“Requirements for cleavage and function of the...
Transcript of “Requirements for cleavage and function of the...
“Requirements for cleavage and function of the
transmembrane chemokine fractalkine/CX3CL1”
Von der Fakultät für Mathematik, Informatik und Naturwissenschaften
der RWTH Aachen University zur Erlangung des akademischen Grades eines
Doktors der Naturwissenschaften
genehmigte Dissertation
vorgelegt von
Diplom-Biologe
Michael Andrzejewski
aus
Torun, Polen
Berichter:
Professor Dr. rer. nat. Andreas Ludwig
Universitätsprofessor Dr. rer. nat. Lothar Elling
Tag der mündlichen Prüfung: 21.12.2009
Diese Dissertation ist auf den Internetseiten der Hochschulbibliothek online verfügbar.
The results of this work were in part published in:
Schulte A, Schulz B, Andrzejewski MG, Hundhausen C, Mletzko S, Achilles J, Reiss K, Paliga K, Weber C, John SR, Ludwig A. Sequential processing of the transmembrane chemokines CX3CL1 and CXCL16 by alpha- and gamma-secretases. Biochem Biophys Res Commun. 2007 Jun 22;358(1):233-40.
Michael G. Andrzejewski, Franz M. Hess and Andreas Ludwig. Proteolytic shedding of the transmembrane Chemokine CX3CL1 involves multiple structural determinants. Wiener klinische Wochenschrift, ISSN 1434-6869, SpringerWienNewYork, Vol. 120, Supplement 1, 2008, p. 181
Michael G. Andrzejewski, Franz M. Hess and Andreas Ludwig. The intracellular C-terminus of CX3CL1 contributes to trafficking and shedding of the chemokine, but is not required for cell adhesion. European Journal of Immunology, ISSN 0014-280, Vol. 39, No. S1, 2009, p. 646
Table of contents I
TABLE OF CONTENTS
1 INTRODUCTION .....................................................................................................1
1.1 Mechanisms of inflammation ...............................................................................1
1.2 Chemokines and their receptors............................................................................4
1.2.1 Classification and structure of chemokines .....................................................4
1.2.2 Structure and signal transduction of chemokine receptors ..............................5
1.3 Transmembrane chemokines ................................................................................6
1.3.1 The transmembrane chemokine CX3CL1 .......................................................6
1.3.2 The function of CX3CL1-CX3CR1 interaction...............................................8
1.4 Proteolytic cleavage by ADAM proteins..............................................................9
1.4.1 The family of ADAM proteins ........................................................................9
1.4.2 ADAM10, ADAM17 and their substrates in inflammatory processes ..........11
1.4.3 Shedding of CX3CL1 by ADAM10 and ADAM17 ......................................12
1.5 Issues and aims ...................................................................................................14
2 MATERIALS AND METHODS............................................................................15
2.1 Chemicals and reagents ......................................................................................15
2.2 Molecular biology...............................................................................................15
2.2.1 RNA isolation and synthesis of cDNA ..........................................................15
2.2.2 Polymerase chain reaction .............................................................................16
2.2.3 Agarose gel electrophoresis and DNA-purification.......................................18
2.2.4 Topo-cloning reaction....................................................................................18
2.2.5 Digestion, ligation and precipitation of plasmid DNA ..................................19
2.2.6 Transformation of competent E. coli cells.....................................................19
2.2.7 Small and large scale isolation of plasmid DNA...........................................20
2.2.8 DNA sequencing............................................................................................21
2.3 Cell culture..........................................................................................................21
2.3.1 Cell lines ........................................................................................................21
2.3.2 Isolation of peripheral blood mononuclear cells and neutrophils..................22
2.3.3 Transient transfection of mammalian cell lines .............................................23
2.3.4 Generation of stable cell lines........................................................................23
2.3.5 Generation of lentiviral derived shRNA HEK293 knockdown system.........23
2.3.6 Detection of the surface expression by flow cytometry.................................24
II Table of contents
2.3.7 Immunofluorescence ..................................................................................... 26
2.3.8 Adhesion assay .............................................................................................. 27
2.3.9 Transmigration assay..................................................................................... 28
2.4 Protein chemistry................................................................................................ 29
2.4.1 Preparation of conditioned cell medium and cell lysates .............................. 29
2.4.2 Enzyme-linked Immuno-sorbant Assay (ELISA) ......................................... 30
2.4.3 The β-glucoronidase assay ............................................................................ 31
2.4.4 Shedding assay .............................................................................................. 31
2.4.5 Tandem protein purification.......................................................................... 32
2.4.6 Deglycosylation............................................................................................. 33
2.4.7 SDS-PAGE.................................................................................................... 34
2.4.8 Western blotting ............................................................................................ 35
2.5 Data illustrations and statistical analysis............................................................ 36
3 RESULTS ................................................................................................................ 38
3.1 Structural characterisation of mouse CX3CL1 .................................................. 38
3.1.1 Shedding of mouse CX3CL1 ........................................................................ 38
3.1.2 Structural determinants for shedding of mouse CX3CL1............................. 41
3.1.2.1 Cleavage sites for human CX3CL1 ............................................................ 41
3.1.2.2 Substitution of the cleavage region............................................................. 43
3.1.2.3 Substitution of the N-terminal region ......................................................... 45
3.1.2.4 Substitution and removal of the transmembrane and the C-terminal ............
region .......................................................................................................... 46
3.1.3 Generation and characterisation of HEK293 cells stably expressing wt and
truncated mCX3CL1 ........................................................................................ 55
3.2 The role of mouse CX3CL1 in adhesion and transmigration............................. 61
3.2.1 Adhesion of mouse CX3CL1 ........................................................................ 61
3.2.2 Transmigration of mouse CX3CL1............................................................... 62
4 DISCUSSION .......................................................................................................... 66
4.1 Characterisation of mouse CX3CL1 .................................................................. 66
4.2 Analysis the shedding and trafficking of mouse CX3CL1 ................................ 68
4.3 The cytoplasmic tail in the function of mouse CX3CL1 ................................... 73
5 CONCLUSIONS AND OUTLOOK...................................................................... 76
6 SUMMARY ............................................................................................................. 81
Table of contents III
7 REFERENCES ........................................................................................................83
8 ABBREVIATIONS..................................................................................................93
9 LIST OF FIGURES.................................................................................................97
10 SUPPLEMENTS......................................................................................................99
DECLARATION ...............................................................................................................108
ACKNOWLEDGEMENTS ..............................................................................................109
CURRICULUM VITAE ...................................................................................................110
Introduction 1
1 1 INTRODUCTION
1.1 Mechanisms of inflammation
The mammalian organism faces a lot of chemical and biological invaders such as viruses,
bacteria, fungi or even body own cancer like cells. The reaction of the organism against these
pathogens often results in a process called inflammation, which is characterised through signs
of heat (calor), pain (dolor), redness (rubor), swelling (tumor) and dysfunction (functio laesa).
Inflammation is a protective response of the immune system to remove injurious or infectious
agents. Acute inflammation can result in initiation of tissue repair or in a chronic
inflammatory process characterized by an active inflammation and simultaneously occurring
tissue repair and destruction.
Inflammatory reactions are controlled by the immune system, a network of organs, different
cells types and molecules. The immune system itself can be divided into two major branches
the innate and the adaptive system, which can be further subdivided into a humoral and a
cellular branch1. The adaptive immune system contains more specialised lymphoid cells,
whereas the innate system consist of several distinct components ranging from the barrier
functions of the epithelia as well as cells and molecules able to control or destroy pathogens
once they have overcome the epithelial defence. Within the first hours, defence is mediated by
resident macrophages within the tissue and subsequent recruitment of neutrophils and
monocytes. The monocytes then further differentiate into phagocytotic cells in order to kill
microbial invasive pathogens.
Molecules involved in the inflammatory reactions are classified into pro- and anti-
inflammatory molecules. These are soluble cytokines, like several interleukins (IL),
interferons (IFN), growth factors and chemotatic cytokines, also known as chemokines2-5.
Leukocyte recruitment to areas of inflammation
A crucial step in the process of inflammation is the recruitment of leukocytes from blood
vessel towards the inflamed tissue, a process known to occur in multi steps6-9 (Fig. 1-1). The
process starts with the selectin-mediated initial rolling of the leukocytes along the blood
vessel wall. These leukocytes are then activated upon binding of chemotatic cytokines
(chemokines) presented on the endothelium. This leads to firm adhesion characterised by
2 Chapter 1
binding of activated leukocytes via their integrins to cellular adhesion molecules. Finally,
transmigration of the leukocytes across the endothelial cell layer occurs, which is regulated by
several molecules of the tight junctions. This series of events can be observed for neutrophils,
lymphocytes and monocytes, although the molecules involved are different among the
leukocyte subpopulations.
Fig. 1-1: Leukocyte recruitment to inflamed tissue10 An initial contact of the leukocyte to the endothelium is mediated by binding of the endothelial selectins (E-, P-selectin) to sialyl-lewisX glycoproteins (PSGL-1) on leukocytes. The binding is reversible and therefore leading to the rolling of the leukocyte on the endothelium. Binding to chemokines presented by proteoglycans (HSPG) and binding of chemokine activated leukocyte integrins (LFA-1) to cellular adhesion molecules (VCAMs) lead to firm adhesion. Finally, transmigration of the leukocyte across the endothial cells is regulated by cellular junction molecules (VE-cadherin) towards the inflammatory stimulus.
The initial rolling and attaching of leukocytes to the endothelial cell layer is mediated by
binding of the selectins to their ligands. On inflamed endothelial cells P- or E-selectins are
upregulated by tumor necrosis factor (TNF)-α and interferon (IFN)-γ and bind to the sialyl-
lewisX glycosylated P-selectin glycoprotein ligand-1 (PSGL-1) expressed on neutrophils and
monocytes11-13. In contrast to E- and P-selectin, L-selectin is expressed on leukocytes and was
shown to be involved in the rolling14. The selectin-ligand binding is reversible due to the
weak binding affinity of the selectins to the sialyl-lewisx residues on PSGL-1 resulting in
further cell rolling onto the endothelial cell layer.
Leukocyte
Rolling ActivationFirm
adhesionTransmigration
Endothelium
E-selectinP-selectin
ICAMs
Chemokine &proteoglycan
Bloodstream
Erythrocyte
Smooth muscle cell
TissueVE-Cadherin
orJAMs
Chemokinereceptor
β2 integrin
PSGL-1
Inflammatory stimuli
Leukocyte
Rolling ActivationFirm
adhesionTransmigration
Endothelium
E-selectinP-selectin
ICAMs
Chemokine &proteoglycan
Bloodstream
Erythrocyte
Smooth muscle cell
TissueVE-Cadherin
orJAMs
Chemokinereceptor
β2 integrin
PSGL-1
Inflammatory stimuli
Introduction 3
After the initial rolling leukocytes are activated upon binding of chemokines presented by
endothelial cells via heparin sulphate proteoglycans (HSPG). These chemokines are cytokines
leading also to directional chemotatic migration of cells (chemotaxis) and are different for the
leukocyte subpopulations.
