollection with Diversity Arrays Technology (DArTTM). Australian Journalof Agricultural Research 2007, 58:1174-1182.

31. White J, Law JR, MacKay I, Chalmers KJ, Smith JS, Kilian A, Powell W: Thegenetic diversity of UK, US and Australian cultivars of Triticum aestivummeasured by DArT markers and considered by genome. Theor Appl Genet2008, 116:439-453.

32. Jiang H, Pan X, Wu W: Space-time variance and Zoning AdvantageAnalysis of China wheat. Chinese Journal of Agricultural Resources andRegional Planning 2005, 26:39-42.

33. Zhou Y, He ZH, Zhang GS, Xia LQ, Cheng XM, Gao YC, Jin ZB, Yu GJ:Utilization of 1BL/1RS Translocation in Wheat Breeding in China. ActaAgronomica Sinica 2004, 30:5-9.

34. Zhang XY, Dong YC, You GX, Wang LF, Li P, Jia JZ: Allelic Variation of Glu-A1, Glu-B1 and Glu-D1 in chinese commercial in wheat varieties in thelast 50 years. Acta Agronomica Sinica 2001, 34:8-11.

35. Nei M, Li WH: Mathematical model for studying genetic variation interms of restriction endonucleases. Proc Natl Acad Sci USA 1979,76:5269-5273.

36. Tinker NA, Kilian A, Wight CP, Heller-Uszynska K, Wenzl P, Rines HW,Bjornstad A, Howarth CJ, Jannink JL, Anderson JM, Rossnagel BG,Stuthman DD, Sorrells ME, Jackson EW, Tuvesson S, Kolb FL, Olsson O,Federizzi LC, Carson ML, Ohm HW, Molnar SJ, Scoles GJ, Eckstein PE,Bonman JM, Ceplitis A, Langdon T: New DArT markers for oat provideenhanced map coverage and global germplasm characterization. BmcGenomics 2009, 10:39.

37. Roder MS, Plaschke J, Konig SU, Borner A, Sorrells ME, Tanksley SD,Ganal MW: Abundance, variability and chromosomal location ofmicrosatellites in wheat. Mol Gen Genet 1995, 246:327-333.


of 11

http://faostat.fao.org/

38. Guyomarc’h H, Sourdille P, Charmet G, Edwards J, Bernard M:Characterisation of polymorphic microsatellite markers from Aegilopstauschii and transferability to the D-genome of bread wheat. Theor ApplGenet 2002, 104:1164-1172.

39. Akbari M, Wenzl P, Caig V, Carling J, Xia L, Yang S, Uszynski G, Mohler V,Lehmensiek A, Kuchel H, Hayden MJ, Howes N, Sharp P, Vaughan P,Rathmell B, Huttner E, Kilian A: Diversity arrays technology (DArT) forhigh-throughput profiling of the hexaploid wheat genome. Theor ApplGenet 2006, 113:1409-1420.

40. Bartos J, Paux E, Kofler R, Havrankova M, Kopecky D, Suchankova P, Safar J,Simkova H, Town CD, Lelley T, Feuillet C, Doležel1 J: A first survey of therye (Secale cereale) genome composition through BAC end sequencingof the short arm of chromosome 1R. BMC Plant Biol 2008, 8:95.

41. Snape JW, Law CN, Parker BB, Worland AJ: Genetical analysis ofchromosome 5A of wheat and its influence on important agronomiccharacters. Theor Appl Genet 1985, 71:9-15.

42. Galiba G, Quarrie SA, Sutka J, Morgounov A, Snape JW: RFLP mapping ofthe vernalization (Vrn1) and frost resistance (Fr1) genes on chromosome5A of wheat. Theor Appl Genet 1995, 90:6-15.

43. Quarrie SA, Gulli M, Calestani C, Steed A, Marmiroli N: Location of a generegulating drought-induced abscisic acid production on the long arm ofchromosome 5A of wheat. Theor Appl Genet 1994, 89:7-18.

44. Botstein D, White RL, Skolnick M, Davis RW: Construction of a Genetic-Linkage Map in Man Using Restriction Fragment Length Polymorphisms.American Journal of Human Genetics 1980, 32:314-331.

45. Nei M: Molecular Evolutionary Genetics Columbia University Press; 1987.46. Jaccard P: Nouvelles recherches sur la distribution florale. Bull Soc Vand

Sci Nat 1908, 4:223-270.47. Hill WG, Robertson A: The effects of inbreeding at loci with heterozygote

advantage. Genetics 1968, 60:615-628.48. Excoffier L, Laval G, Schneider S: Arlequin (version 3.0): an integrated

software package for population genetics data analysis. Evol BioinformOnline 2005, 1:47-50.

doi:10.1186/1471-2156-12-42Cite this article as: Zhang et al.: Investigation of genetic diversity andpopulation structure of common wheat cultivars in northern Chinausing DArT markers. BMC Genetics 2011 12:42.

Submit your next manuscript to BioMed Centraland take full advantage of:

• Convenient online submission

• Thorough peer review

• No space constraints or color figure charges

• Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar

• Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit


of 11

RESEARCH ARTICLE Open Access Investigation of genetic ......The 1RS/1BL translocation is one of the...

Documents

Transcript of RESEARCH ARTICLE Open Access Investigation of genetic ......The 1RS/1BL translocation is one of the...