The activation of leukocytes by chemokines then leads to firm adhesion, which is
characterised by the interaction of cellular adhesion molecules, expressed on the endothelial
cells, with activated β1- and β2-integrins, expressed on leukocytes. Important integrins are the
lymphocyte function-associated antigen-1 (LFA-1) and the Mac-1 (CD11b/CD18) both
expressed on neutrophils and monocytes. The LFA-1 antigen interacts with the inter-cellular
adhesion molecule-2 (ICAM-2)15,16, whereas Mac-1 interacts with the intercellular adhesion
molecule-1 (ICAM-1)17-19 Additional interactions take place between the monocyte expressed
very late antigen-4 (VLA-4) and the vascular cell adhesion molecule-1 (VCAM-1)20,21.
The final step of the leukocyte recruitment process is known as transmigration. Within this
process leukocytes transmigrate across the activated endothelial cell layer towards a
chemoattractant or chemokine22,23. Additionally, it was shown, that depending on leukocyte-
subtype or tissue specificity, leukocytes can transmigrate through cellular tight junctions
(paracellular) or channels within the cell itself (transcellular)24. Various interactions of the
cellular junction molecules with molecules expressed by leukocytes have been described. For
the neutrophils homophilic interactions of the platelet-endothelial cell adhesion molecule-1
(PECAM-1, CD31) have been shown to be critical for crossing the cellular tight junctions25.
The monocyte transmigration was supposed to be regulated by PECAM-1 interactions25, by
interactions of the junctional adhesion molecules (JAM)-A and C and by CD9926-29. These
interactions for example can be homophilic in case of PECAM-1, CD99 or JAM-A or
heterophilic for example in case of LFA-1/JAM-A. PECAM-1, CD99 and JAM-A
interactions can occur between the leukocytes and the endothelial cells or between two
endothelial cells. Further molecules like the vascular endothelial (VE)-cadherin are also
reported to be involved in the vascular permeability and therefore in the regulation of the
transmigration process30,31.
4 Chapter 1
1.2 Chemokines and their receptors
1.2.1 Classification and structure of chemokines
More than 50 chemokines have already been described. They are cytokines directing
leukocytes to the area of inflammation via a chemotatic stimulus32,33. They are structurally
subdivided into four classes, depending on the N-terminal location of the first or first two
cysteine residues (Fig. 1-2).
Fig. 1-2: Schematic structure of chemokine classes Chemokines are classified into four groups depending on the location of the first or the first two N-terminal residues. There exists either as XC-, CC-, CXC- or CX3C-chemokine. The CX3C chemokine are the only transmembrane expressed member of this family, since the contain an chemokine domain, a mucin-like domain, a transmembrane region (TM) and a intracellular cytoplasmic tail (CT). The peptide chain of all chemokines is indicated in blue.
XC-chemokines contain only one cysteine residue. Members of this group are lymphotactin-
alpha (XCL1) and lymphotactin-beta (XCL2), whose receptor XCR1 is expressed on T-
lymphocytes and is therefore also responsible for their recruitment to the thymus34,35.
The second group consists of chemokines containing two adjacent cysteine residues, they are
called CC-chemokines. The group consists of at least 28 distinct chemokines. Members of
this family are the monocyte chemoattractant protein-1 or the chemokine CCL5 (RANTES,
regulated on activation normal T cell expressed)36,37.
The CXC-chemokines represent another group of so far 17 dintinct members, which are
characterised by an acid flanked by two cysteine residues (CXC). The best characterised
NH2
COOH
NH2
COOH
C
C
C
C C
C
C
CXNH2
COOH
C
C
NH2
COOH
CXXXC
C
C
XC chemokine CC chemokine CXC chemokine
CX3C chemokine
TM
CT
mucin-likedomain
NH2
COOH
NH2
COOH
C
C
C
C C
C
C
CXNH2
COOH
C
C
NH2
COOH
CXXXC
C
C
XC chemokine CC chemokine CXC chemokine
CX3C chemokine
TM
CT
mucin-likedomain
Introduction 5
member of this group is IL-8 (CXCL8) attracting neutrophils and monocytes38,39. It is induced
by proinflammatory cytokines IL-1, TNF-α and even by lipopolysaccharide (LPS)32.
The fourth group of chemokines, the CX3C-chemokines, consists of one member (fractalkine
(FKN), CX3CL1) and is characterised through three random amino acids flanked by one
cysteine residue on both sides.
In contrast to the structural classification, chemokines can additionally be classified according
to their function and physiology. They can be divided into pro-inflammatory (inducible) or
homeostatic (constitutive) chemokines or into dual chemokines, if they are acting in both
ways. Inducible chemokines normally act on monocytes, granulocytes and T-cells in order to
recruit cells to areas of inflammation or infection. In contrast, constitutive chemokines
normally act on leukocytes in absence of inflammation, for example in haematopoiesis in
order to regulate the trafficking of these leukocytes within primary (bone marrow and thymus)
and secondary (lymph nodes and peyer’s patches) lymphatic organs33,40.
Most of the chemokines are soluble proteins with a molecular weight of 8-10 kDa41. They
share high nucleic and amino acid homology and are structurally organised in a so called
Greek key shape structure, stabilised through disulfide bonds. Chemokines consist of a signal
peptide (20 amino acids), an N-terminal loop (N-loop), a single-turn helix (310-helix) and
three β-strands followed by an α-helix42.
1.2.2 Structure and signal transduction of chemokine receptors
The approximately 20 described chemokine receptors share the same nomenclature with the
chemokines, however, they are abbreviated with L (for ligand) and receptors with R (for
receptors). The XC-, CC-, CXC- and CX3C-chemokine receptors exclusively bind the
chemokine ligands of the analogous groups43-45. Many of these receptors are able to bind more
than one chemokine of this groups, which then can lead to different signalling events46.
The chemokine receptors exist as homo- and heterodimers with a size of approximately 40
kDa and belong to the class of G-protein coupled (GPCRs) receptors47. Structurally, these
type-I transmembrane proteins consist of seven transmembrane α-helices, which are
connected through three intra- and three extracellular hydrophilic loops.
The N-terminal loop is involved in ligand binding48, whereas the cytoplasmic C-terminal tail
contains serine and therione residues as potential phosphorylation sites, which are important
6 Chapter 1
for the regulation of the receptor activity49,50. The receptor activation is a cascade of
chemokine binding, conformational changes and G-protein activation. Further downstream
involved molecules are for example phospholipases C (PLC), phosphatidylinositol
bisphosphates (PIP2), inositol triphosphate (IP3) and proteinkinase C (PKC), which then can
activate MAP-Kinase cascades by phosphorylation leading to the activation of extracellular
signal-regulated kinases (ERK) or p3849,51.
1.3 Transmembrane chemokines
1.3.1 The transmembrane chemokine CX3CL1
Among the large family of chemokines, there is an exceptional member existing as a soluble
and as a membrane-associated form. This transmembrane CX3C-chemokine CX3CL1 is also
known as fractalkine52 or neurotactin53. The human CX3CL1 gene encods a protein of 397
amino acids and is located on chromosome 16q13, whereas the mouse gene encodes a protein
of 395 amino acids and is located on chromosome 8 46.0. Human and mouse CX3CL1 share
great sequence and structural homology. The schematic structure of human and mouse
CX3CL1 is shown in Fig. 1-3.
Fig. 1-3: Schematic structure of human and mouse CX3CL1 The domain structures [B], indicated by the starting amino acid, of human and mouse CX3CL1 and the structure of CX3CL1 within the membrane [B] are shown. Both transmembrane chemokines contain a signal peptide (light grey), an N-terminal chemokine domain (green), a highly glycosylated mucin-like stalk (dark grey), a transmembrane domain and a C-terminal cytoplamic tail (blue) containing a potential SH2-domain binding motif (YVLV).
signal peptidechemokine domainmucin-like stalk region
transmembrane domaincytoplasmic domain
1 25 101 342 363 397
YVLVhuman CX3CL1
1 25 101 340 361 395
YVLVmurine CX3CL1
A B
signal peptidechemokine domainmucin-like stalk region
transmembrane domaincytoplasmic domain
1 25 101 342 363 397
YVLVhuman CX3CL1
1 25 101 340 361 395
YVLVmurine CX3CL1
1 25 101 342 363 397
YVLVhuman CX3CL1
1 25 101 340 361 395
YVLVmurine CX3CL1
A B
Introduction 7
Both proteins contain a signal peptide (24 amino acids), an N-terminal CX3C-chemokine
domain (76 amino acids) attached to a highly o-glycosylated mucin-like stalk region (241
amino acids (human) / 239 amino acids (mice)), a transmembrane domain (21 amino acids)
and a C-terminal cytoplasmic tail (35 amino acids). This tail contains a potential tyrosine
phosphorylation site (YVLV) similar to other SH2-domain binding sites, predicted to bind
clathrin-coated pit associated cargo adaptor protein AP254. The mucin-like stalk was reported
to contain 17 degenerated mucin-like repeats with 26 potential O-glycosylations at serine and
threonine residues52,55,56.
The transmembrane chemokine CX3CL1 is expressed in the membrane, but also exists as a
soluble form consisting of the chemokine domain plus the mucin-like stalk (approximately 70
kDa)52,53.
According to the studies with epithelial cell lines, CX3CL1 is expressed in two cellular
compartments: on the cell membrane and in distinct subcellular compartments. Intracellular
CX3CL1 was associated with soluble N-ethylmaleimide factor attachment protein receptor
(SNARE) proteins like syntaxin-13 and VAMP-3, pointing towards SNARE-mediated rapid
recycling of CX3CL1 to and from the endomembrane storage compartments57.
CX3CL1 was reported to be expressed by various cells and tissues58. High levels of
constitutive and LPS-induced expressions were found in the brain53,59. Lower levels were
found in the heart, the lung, the kidney and the intestine52. As shown by in vitro studies
CX3CL1 is constitutively expressed on epithelial cells, but not on endothelial cells and not on
circulating peripheral blood mononuclear cells (PBMCs)52,53,60.
Several studies described the induction of CX3CL1 by various cytokines during inflammation
in different cell types. Endothelial cells for example upregulate CX3CL1 after TNF-α and IL-
1 or TNF-α and IFN-γ stimulation52,61. In airway smooth muscle cells CX3CL1 is also
upregulated by TNF-α and IFN-γ62, whereas in aortic smooth muscle cells CX3CL1
expression could be increased by TNF-α and IL-1β63,64. Fibroblasts express elevated levels of
CX3CL1 after combinatorial treatment with TNF-α and IL-865. Studies investigating a
potential negative effect of cytokines on CX3CL1 expression revealed that in endothelial cells
the soluble interleukin-6 receptor-α inhibits the expression CX3CL166 and that in airway
smooth muscle cells TGF-β treatment suppresses CX3CL1 expression effectively62. Thus,
CX3CL1 seems to be tightly regulated by pro-and anti-inflammatory cytokines.
8 Chapter 1
1.3.2 The function of CX3CL1-CX3CR1 interaction
CX3CR1 exclusively binds to CX3CL1. It was first described as a G-protein coupled receptor
and named CMKBRL or V2867,68. The gene contains 4 exons and is localised on the human
chromosome 3p21.3 and the mouse chromosome 9 F4. Like all chemokine receptors,
CX3CR1 is a G-protein coupled seven transmembrane-spanning domain receptor.
CX3CR1 is expressed on leukocytes like human monocytes69, T cells70, NK-cells71,72,
dendritic cells73 and throughout the brain on astrocytes and microglia53,74. The endogenous
CX3CR1 receptor expression can be increased/decreased by treatment of NK-cells and human
periphal blood mononuclear cells (PBMCs) with IL-2 and IL-1575-77.
CX3CL1 was thought to have two functions within the process of leukocyte recruitment. It
was shown that CX3CL1 expressed on the cell membrane mediates adhesion of cells carrying
the CX3CR1 receptor. On the other hand, it was shown that soluble CX3CL1 induces
chemotaxis. Studies, in which the chemokine domain or the mucin-like stalk region were
mutated, supported the assumption that CX3CL1 is involved in the adhesion of leukocytes.
Although the exchange of the CX3C-chemokine domain to that of IL-8, MCP-1 or RANTES
for example showed that adhesion was not disturbed and occurs to an equivalent extend
compared to the wt CX3CL1, the flow adhesion activity of the various chimera compared to
the wt CX3CL1 was, however, efficiently decreased. Binding studies of wt CX3CL1 to the
CX3CR1 receptor revealed a slower off-rate for wt CX3CL1 as for the chimeras, supporting
the previous findings of decreased flow adhesion. Interestingly, cells captured by CX3CL1
showed no rolling capacity, whereas cells captured by the IL-8 and MCP-1 chimeras
displayed the rolling78. Mutational studies on the chemokine domain revealed two residues at
position seven (lysine) and 47 (arginine) of the protein being differently associated with
adhesion and transmigration/chemotaxis. Both K7A and R47A showed a massive decrease in
the binding affinity to CX3CR1 and therefore a reduced firm adhesion of CX3CR1-
expressing cells under flow conditions79. The analysis of the mucin-like stalk, in which the
entire mucin-like stalk was changed by that of rod-like segments of E-selection resulted in
similar adhesion of PBMCs compared to the wt CX3CL1, indicating the importance of the
chemokine domain receptor interaction for the adhesion process80.
In vivo studies on human and mouse receptor CX3CR1 revealed that the receptor is involved
adhesion and transmigration71,81,82. The CX3CR1/CX3CL1 interaction occurs under
physiological flow conditions and is independent of the G-protein activation52,71,83,84. More
Introduction 9
recent studies , however, showed that Gi-protein signalling is associated with leukocytes85.
Studies with double CX3CR1-/- and ApoE-/- animals showed reduced lesion size due to
disordered macrophage accumulation86,87. In the brain of CX3CR1-/- animals microglial
neurotoxicity is increased compared to control animals due to enhanced neuronal cell loss88.
In CX3CR1-deficient mice reduced kidney fibrosis, reduced inflammation in the ischemia
reperfusion injury, as well as reduced clearance of enteroinvasive bacteria was observed89,90.
Genetic studies on CX3CR1 revealed the existents of two single nucleotide polymorphisms
(SNP) in the fourth exon of the gene91,92. The V249I-SNP and the T280M-SNP were
demonstrated to be associated with reduced risk of atherosclerotic cardiovascular diseases
(CVD), due to the reduced binding affinity of the I249 and M280 receptor variants to
CX3CL1 resulting in reduced of primary leukocytes93-95.
The role of the chemokine CX3CL1 during inflammatory processes was also investigated in
in vivo models. The first described in vivo study of the CX3CL1 knockout, however, showed
no influence of CX3CL1 in inflammatory models, contrarily to the previous data raised with
neutralising antibodies96. Studies of CX3CL1 in double knockout models with ApoE and
CCR2 deficient mice then revealed the atherogenic accomplishment of CX3CL1 in the
brachiocephalic artery97 and its capacity in the process of macrophage accumulation during
inflammation98. Increased CX3CL1 accumulation was also seen in atherosclerotic coronary
arteries within the intima, media and adventitia99. In the brain of CX3CL1 knockout mice a
reduced infarction size and a reduced mortality in the model of cerebral ischemia reperfusion
injury was described100. Due to the high expression of CX3CL1 in the lung, a possible
association of CX3CL1 with lung diseases was investigated. One worldwide advancing lung
disease is COPD (chronic obstructive pulmonary disease) a chronic airway inflammation,
which is mainly caused by cigarette smoking. Studies with mice chronically exposed to
cigarette smoke, showed increased CX3CL1 expression101.
1.4 Proteolytic cleavage by ADAM proteins
1.4.1 The family of ADAM proteins
The family of ADAM proteins (ADAM, “A Disintegrin and a Metalloproteinase”) contains
proteins with a size of 750-800 amino acids. Together with the snake venom
metalloproteinases (SVMPs) they are part of adamlysins, a subfamily of the metzincin
10 Chapter 1
enzyme superfamily. This metzincin superfamily also contains matrixins (matrix
metalloproteinases (MMPs)), serralysins and astacins102. A key feature of zinc-dependent
metzincins is the zinc-binding consensus sequence (HEXXH) and the proximal to the
catalytic core located conserved methionin residues (Met-turn)103,104.
Approximately 40 cDNA sequences of the ADAMs containing a conserved metalloproteinase
domain were identified in a broad spectrum of organisms. However, only approximately 15 of
those have the HEXXH zinc-binding sequence, indicating that not all ADAMs are
catalytically active105,106. Structurally one domain of the ADAMs is similar to disintegrins.
These disintegrins are snake venom polypeptides that are able to bind to platelet integrin
leading to inhibited platelet aggregation by integrin disruption107,108.
Most of the ADAMs are type-1 transmembrane glycoproteins and are characterised by an N-
terminal signal sequence, a prodomain, a metalloproteinase domain, a disintegrin domain, a
cyteine-rich region containing epidermal growth factor (EGF) repeats, a transmembrane
domain and a cytoplasmic tail109-111 (Fig. 1-4). Some ADAMs, however, are soluble proteins
containing thrombospondin type-I motif and are therefore named “a disintegrin and a
metalloproteinase with thrombospondin motifs” (ADAM-TS). This type of ADAMS can bind
proteins of the extracellular matrix112.
Fig. 1-4: The schematic structure of ADAM proteins113 A typical structure of a disintegrin and metalloproteinase is shown containing a cytoplasmic tail, a transmembrane region, a cysteine-rich region (yellow) with EGF-repeat (blue), a disintegrin domain (green) and a catalytic metalloproteinase domain (red). A prodomain (grey) is also attached to the catalytic domain leading to an inactive proteinase by binding to the His3-Zinc-Cysteine complex within the catalytic centre of the ADAM. The metalloproteinase is activated by a removal of the cysteine (“cysteine-switch”) from the complex or by an enzymatic elimination of the prodomain through furin convertases.
CR
DSMP PD
EGF
Zn++
His
His
His
S-Cys
CR
DSMP PD
EGF
Zn++ S-Cys
His
His
His
Zn++ S-Cys
His
His
His
Introduction 11
The extracellular domains (ectodomains) of several proteins like growth factors, cell adhesion
molecules, cytokines, receptors and other transmembrane proteins can be proteolytically
cleaved from the surface leading to the release of its soluble ectodomain105, a process termed
“ectodomain shedding”. The ectodomain shedding is performed in part by activated ADAM
proteins. ADAMs themselves can be activated by a “cysteine-switch” leading to the removal
of the intermolecular complex within catalytic centre of the ADAMs. The intermolecular
complex is formed by the interaction of a single cysteine residue of the prodomain and the
zinc atom of the metalloproteinase domain114. It is known that during the process of shedding
the ADAMs hydrolyse their substrates by transferring water molecules onto the metal ion
(Zn++). The cleavage sites for ADAMs are highly variable and consensus sequences could not
be defined115,116. ADAMs can also be activated by an enzymatic cleavage of the prodomain by
furin-peptidases117. Moreover, it was suggested that ADAM activation can be regulated by
(post)-transcriptional control, ADAM mRNA stability, cytosolic interaction or even cellular
and membrane distributions118.
ADAMs were found to be ubiquitously distributed within the mammalian organism110,111.
They were first described to be involved in the reproduction process, in particular in the
spermatogenesis and the fusion of the sperm and the egg and therefore named fertilin-α and -β
(ADAM1 and ADAM2)109,110,119. As already mentioned, the family of ADAM proteins
consist of about 15 catalytically active members. Examples are meltrin-γ (ADAM9),
kuzbanian (ADAM10), meltrin-α (ADAM12) or the tumor-necrosis factor-α (TNF-α)
converting enzyme (TACE, ADAM17). They were reported to be involved in the
development of the muscles, the bones, the brain and also in the development of inflammatory
processes120-126.
1.4.2 ADAM10, ADAM17 and their substrates in inflammatory processes
ADAM10 and ADAM17 are involved in many neuronal, tumor and inflammation associated
diseases127. In the central nervous system (CNS) ADAM10- and/or ADAM17-mediated
shedding of the amyloid precursor protein (APP) and the prion protein (PrP) leads to
neuroprotection128-132, whereas shedding-induced signalling of the receptor Notch increases
neurogenesis133,134.
In inflammatory processes, ADAM17 is involved in the shedding of the pro-inflammatory
cytokine TNF-α120,122 and its receptor TNFR135, which represents together with IL-1 and its
12 Chapter 1
receptor IL-1R one of the major pro-inflammatory cytokines/receptor pairs. The pro-
inflammatory IL-6 receptor (IL-6R) was also shown to be shed by ADAM17136. ADAM17
was furthermore described in the release of cell adhesion molecules like L-selectin137,138,
VCAM-1139,140 and also CX3CL1141,142.
ADAM10 was first isolated from myelin membranes of the brain143 and since then shown to
be involved in several inflammatory processes. For example ADAM10 releases the sialyl-
lewisX PSGL-1 ligand for E- and P-selectin from the surface of leukocytes144. Furthermore
ADAM10 was made responsible for the release of the vascular endothelial (VE)-cadherin
and the transmembrane chemokine CX3CL1145,146.
Several ADAM10- and ADAM17-mediated shedding events were identified by the use of the
dual-specific inhibitor for ADAM10 and ADAM17 (GW280264 (A10/17)) and the specific
inhibitor for ADAM10 (GI254023 (A10)), which block the catalytic centre within the
metalloproteinase domain. The dual-specific A10/17 inhibitor was reported to have an IC50
against ADAM17 of 8.0 nM and an IC50 of 11.5 nM against ADAM10, whereas the specific
A10 inhibitor was reported to have an IC50 against ADAM10 of 5.3 nM146.
1.4.3 Shedding of CX3CL1 by ADAM10 and ADAM17
The transmembrane chemokine CX3CL1 exists as a membrane-bound form and as a smaller
soluble forms presented as the CX3C-chemokine domain plus the mucin-like stalk
(approximately 70 kDa)52,53. Since the soluble forms of CX3CL1 were reported to be smaller
as the membrane-bound forms, a proteolytic cleavage process from the cell surface was
proposed. ADAM10 and ADAM17 were likely to be responsible for the release of soluble
CX3CL1.
In fact, studies showed that ADAM10 and ADAM17 are involved the process of CX3CL1
shedding. ADAM17 is involved in the PMA-induced shedding of CX3CL1141, whereas
ADAM10 is involved in the process of constitutive and ionomycin-induced shedding of
CX3CL1146, processes which were both pharmacologically targeted by the use of the specific
ADAM10 inhibitor (A10, GI254023) and the dual-specific ADAM10 and ADAM17
inhibitor (A10/17, GW280264) (Fig. 1-5).
Although an involvement of other proteinases in the cleavage of CX3CL1 can be assumed,
no specific proteinase was shown so far to be part of the CX3CL1 shedding127. As already
mentioned, CX3CL1 is shed from the cell surface proximal to the membrane by ADAM10
and by ADAM17. The di-argine (R-R) motif, located at amino acid position 2-3 distal from
Introduction 13
the membrane within the mucin-like stalk region of CX3CL1, was predicted to represent the
cleavage site52.
Fig. 1-5: Ectodomain shedding of CX3CL1 by ADAM10 and ADAM17 ADAM10 constutively cleaves CX3CL1 from the surface, whereas ADAM17 cleaves CX3CL1 from the surface by an induction of PMA. Cleavage within the mucin-like stalk of CX3CL1 occurs proximal to the membrane resulting in soluble forms of CX3CL1 and different C-terminal fragments (CTFs), which are then further degraded by the membrane associated secretases and the proteasome. This cleavage can be pharmacologically targeted by the high affinity hydroxamic acid inhibitors A10 (GI254023X) and A10/17 (GW280264X), which contain hydrogen, lower alkyl, lipophilic and heteroaryl substituents63.
The catalytic site of the ADAMs is located in the metalloproteinase domain, far distal from
the membrane. However, the process of shedding was described to be proximal to the
membrane, so that one can conclude that the structure of the ADAMs must be very flexible.
Indeed, current findings on the structural organisation of the protein support this view113.
Not only the structure of the ADAMs is important for the function as a proteinase,
moreover structural requirements and interaction with other molecules like tetraspanins are
addressed in current studies147,148.
ADAM10 (constitutive)ADAM17 (PMA-induced) CX3CL1
CX3C
MP
DS
CR
EGF
CX3C
soluble
CTFs
degradation
A10 (GI254023X) A10/17 (GW280264X)
ADAM10 (constitutive)ADAM17 (PMA-induced) CX3CL1
CX3C
MP
DS
CR
EGF
CX3C
soluble
CTFs
degradation
A10 (GI254023X) A10/17 (GW280264X)
14 Chapter 1
1.5 Issues and aims
The transmembrane chemokine CX3CL1 contributes to leukocyte adhesion and thereby
promotes the development of inflammatory diseases. Regulation of the CX3CL1 function, in
particular shedding, appears to be mainly controlled by ADAM10- and ADAM17-dependent
mechanisms. Up to date, it is not fully clear how ADAM10 and ADAM17 contribute to
CX3CL1 function. Molecular determinants within CX3CL1 that influence its shedding and
function remain to be clarified.
The goal of this thesis is to understand and to characterise the molecular determinants for the
CX3CL1 function, in particular shedding by ADAM10 and ADAM17, and to further
characterise the CX3CL1 function in processes of adhesion and transmigration. The results
should help to extend the current understandings of the inflammatory leukocyte recruitment.
To achieve this, the specific aims of this thesis are as follows.
1. Compare shedding of human and mouse CX3CL1 mediated by ADAM10
(and ADAM17).
2. Study the determinants within mouse CX3CL1 for ADAM10-mediated
shedding by generation of mouse CX3CL1 chimeras/variants, with
changes in the N-terminal region, the membrane proximal region and the
C-terminal region.
3. Analyse the functional properties of the mouse CX3CL1 chimeras/variants
in terms of cellular trafficking, surface expression, adhesion and
transmigration.
Materials and methods 15
2 2 MATERIALS AND METHODS
2.1 Chemicals and reagents
All reagents were of analytical grade and purchased from mayor chemical suppliers such as
Sigma-Aldrich Chemie GmbH (Steinheim, Germany), Carl Roth GmbH + Co. KG
(Karlsruhe, Germany) and Merck KGaA (Darmstadt, Germany) unless otherwise stated in the
text.
All enzymes described were mainly purchased from Fermentas GmbH (St. Leon-Rot,
Germany) and Invitrogen GmbH (Karlsruhe, Germany). Oligonucleotides were purchased
from MWG Biotech AG (Ebersberg, Germany), antibodies and cytokines mainly from R&D
Systems GmbH (Wiesbaden-Nordenstadt, Germany) and PeproTech GmbH (Hamburg,
Germany) and cell culture solutions mainly from PAA Laboratories GmbH (Pasching,
Austria). Expression vectors were made on the basis of the pcDNA3.1(+) from the Invitrogen
GmbH.
The specific ADAM10 (GI 254023X) inhibitor and dual-specific ADAM10 and ADAM17
inhibitor (GW 280264X) were kindly provided by Dr. Neil Brodway, GlaxoSmithKline
(Stevenage, UK). The inhibitors were described in US patents US 6 172 064, US 6 191 150,
and US 6 329 400.
Unless otherwise stated in the text methods were used according to Sambrook and Russell149.
2.2 Molecular biology
2.2.1 RNA isolation and synthesis of cDNA
Mice were sacrificed by cervical dislocation, the spleen was removed and snap frozen in
liquid nitrogen before being homogenized, separated and precipitated using a modified trizol
protocol from Invitrogen. Briefly, 1ml trizol reagent (Invitrogen GmbH) was mixed with 100
mg tissue and incubated at 15-30°C for 5 min. Then 200 µl of chloroform was added, mixed
vigorously and again incubated at 15-30°C for 5 min. The colourless upper aqueous phase
was taken and precipitated with 0.5 ml of 100% isopropanol by incubating for another 10 min
at 15-30°C and centrifugation at 16,100 g for 10 min at 4°C. The supernatant was discarded
16 Chapter 2
and the RNA-pellet was washed twice with 70% EtOH, air dried and dissolved in 10-20 µl of
ultra pure H2O. Total RNA concentrations were measured by reading the absorbance at 260
nm in a standard spectrometer (Nano-Drop NP-1000, Thermo Scientific, Waltham, USA).
1-5 µg of total spleen RNA was then subjected to DNase treatment by adding 1 µl of RNase-
free DNase in a 10 µl reaction mixture containing 1x reaction buffer with MgCl2 and ultra
pure H2O (aqua ad injectabilia, Delta Select GmbH, Pfullingen, Germany). After an
incubation at 37°C for 30 min, the enzymes were inactivated by an incubation for 5 min at
70°C. After a brief incubation on ice, the RNA was subjected to 1st strand cDNA synthesis
using the RevertAid™ first-strand cDNA-synthesis kit protocol (Fermentas GmbH). Briefly,
5 µl of DNase treated RNA and 0.5 µg oligo(dT)18 primer were solved in ultra pure H20 to a
volume of 12 µl, incubated for 5 min at 70°C and then briefly incubated on ice. 1 x reaction
buffer, 20 U RNase inhibitor and 2 µl of 10 mM dNTP mix were added. After an incubation
at 37°C for 5 min, 200 U of RevertAid™ M-MuLV reverse transcriptase was added to a final
volume of 20 µl and incubated at 42°C for 60 min. The reaction was heat-inactivated for 10
min at 70°C. Subsequently, 2 µl of this reaction mixture containing the reversely transcribed
cDNA was used as template in a standard PCR.
2.2.2 Polymerase chain reaction
The polymerase chain reaction (PCR) was performed in a standard thermocycler
(TProfessional) from Biometra biomedizische Analytik GmbH (Goettingen, Germany) for 3
min at 94°C, followed by 25-35 cycles of 30-60 s at 94°C, 30-45 s at 42-65°C, 45-60 s at 68
or 72°C and a final extension with 5 min at 72°C. The reaction mixture contained 1x PCR
buffer, 1-4 mM MgCl2 or MgSO4, 0.1-0.2 mM dATP, dCTP, dGTP and dTTP, 0.2 µM primer
sense, 0.2 µM primer antisense, 10-200 ng DNA template or 2 µl of cDNA template, 1-5 U
polymerase and was solved in ultra pure H2O to a final volume of 50µl. Taq-polymerase, Pfx-
platinum-polymerase or Pfu-polymerase) were used with specific 10x PCR buffers.
Primers
5mFKNEcoRI_fo 5‘ TCCGGAATTCGCCACCATGGCTCCCTC
GCCGCTC 3‘
Sense primer to amplify the mCX3CL1 or
mCX3CL1/CD4 genes
Materials and methods 17
3mFKNXhoI_re 5‘ ATCCGCTCGAGTCACACTGGCACC
AGGACGTATG 3‘
Antisense primer to amplify the mCX3CL1 gene
5hRANEcoRI_fo 5‘ GAATTCGCCACCATGAAGGTCTCC 3‘
Sense primer to amplify the CCL5 gene
3hRANAgeI_re 5‘ ACCGGTGCTCATCTCCAAAGAGTTGAT 3‘
Antisense primer to amplify the CCL5 gene
5mFKNAgeI_fo 5‘ ACCGGTGGCAAGTTTGAGAAGCGG 3‘
Sense primer to amplify the upper part of the mCX3CL1
stalk region
3mFKNPflAge_re 5‘ ACCGGTCCAAACGGTGGTGGAGATG 3‘
Antisense primer to amplify the upper part of the
mCX3CL1 stalk region
5mCD4EcoRI_fo 5‘ GAATTCGCCACCATGTGCCGAGCCATC 3‘
Sense primer to amplify the mCD4 gene
3mCD4XhoI_re 5‘ TCGAGTCAGATGAGATTATGGCTC
TTCTGCATC 3‘
Antisense primer to amplify the mCD4 gene
3mFKNCD4Bam_re 5‘ TGGATCCTGGAGTCCATC 3‘
Antisense primer to amplify the mCX3CL1/CD4 gene
5mFKNPfl_fo 5‘ ACCACCGTTTGGCCGAGT 3‘
Sense primer to amplify the truncated form of the
mCX3CL1 or mCX3CL1/CD4 genes
18 Chapter 2
3mFKNStopl_re 5‘ CTCGAGTCAGCTCTGGTAAGCAAACATGGC 3‘
Antisense primer to amplify the truncated form of the
mCX3CL1 or mCX3CL1/CD4 genes
2.2.3 Agarose gel electrophoresis and DNA-purification
The agarose gel electrophoresis was performed in an Agagel Mini or Midi-Wide apparatus
from Biometra biomedizinische Analytik GmbH for 30-60 min at 40-120 V (Power pac 200,
Bio-Rad, USA). DNA-samples were loaded with 6x DNA loading dye and 6x Orange DNA
loading dye (Fermentas GmbH) and separated in a 1-2% (w/v) standard agarose gel (Biozym
Scientific GmbH, Hess. Oldendorf, Germany) containing 1 µg/ml ethidium bromide in TAE
buffer (40 mM Tris-Acetate, 1 mM EDTA). The GeneRuler 1kb –or 100 bp DNA Ladder or
the MassRulerTM high -or low range DNA ladder (Fermentas GmbH) were used as standards.
Subsequently, the DNA of interest was excised from the gel using a scalpel blade and was
then purified using the NucleoSpin® extract II kit (Machete-Nagel GmbH & Co. KG, Dueren,
Germany) according to manufacturer’s instructions. Briefly, the gel slice was incubated at
50°C for 10 min in two volumes of solubilisation buffer, then applied to a column and
centrifuged for 1 min at 16,100 g. The column was washed once with 600 µl wash buffer.
Finally, the DNA was eluted in appropriate volume (25-50 µl) of ultra pure H20.
2.2.4 Topo-cloning reaction
The TOPO-cloning reaction was performed according to a modified TOPO TA Cloning®
protocol from Invitrogen GmbH. Therefore, 4 µl of fresh PCR-product was solved in ultra
pure H2O with 1 µl of salt solution and 0.5 µl of pCR®2.1-TOPO® vector solution to a final
volume of 6 µl. This mixture was incubated for 5 min at room temperature and then mixed
with E. coli TOP10 cells for transformation using the heat shock protocol in section 2.2.6.
The suspension containing the bacteria was spread out on LB-agar plates containing 50
µg/ml carbenicillin and 50 µl of 40 mg/ml X-gal dimethlyformamide-solution used for the
blue/white screening. The plates were incubated overnight at 37°C. White colonies were
picked and prepared according to section 2.2.7.
Materials and methods 19
2.2.5 Digestion, ligation and precipitation of plasmid DNA
Amounts of 50-200 ng DNA (analytical digest) or 1-2 µg DNA (preparative digest) were
digested in 1x specific enzyme buffer with 5-10 U or 20-50 U of enzyme in a 10 or 50 µl
reactions according to manufacturer’s manual. The digested DNA was visualised by agarose
gel electrophoresis.
The ligation reaction was carried out either at room temperature for 3 h or overnight at 14°C
in 1x ligation buffer. Exact 200 U T4 DNA ligase was added to a final volume of 10 µl. The
molar vector to insert ratio was approximately 1 to 3. In some cases, an in-gel ligation was
performed by excising a low melt agarose gel slice containing the DNA and melting it at
65°C, it was then kept at 37°C. The volume was estimated by measuring the weight of the
melted gel pieces. The concentration of DNA was estimated from the gel before the DNA
was cut out. Mixing of liquid gel, buffer and enzyme occurred at 37°C, before incubating at
14°C overnight or at room temperature for 3 h. Buffers, enzymes and molar ratios were used
as described above.
If necessary, the plasmid-DNA was purified using the NaCl-EtOH method. In brief, NaCl to
a final concentration of 0.5 M and 2-3 volumes of 100% absolute EtOH were mixed with the
DNA solution and placed at -20°C for at least 1 h. After centrifuging at 16,100 g at 4°C for
20 min, the DNA-pellet was washed twice in 1 ml of 70% EtOH, air dried and resuspended
in an appropriate volume of ultra pure H20.
2.2.6 Transformation of competent E. coli cells
E. coli TOP10 (Invitrogen GmbH) were cultured at 37°C in LB medium using 50 µg/ml
carbenicillin as an ampicillin analogue for pcDNA3.1 based vectors or 50 µg/ml kanamycin
for pEGFP based vectors. For long term storage, the cell pellet was resuspended in LB
medium containing ampicillin or kanamycin with 25-50% (v/v) glycerol and kept at -70°C.
The cells were transformed according to the manufacturer’s protocol. Briefly, 50 µl aliquots
were thawed on ice, 50-200 µg of DNA solved in water volumes of 2-5 µl was added and
carefully mixed and then incubated on ice for 15-30 min. After a heat shock incubation at
42°C for 20-30 s, bacteria were returned to ice for 5 min and then grown in pre-warmed LB
medium with shaking (200 rpm) at 37°C for 60 min. 100 µl of bacteria suspension was
spread out on a petri dish containing LB medium with 1.5% (w/v) agar and appropriate
20 Chapter 2
antibiotics and then incubated at 37°C overnight. Single colonies were picked and inoculated
in 5 ml LB medium containing appropriate antibiotics overnight with shaking (200 rpm) at
37°C. Following this, a small and later a large-scale isolation of plasmid DNA was
performed.
LB medium
10 mg/ml NaCl
10 mg/ml Tryptone
5 mg/ml Yeast extract (ICN Biochemical, Inc., Cleveland, USA)
2.2.7 Small and large scale isolation of plasmid DNA
The Macherey-Nagel NucleoSpin® Plasmid Kit was used to isolate plasmid DNA from
bacteria in a small volume according to the manufacturer’s instructions. In brief, overnight
cultures were centrifuged at 16,100 g. The cell pellet was then resuspended in 250 µl
resuspending buffer, lysed in 250 µl lysis buffer and neutralised with 300 µl neutralisation
buffer. After centrifugation at 16,100 g for 10 min the supernatant was applied to a column
and centrifuged for 1 min at 16,100 g. After washing the column with 500 µl wash buffer
once, the DNA was eluted in appropriate volume of ultra pure H20.
To prepare larger amounts of highly pure plasmid DNA the Macherey-Nagel NucleoBond®
PC 500 plasmid kit was used according to the manufacturer’s instructions. Briefly, 200 ml of
an overnight culture were centrifuged at 4°C for 15 min at 6,000 g in a standard
ultracentrifuge (AvantiTM J-25, Beckmann Coulter GmbH, Krefeld, Germany) using a JLA-
10.500 rotor. The cell pellet was resuspended in 12 ml resuspending buffer, lysed in 12 ml
lysis buffer and neutralized with 12 ml of neutralisation buffer. After removing bacterial cell
debris by filtering, the DNA containing solution was applied to an AX 500 column. After
washing it twice with 18 ml washing buffer the plasmid DNA was eluted from the column
with 15 ml elution buffer. The plasmid DNA was precipitated with 11 ml of 100%
isopropanol and centrifuged for 30 min at 11,000 g in a JS-13.1 rotor. After decanting the
supernatant the DNA pellet was resuspended in 500 µl ultra pure H20. If necessary, the DNA
was precipitated with the NaCl-ethanol method. Briefly, the DNA was precipitated with a
final of 0.5 M NaCL and two volumes of EtOH for 30 min at -20°C. The solution was then
centrifuged at 16,100 g for 10 min at 4°C before washed with 70% EtOH and again
Materials and methods 21
centrifuged. The DNA pellet was air dried and dissolved in an appropriate volume of ultra
pure H20.
Plasmid concentrations were estimated by measuring the absorbance at 260 nm in a standard
spectrometer (Nano-Drop NP-1000). The purity was estimated by reading the absorbance at
280 nm and calculating the ratio of OD260 to OD280.
2.2.8 DNA sequencing
The sequencing reactions were performed by MWG Biotech AG using primers binding the
T7 promotor and BGH reserve priming sites within the pcDNA3.1(+) vector or primers
binding the M13 forward or reverse priming sites within the pCR®2.1-TOPO® vector.
2.3 Cell culture
2.3.1 Cell lines
Cells were maintained in exponential growth in 10 cm culture dishes, TS-25 or TS-75 culture
flasks as a monolayer in a humidified 10% CO2 atmosphere incubator (APT.lineTM CB 150
or 250, BINDER GmbH, Tuttlingen, Germany ) at 37°C. The human embryonic kidney 293
cell lines (HEK293, # ACC 305 & HEK293T, # ACC 635, DSMZ, Braunschweig, Germany)
were grown in complete DMEM, whereas the human urinary bladder carcinoma cell line
(ECV304, # ACC 310) was grown in complete M199 medium. Stably transfected cell lines
were additionally maintained in medium containing 1 mg/ml G418 sulfate (Calbiochem, San
Diego, USA). All HEK293 and ECV304 based cells lines were passaged by washing once
with Dulbecco's PBS (without Ca & Mg) and using trypsin/EDTA for 5 min for cell
detachment. For long term storage, cell pellets were resuspended in freezing medium, frozen
for 24-48 h at -80°C and then stored in liquid nitrogen.
Freezing medium
40% (v/v) complete DMEM or M199
10% (v/v) DMSO
50% (v/v) Fetal bovine serum "GOLD"
22 Chapter 2
Complete DMEM
10% (v/v) Fetal bovine serum "GOLD"
100 U/ml Penicillin
100 µg/ml Streptomycin
in DMEM high Glucose (with L-Glutamine)
Complete M199
10% (v/v) Fetal bovine serum "GOLD"
100 U/ml Penicillin
100 µg/ml Streptomycin
in Medium 199 with Earle's Salts (with L-Glutamine)
2.3.2 Isolation of peripheral blood mononuclear cells and neutrophils
Human peripheral blood was supplied by healthy male and female donors. If not otherwise
stated in the text, the total isolation procedure was performed at room temperature. 2 ml of
3.1% (w/v) sodiumcitrate-2 hydrate (Eifelfango®, J. Graf Metternich GmbH & Co. KG, Bad
Neuenahr-Ahrweiler, Germany) were immediately added to approximately 23 ml blood and
then mixed with equal amounts of Dulbecco's PBS (without Ca & Mg). 50 ml of this solution
were carefully placed onto 30 ml of 1.077 g/ml human pancoll (PAN-Biotech GmbH,
Aidenbach, Germany) in two 50 ml tubes and centrifuged for 35 min at 400 g without
breaking force resulting in fractions of erythrocytes, neutrophils, pancoll solution, peripheral
blood mononuclear cells (PBMC) and blood plasma.
After removal of the blood plasma, the PBMC fraction was collected, washed twice with 20-
30 ml Dulbecco's PBS (without Ca & Mg) using 400 g for 5 min before finally being
resuspended in 0.2% (w/v) BSA in serum-free RPMI medium to a concentration of 2x 106
cells / ml.
The neutrophil fraction was also collected after further removal of the pancoll solution.
Contaminating erythrocytes were lysed by adding 5-10 ml erythrocyte-lysisbuffer. The cells
were washed with 20-30 ml of Dulbecco's PBS using 400 g for 5 min until the cell pellet
remain clear (erythrocyte free). The neutrophils (2x 106 / ml) were then resuspended in 0.2%
(w/v) BSA in serum-free RPMI 1640 medium (with L-glutamine).
Materials and methods 23
Erythrocyte-lysisbuffer
155 mM NH4Cl
1 mM KHCO3
137 µM EDTA
2.3.3 Transient transfection of mammalian cell lines
Lipofectamine™ 2000 transfection reagent (Invitrogen GmbH) was used to transfect cells
according to the manufacturer’s instructions. Briefly, cells were grown in complete medium
overnight until they reached 50-70% confluence. Transfection reagent was carefully diluted
in 100 µl serum-free medium and incubated for 5 min at room temperature before it was
dropped onto the DNA and incubated for 20 min. The mixture was added to the cells, which
prior received serum-free medium. After 24 h, the medium was changed to complete medium
and cells were grown for further 24 h. The ratio of transfection reagent to DNA was 3:1.
2.3.4 Generation of stable cell lines
Cells were transiently transfected for 48 h according to section 2.3.2 before the medium was
replaced by complete medium containing 1 mg/ml G418 sulfate for the selection of
transfected cells. The medium and selection reagent was changed every two days for 2-3
weeks. After this period the cells were rinsed off with trypsin/EDTA, transferred to a 96 well
plate in a dilution of one cell per well and grown for 1-2 weeks. A pre-screening of the cells
for expression of the transfected proteins was performed by ELISA and the final selection of
the cell clones was done by using flow cytometry according to sections 2.4.2 and 2.3.6.
2.3.5 Generation of lentiviral derived shRNA HEK293 knockdown system
For generating specific transcriptional knockdown for human ADAM10 and ADAM17, a
lentiviral derived expression systems was applied using short-hairpin RNA (shRNA)
sequences for ADAM10 and ADAM17 according to the Laboratory of Virology and
Genetics (Ecole Polytechnique Fédérale de Lausanne, Prof. Didier Trono) with the help of
the AG Ludwig lab member F.M. Hess. The shRNA targeting sequences for ADAM10 (5’-
24 Chapter 2
GACATTTCAACCTACGAAT-3’) were annealing at position 650-668 of the ADAM10
mRNA, whereas the targeting sequences for ADAM17 (5’-AGGAAAGCCCTGTACAGTA-
3’) were annealing at position 2061-2079 of the ADAM17 mRNA. The following sequence
5’-GCGTCACATCAATTGCCGT-3’ served as scrambled control. To generate the shRNA a
9-nucleotide noncomplementary spacer sequence (TTCAAGAGA) was used for all
sequences. The shRNA sequences, supplied from MWG Biotech (Ebersberg, Germany) were
inserted into the lentiviral expression vector pLVTHM upon MluI and ClaI restriction
enzymes digest and screened using EcoRI and ClaI and subsequently verified by sequencing.
To produce virus with the target vector pLVTHM containing the shRNA sequences
HEK293T cells were seeded onto a 10 cm cell culture dish for one day (1.5x 106 per plate)
and then transfected using the jetPEI transfection reagent (PEQLAB Biotechnologie GmbH,
Erlangen, Germany). Thereby, 10 µl of jetPEITM reagent was used with 250 µl of 150 mM
Chlorure Sodium Solution and mixed with 2.5 µg of target vector pLVTHM, 0.9 µg of the
pMD2.G envelope vector and 1.6 µg of psPAX2 packaging vector and incubated for 15 min.
The mixture was applied to the HEK293T cells. The medium was changed after 4 h, 1 day
and 2 days before the supernatant was harvested on day 3 by centrifugation for 5 min at 500
g. To remove the cell debris subsequent filtering of the supernatant through a 0.22 µm filter
was applied. Subsequently hexadimethrine bromide (Sigma-Aldrich GmbH) was added to a
final of 8 µg/ml.
The HEK293 cells stable expressing the mCX3CL1 were then seeded onto a 6-well plate (1x
105 / well / 2ml). The following day they were transduced with the 1 ml of corresponding
supernatant containing the viruses. HEK293 cells were re-infected after 48 h and left
untreated for further 48 h. Surface expression of ADAM10 was then analysed by flow
cytometry.
2.3.6 Detection of the surface expression by flow cytometry
Cells were harvested using trypsin/EDTA or accutase. Unless otherwise stated the total
protocol was performed at 4°C. 5x105 cells were stained for 30 min in 50 µl flow cytometry
buffer using 1 µg/ml of the first antibody of interest or of the isotype control. A human
CX3CL1-Fc construct was also used for detection as a control of the surface expression.
Human CX3CL1 binds the mouse receptor CX3CR1 and can then be itself detected by
antibodies against the Fc-tail. In this case, conditioned medium of HEK293 cells expressing
Materials and methods 25
the CX3CL1-Fc construct was used as a positive control and the medium of untransfected
HEK293 cells as negative control. Both media were diluted 1 to 10 in flow cytometry buffer
and incubated for 20 min with the respective antibody. Cells were then washed once using
500 µl flow cytometry buffer and centrifuged at 1,000 g for 5 min. The appropriate
secondary antibody was then applied according to manufacturer’s instructions for further 30
min. Cells were washed 3 times and fixed in PBS with 1% (w/v) PFA. The analysis of the
stained cells was performed in either a Guava EasyCyte mini flow cytometer (Millipore,
Billerica, USA) or a FACSCalibur flow cytometer (BD Biosciences). Data were analysed
using the WinMDI software (WinMDI version 2.9, Copyright© 1993-2000 Joseph Trotter) or
the FlowJo software (FlowJo flow cytometry analysis software version 7.2.5, Tree Star,
Inc.1997-2009) and either shown by dot plot or histogram.
Flow cytometry buffer
0.2% (w/v) BSA
137 mM NaCl
2.7 mM KCl
10 mM Na2HPO4
2 mM KH2PO4
Antibodies and Sera
hCX3CL1-Fc 10x conditioned medium of HEK293 cells expressing
the CX3CL1-Fc construct for 24 h, diluted 1 to 10
control-Fc 10x conditioned medium of untransfected HEK293
cells for 24 h, diluted 1 to 10
α-mCX3CL1 goat IgG anti-mouse CX3CL1 antibody, #AF472,
R&D Systems GmbH, Germany, used at 1 µg/ml
goat IgG normal goat IgG isotope antibody, #AB-108-C, R&D
Systems GmbH, Germany , used at 1 µg/ml
26 Chapter 2
α-hA10 mouse IgG2B anti-human ADAM10 ectodomain
antibody, #MAB1427, R&D Systems GmbH,
Germany, used at 1 µg/ml
mouse IgG2B mouse IgG2B isotype antibody, #MAB004, R&D
Systems GmbH, Germany, used at 1 µg/ml
α-hCX3CR1-PE R-phycoerythrin(PE)-conjugated rat IgG2b anti-
human CX3CR1 antibody, #D070-5, MBL
International, Woburn, USA, used at 1 µg/ml
rat IgG2b-PE R-phycoerythrin(PE)-conjugated rat IgG2b kappa
isotype antibody, #ab18537, Abcam Inc., Cambridge,
USA, used at 1 µg/ml
α-goat FITC Fluoresceinisothiocyanat(FITC)-conjugated rabbit
anti-goat IgG antibody, #F7367, Sigma-Aldrich
GmbH, diluted 1 to 200
α-hFc PE R-phycoerythrin(PE)-conjugated goat F(ab') 2
Fragments anti-human IgG Fc γ-fragment , #109-116-
170, Jackson ImmunoResearch Laboratories Europe
Ltd., Suffolk, UK, used at 2 µg/ml
α-mouse APC Allophycocyanin-conjugated goat anti-mouse IgG1-3
antibody, #115-135-164, Jackson ImmunoResearch
Laboratories Europe Ltd., Suffolk, UK, used at 5
µg/ml
2.3.7 Immunofluorescence
15 x 15 mm cover slips were coated with 0.01% (w/v) poly-L-lysine in ultra pure H20 for 15
min at room temperature, washed twice with ultra pure H20 and air dried for approximately
Materials and methods 27
60 min before being transferred into 12-well cell culture plates. The wt HEK293 cells were
seeded using 5x 104 cells per 500 µl. Liposomal transfection was carried out after cells
reached 50% confluence. All following steps were carried out at room temperature. Cells
were washed twice in PBS and fixed in 4% (w/v) paraformaldehyde-PBS for 15 min. Free
aldehyde groups were quenched with 50 mM NH4Cl in PBS for 10 min. Cells were
permeabilised in 1% (v/v) Triton X in PBS for 4 min and blocked in 5% FCS (v/v) in PBS
for 30 min. The cells were then stained with 4µg/ml of primary antibody diluted in 5% FCS
(v/v) in PBS for 30 min, washed three times with PBS and incubated with the secondary
antibody diluted in PBS with 2.5% FCS (v/v) for a further 30 min. If more then one primary
antibody was used, cells were stained sequentially. Cells were then washed four times in
PBS. After this, cells were washed again with PBS for 15 min. Finally, they were briefly
washed in MilliQ® H20, before being mounted on microscope slides in mowiol. For storage
at 4°C for more than one week, the edges were covered with nail polish. The cell proteins
were visualised using the LSM 510 confocal laser scanning microscope (Carl Zeiss AG,
Oberkochen, Germany) at the Institute for Biochemistry and Molecular Biology (Laboratory
of Cytokine Signal Transduction, Prof. Dr. Gerhard Mueller-Newen).
Antibodies
α-mCX3CL1 goat IgG anti-mouse CX3CL1 antibody, #AF472,
R&D Systems GmbH, used at 5 µg/ml
α-goat 488 Alexa Fluor® 488-conjugated donkey anti-goat IgG
antibody, # A-11055, Invitrogen GmbH, used at 10
µg/ml
2.3.8 Adhesion assay
This static one cell adhesion assay was performed in a Nunc MaxiSorbTM flat-bottom 96-well
plate (eBioscience, Ltd., Hatfield, UK). The plate was coated with the rat α-mCX3CL1
antibody diluted in PBS at room temperature. After 24 h free antibodies were removed and
the plate was washed twice with PBS. After blocking in 2% BSA/PBS for 2 h, the plate was
washed again two times with PBS. HEK293 cells were harvested using trypsin/EDTA and
placed onto the antibody coated plate with a concentration of 1-2x 105 cells per well. Cells
28 Chapter 2
were sedimented onto the plates by centrifugation with 1,000 g for 1 min and incubated for 5
min in a humidified 10% CO2 atmosphere incubator at 37°C.
Unbound cells were washed away with pre-warmed PBS followed by four additional
washing steps. The number of the cells bound prior to the washing and after the various wash
steps was estimated using the method for detection of the endogenous β-glucoronidase
according to section 2.3.3. To correlate β-glucoronidase activity with cell numbers a standard
curve starting with 1x 106 cells per well in eight 1 to 2 dilution steps was performed.
Antibody
rat α-mCX3CL1 rat IgG2A anti-mouse CX3CL1 antibody,
#MAB571, R&D Systems GmbH, used at 4 µg/ml
2.3.9 Transmigration assay
ECV304 cells (2-3x 104 cells / well) and HEK293 cells (3-4x 104 cells / well) were seeded
onto 24-well polycarbonate-membrane transwell-filters (Vitaris AG, Baar, Germany) with a
pore size of 5 µm for 2 days until they reached 100% confluence. Cells were carefully
washed once with 100 µl of Dulbecco's PBS before 2x 105 fresh isolated PBMCs or
neutrophils were added to the upper chamber of the Transwell system. The lower chamber
contained 500 µl of serum-free RPMI medium with 0.2% BSA containing different
chemotactic stimuli like 2.5 nM human IL-8, 6 nM human CCL2 (MCP-1) or 12 nm human
CX3CL1. Neutrophils were allowed to transmigrate towards the lower chamber for 30-45
min, whereas PBMCs were allowed to transmigrate for 2-3 h. The medium of the lower
chambers containing the transmigrated cells was then divided in equal volumes of 250 µl.
The cells were then centrifuged at 1,000 g for 5 min, the supernatant was removed and the
cell pellets were resuspended in 100 µl Dulbecco's PBS. By measuring the endogenous β-
glucoronidase activity (see section 2.4.3) the number of transmigrated cells in this 100 µl was
estimated and extrapolated to 500 µl. To be able to correlate endogenous β-glucoronidase
activity to cell numbers a standard curve starting at 2x 106 cells per well in escalating steps of
1 to 2 dilution was performed.
Materials and methods 29
2.4 Protein chemistry
2.4.1 Preparation of conditioned cell medium and cell lysates
To obtain conditioned cell medium containing soluble proteins, serum-free medium was
added to HEK293 cell for 24 h, removed and mixed with complete protease inhibitor cocktail
(Roche Diagnostics GmbH, Mannheim, Germany) according to the instructions. The cell
medium was then centrifuged at 16,100 g for at least 10 min before the supernatant was
placed into a fresh tube. If used for Western blotting, the supernatant was then concentrated
5-10 times using the Vivaspin 500 centrifugal filters (Sartorius Stedim Biotech S.A.,
Aubagne Cedex, France) with a molecular weight cut off of 3, 5 or 10 kDa.
For the preparation of the cell lysates, HEK293 cells were harvested from the plates by
rinsing them off with ice cold PBS, ECV304 cells were rinsed off by using trypsin/EDTA.
Cells were centrifuged at 1,000 g for 5 min at 4°C. Subsequently the cell pellet was lysed in
lysis buffer by incubation on ice for 10-15 min. Cellular debris and supernatant containing
proteins were separated by centrifugation for 10 min. The supernatant was transferred to a
fresh tube and stored at -20°C.
Protein amounts were estimated by using the DC protein assay (Bio-Rad Laboratories
GmbH, Munich, Germany) according to the manufacturer’s instructions. The absorbance of
the samples was measured in a GENios microplate reader at 562 nm.
Lysis buffer
137 mM NaCl
2.7 mM KCl
10 mM Na2HPO4
2 mM KH2PO4
1% (v/v) Triton X-100
1x complete protease inhibitor cocktail
30 Chapter 2
2.4.2 Enzyme-linked Immuno-sorbant Assay (ELISA)
The mouse CX3CL1 ELISA was performed using the DuoSet ELISA Kit (R&D Systems
GmbH) according to the manufacturer’s instructions. The human CX3CL1 and the human
CCL5 (RANTES) ELISA was performed using antibodies as indicated below.
All following steps were performed at room temperature. Samples, standards and antibody
were diluted in 2% BSA/PBS-N-05 unless stated in the text. In brief, 2-5 µg/ml of capture
antibody was coated to a Nunc MaxiSorbTM flat-bottom 96-well plate overnight in PBS. The
plate was blocked in 2% BSA/PBS-N-05 for 1-2 h before the samples and corresponding
controls in different dilutions were incubated on the plate also for 1-2 h. Plates were washed
three times with PBS-N. Following this, 200-400 ng/ml of detection antibody was added to
the plate for another 1-2 h. Before the Streptavidin-HRP was applied for 30 min, the plates
were washed again three times with PBS-N-05. Substrate solution was added to the plate for
5-15 min and the reaction was stopped with the same volumes of 2 N H2SO4. The optical
density was measured in a GENios microplate reader at 450 nm and corrected by subtraction
of the optical density at 550 nm.
PBS-N-05
0.05% (v/v) Tween 20
137 mM NaCl
2.7 mM KCl
10 mM Na2HPO4
2 mM KH2PO4
Antibodies
mFKN ELISA DuoSet ELISA Development Kit (# DY472)
α-hCX3CL1 mouse IgG1 anti-human CX3CL1 capture antibody,
#MAB365, R&D Systems GmbH, used at 3 µg/ml
α-hCX3CL1-biotin biotinylated goat IgG anti-human CX3CL1 detection
antibody, #BAF365 R&D Systems GmbH, used at
300 ng/ml
Materials and methods 31
α-hRANTES mouse IgG1 anti-human CCL5 capture antibody,
#MAB678, R&D Systems GmbH, used at 4 µg/ml
α-hRANTES-biotin biotinylated goat IgG anti-human CCL5 detection
antibody, #BAF278, R&D Systems GmbH, used at
400 ng/ml
2.4.3 The β-glucoronidase assay
Cell numbers were indirectly measured using p-nitropheny-β-D-glucoronide as a substrate,
which is cleaved by the β-glucuronidase located in the lysosomes of the cells. In brief, cells
were lysed in 100 µl of 0.1% Triton in PBS for 5 min, 100 µl substrate solution containing p-
nitropheny-β-D-glucoronide was added and incubated overnight at room temperature. The
reaction was stopped by addition of 100 µl 0.4 M glycin, pH 10.3. The extinction of the cell
lysates was measured in a GENios microplate reader at 405 nm. To be able to correlate
endogenous β-glucoronidase activity to cell numbers a standard curve was generated by
serial dilutions (1 to 2) of a cell suspension, previously defined by counting in a
haemocytometer.
Substrate solution
0.1 M Na-acetate, pH 4
10 µM p-nitropheny-β-D-glucoronid (Calbiochem, USA)
2.4.4 Shedding assay
Shedding assays were performed in culture plates with 5x 105 cells per 6-well or 1x 105 cells
per 24-well. Cells were either transfected transiently according to section 2.4.3 for 48 h or
stably expressed different proteins of interest. Cells were seeded for 24 h and then serum
starved in presence or absence of different stimuli or inhibitors for additionally 24 h medium.
Conditioned medium (750 µl) and cell lysates (200 µl) were prepared as described in section
2.4.1 and subjected to ELISA as indicated in section 2.4.2. Subsequently, the measured
concentration of CX3CL1 in the medium and cell lysate was further calculated by dividing
32 Chapter 2
through 9.24, which represents the molecular mass of the chemokine domain of CX3CL1 (84
amino acids = 9,240 Da), resulting in the molar concentration of CX3CL1 [pmol/ml]. This
was then multiplied with 0.75 (medium) and 0.2 (lysat), which finally resulted in the molar
amount of CX3CL1 [pmol] in the whole medium and cell lysate sample. Following this, the
release rate [%] of various CX3CL1 constructs was calculated as the ratio of the amount of
soluble CX3CL1 in the medium and the amount of soluble CX3CL1 in the medium plus the
cell-associated CX3CL1 in the cell lysates.
2.4.5 Tandem protein purification
HEK293 cells were transiently transfected with the pcDNA3.1 vector containing a human
CX3CL1 C-terminal tagged with a 2z und a histidin domain according to section 2.4.3. The
cell lysate of one 10 cm culture dish was harvested after 48 h using the 1 ml lysis buffer
(section 2.3.1).
100 µl of IgG-sepharoseTM 6 fast flow (Amersham, GE Healthcare, Munich, Germany) was
washed three times with TST-buffer by resuspension and centrifugation with 0.5 g for 1 min
at 4°C and finally resuspended in 2 ml TST-buffer. 2 ml of IgG-sepharose solution and 1ml
of cell lysate were incubated under agitation for 1-2 h at 4°C. Subsequently, the proteins
bound to the IgG-sepharose were washed three times with TST-buffer by resuspension and
centrifugation with 0.5 g for 1 min at 4°C. Proteins were eluted in 300 µl 0.5 M acetic acid
(pH 3.4). The solution was then neutralised with 150 µl 1 M Tris (pH 11) and the buffer was
finally changed to 1 ml PBS-N-05 (see section 2.4.2) using the illustra NAP™-10 columns
(GE Healthcare) according to manufacturer’s protocol.
In a second step, 100 µl of Ni-NTA agarose (QIAGEN GmbH, Hilden, Germany) was
washed three times with equilibration buffer using 0.5 g for 1 min at 4°C and finally
resuspended in 1 ml equilibration buffer. 1 ml of Ni-NTA solution and 1ml of the protein
solution from the first purification step were again incubated under agitation for 1-2 h at 4°C.
The Ni-NTA agarose was then washed two times with equilibration buffer and two times
with Ni-NTA wash buffer before the protein was eluted with 300 µl of Ni-NTA elution
buffer. By the use of illustra NAP™-10 columns the buffer was again exchanged to 1 ml
equilibration buffer according to manufacturer’s protocol. The eluted protein was then 10
times concentrated using the Vivaspin 500 centrifugal filters with a molecular weight cut off
Materials and methods 33
of 10 kDa. Some fractions of the purification procedure were then subjected to SDS-PAGE
and Western blotting.
TST buffer
50 mM Tris HCl, pH 7,6
150 mM NaCl
0.05 % (v/v) Tween 20
Equilibration buffer
0.05 % (v/v) Tween 20
in PBS
Ni-NTA wash buffer
20 mM Imidazol
0.05 % (v/v) Tween 20
in PBS
Ni-NTA elution buffer
250 mM Imidazol
0.05% (v/v) Tween 20
in PBS
2.4.6 Deglycosylation
Tandem purified human CX3CL1-2zHis protein or unpurified human cell bound CX3CL1
protein (transiently expressed for 48hrs in HEK293 cells) were subjected to deglycosylation.
In order to get complete O-deglycosylation, the endo-α-N-acetylgalactosaminidase
(Calbiochem) and the α2-3,6,8,9-neuraminidase (Calbiochen) were used together. The endo-
α-N-acetylgalactosaminidase cleaves only unsubstituted Galβ1,3GalNAc disaccharides
attached to serine or threonine residues, whereas the α2-3,6,8,9-neuraminidase hydrolyses all
non-reducing terminal sialic acid residues. Purified cell lysate (13 µl), deglycosylation buffer
(4 µl), endo-α-N-acetylgalactosaminidase (2 µl) and α2-3,6,8,9-neuraminidase (1 µl) were
34 Chapter 2
mixed and incubated for 2 h at 37°C. Afterwards the proteins/lysates were analysed in
comparison to the unglycosylated proteins/lysates by Western blotting.
.
Deglycosylation buffer (pH 5)
250 mM NaH2PO4
250 mM Na2HPO4
2.4.7 SDS-PAGE
Sodiumdocecylsulfate-polyacrylamid-gelelectrophoresis (SDS-PAGE) was carried out on
12.5% separating gels with a 5% stacking gels unless otherwise stated in the text. The gels
were electrophoresed in a Mini-PROTEAN® 3 cell system (Bio-Rad Laboratories) containing
SDS running buffer at 50-75 V (Power pac 200, Bio-Rad Laboratories) for 60-90 min at
room temperature. Samples were loaded in the presence of 5x sample buffer together with
PageRuler™ prestained protein ladder (Fermentas GmbH) according to Laemmli150.
Separating gel
2.5 ml 1.5 M Tris-Base pH 8.8
3.3-5 ml Rotiphorese® Gel 30 (37.5:1)
0.1% (w/v) SDS
0.1% (w/v) APS
10 µl TEMED
add 10 ml (MilliQ® H20)
Stacking gel
1.25 ml 0.5 M Tris-Base pH 6.8
0.85 ml Rotiphorese® Gel 30 (37.5:1)
0.05% (w/v) SDS
0.05% (w/v) APS
5 µl TEMED
add 5 ml (MilliQ® H20)
Materials and methods 35
SDS running buffer
25 mM Tris-Base
200 mM Glycine
0.1% (w/v) SDS
5x sample buffer
250 mM Tris-Base
10% (w/v) SDS
0.1% (w/v) Bromphenol blue
50% (v/v) Glycerol
2% (v/v) β-mercaptoethanol
2.4.8 Western blotting
Proteins separated by SDS-PAGE were electrophoretically transferred to a PDVF blotting
membrane (GE Healthcare) using the TransBlot® semi dry system (Bio-Rad Laboratories) in
transfer buffer at 1 mA per cm2 membrane for 1.5 h at room temperature. All following steps
were performed at room temperature. The membrane was blocked by shaking in blocking
solution (10% BSA/PBS-N-1 or 5% milk powder/PBS-N-1). The membrane was then
incubated with the first antibody in blocking solution for 45-60 min at room temperature and
washed three times for 5 min with PBS-N-1. The protein/first antibody complex was then
detected with the appropriate secondary antibody coupled to the horse radish peroxidase
(HRP) for another 45-60 min. Afterwards the membrane was washed four times for 5 min
with PBS-N-1. The equal volumes of LumigenTM TMA-6 Solution A and B (GE Healthcare)
were placed onto the membrane for 45-60 s. The intensity of the chemo-luminescent HRP
reaction was measured for 1-120 s with the LAS-3000 Gel-analyser (FUJIFILM Europe
GmbH, Duesseldorf, Germany).
Transfer buffer
25 mM Tris-Base
192 mM Glycine
10% (v/v) Methanol
36 Chapter 2
PBS-N-1
0.1% (v/v) Tween 20
137 mM NaCl
2.7 mM KCl
10 mM Na2HPO4
2 mM KH2PO4
Antibodies
α-hCX3CL1 rabbit anti-human CX3CL1 antibody, #500-P98,
PeproTech GmbH, used at 250 ng/ml
α-mCD4 rat IgG2B anti-mouse CD4 antibody, #MAB5541,
R&D Systems GmbH, used at 1µg/ml
α-rabbit HRP Horse radish peroxidase-conjugated goat F(ab') 2
fragments anti-rabbit IgG, #111-036-003, Jackson
ImmunoResearch Laboratories Europe, Ltd., used at
32 ng/ml
α-rat HRP Horse radish peroxidase-conjugated goat F(ab') 2
fragments anti-rat IgG, #112-036-003, Jackson
ImmunoResearch Laboratories Europe, Ltd., used at
32 ng/ml
2.5 Data illustrations and statistical analysis
The graphs display the result as mean ± SD (standard deviation) of three independent
experiments, if not indicated otherwise.
All data were generally Box-Cox transformed prior the statistical analysis using the JMP
software (JMP, Version 7, SAS Institute Inc., Cary, NC, 1989-2007) to reduce the possibility
of the data to not contain equal variances (homoscedasticity). Since data shown in percent are
believed to be not Gauss distributed, these data were also AcrSine transformed using the
Excel software (Microsoft® Office Excel 2003, Microsoft Corporation, Seattle, WA, 1985-
2003) to achieve Gaussian distribution. The data were subsequently analyzed using t-test and
Materials and methods 37
one- or two-way analysis of variance (ANOVA) using the GraphPadPrism software
(GraphPad Prism 5.02, GraphPad Software, San Diego, CA, 1992-2009). In case of one-
factor analysis the paired t-test was used for single comparison, whereas for one-factor
multiple comparison the one-way ANOVA was used. Two-way ANOVA was performed for
two-factor multiple comparison analysis. As post-hoc tests after the one- or two-way
ANOVA the Bonferroni or the Dunnett tests were used. The Bonferroni test was used to
compare all data against all other data, whereas the Dunnett test was used to compare all data
against the control. The data were then considered significantly different at probability values
smaller 0.05 (0.01, 0.001), marked with * (**, ***). In the figures only those comparisons
with interest to the main hypotheses were indicated.
38 Chapter 3
3 3 RESULTS
3.1 Structural characterisation of mouse CX3CL1 Several reports have described ADAM mediated shedding of human CX3CL1. However,
shedding of mouse CX3CL1 remains to be analysed in detail. In the present study the
domains within CX3CL1 involved in shedding by ADAM10 were analysed. For this purpose,
shedding of mouse CX3CL1 was analysed and compared to human CX3CL1. Subsequently,
the cleavage region for human CX3CL1 was defined in more detail. Finally, the molecular
determinats for the ADAM10 mediated shedding within the whole mouse CX3CL1 were
analysed.
3.1.1 Shedding of mouse CX3CL1
Shedding of human CX3CL1 is well characterised, whereas shedding of mouse CX3CL1
remain to be investigated. Here, shedding of the mouse CX3CL1 mediated by human
ADAM10 and ADAM17 was analysed and compared to the human variant. Therefore, an
expression system for mouse CX3CL1 was generated. The vector map of the mCX3CL1
expression vector (mCX3CL1_3.1+) and the sequence of mouse CX3CL1 are shown in the
supplement section (Sup.-Fig. 1a, b). The mCX3CL1_3.1+ vector was generated by
amplifying the CX3CL1 gene from the pORF-mFractalkine vector (supplied by InvivoGen,
San Diego, USA) using the 5mFKNEcoRI_fo and 3mFKNXhoI_re primers at an annealing
temperature of 55°C. The gene-sequence was ligated into the pCR2.1 Topo vector, verified
by sequencing and then subcloned into the pcDNA3.1+ vector using EcoRI and XhoI
restriction enzymes.
The domain structures of human and mouse CX3CL1 are schematically presented in Fig. 3-1
[A]. To compare the expression, human and mouse CX3CL1 were transiently expressed in
HEK293 cells. The conditioned medium and cell lysates of both CX3CL1 forms were then
subjected to SDS-PAGE followed by Western blotting using an antibody against human and
mouse CX3CL1 (Fig. 3-1 [B]). It was found that soluble forms of hCX3CL1 were released
into the conditioned medium and migrated at a molecular weight of approximately 70 kDa.
The soluble forms of mCX3CL1 seemed to migrate slightly lower than 70 kDa. Two
predominant cell-associated molecules were detected in the cell lysates of hCX3CL1 and
Results 39
mCX3CL1 transfected HEK293 cells. For hCX3CL1 they were detected at around 55 and 90
kDa, respectively and for mCX3CL1 at around 60 and 90 kDa.
Fig. 3-1: Shedding of hCX3CL1 and mCX3CL1 into the medium of HEK293 cells [A] Schematic presentation of the domain structures of human CX3CL1 (X3CL1_HUMAN (accession #P78423)) and mouse CX3CL1 (X3CL1_MOUSE (#O35188)) indicated by the number of the first amino acid residue of each domain. The light gray bars represent the signal peptides, the green bars the chemokine domains, the dark grey bars the mucin-like stalk, the white shaped bars the transmembrane domain and the blue bars the cytoplasmic tail containing the potential tyrosine phosphorylation motif. The two potential cleavage sites within the mucin-like stalk, which are represented through the di-argine motif (R-R) and one of the potentially o-glycosylated threonine residues (T). [B] Conditioned medium (M) and cell lysates (L) of human (hCX3CL1) and mouse CX3CL1 (mCX3CL1), expressed in HEK293 cells, were subjected to SDS-PAGE followed by Western blotting using the rabbit α-hCX3CL1 antibody and the α-rabbit HRP antibody for the detection. The pcDNA3.1+ vector (pcDNA) served as control.
The Western blot analysis showed that soluble forms of human and the mouse CX3CL1 with
a size of approximately 70 kDa were released into the medium. Since the cell surface
expressed form has a size of approximately 90 kDa141, this release was most likely caused by
proteolysis/shedding from the cell surface. Already published data using specific inhibitors
for ADAM10 (A10) and ADAM10/17 (A10/17) and ADAM10-defiencient embryonic
fibroblasts suggested that this constitutive release of the human CX3CL1 is due to
A
B
kDa M M L L M M L L M M L L
hCX3CL1 pcDNA mCX3CL1
10070
40
55
signal peptidechemokine domainmucin-like stalk region
transmembrane domaincytoplasmic domain
1 25 101 342 363 397
YVLVhuman CX3CL1
1 25 101 340 361 395
YVLVmurine CX3CL1
R-RYVLV
T
R-RT
signal peptidechemokine domainmucin-like stalk region
transmembrane domaincytoplasmic domain
1 25 101 342 363 397
YVLVhuman CX3CL1
1 25 101 340 361 395
YVLVmurine CX3CL1
R-RYVLV
T
R-RT
A
B
kDa M M L L M M L L M M L L
hCX3CL1 pcDNA mCX3CL1
10070
40
55
B
kDa M M L L M M L L M M L L
hCX3CL1 pcDNA mCX3CL1
10070
40
55
signal peptidechemokine domainmucin-like stalk region
transmembrane domaincytoplasmic domain
1 25 101 342 363 397
YVLVhuman CX3CL1
1 25 101 340 361 395
YVLVmurine CX3CL1
R-RYVLV
T
R-RT
signal peptidechemokine domainmucin-like stalk region
transmembrane domaincytoplasmic domain
1 25 101 342 363 397
YVLVhuman CX3CL1
1 25 101 340 361 395
YVLVmurine CX3CL1
R-RYVLV
T
R-RT
40 Chapter 3
ADAM10-mediated shedding146, whereas the PMA-induced release of human CX3CL1 is
mediated by ADAM17141.
The human and mouse CX3CL1 forms were transiently expressed in HEK293 cells to
analyse the involvement of ADAM10 and ADAM17 in the release of mouse CX3CL1.
Transfected cells were incubated in the absence or presence of the specific inhibitors A10
and A10/17 and analysed for soluble forms found in the conditioned medium by ELISA (Fig.
3-2). The dual-specific A10/17 inhibitor was already reported to have an IC50 against
ADAM17 of 8.0 nM and an IC50 of 11.5 nM against ADAM10, whereas the specific A10
inhibitor was reported to have an IC50 against ADAM10 of 5.3 nM146. In the present study it
was demonstrated that soluble forms of mouse CX3CL1 can be found in the conditioned
medium, as they can be for human CX3CL1. The release of both human and mouse forms
was inhibited by the A10 and A10/17 inhibitors, however, in both cases the A10/17 inhibitor
seemed to be the more effective. Application of both inhibitors reduced the release of human
CX3CL1 up to approximately 75%, whereas the combined use of A10 and A10/17 inhibited
the release of mouse CX3CL1 up to approximately 66%. Since application of both A10 and
A10/17 inhibitors led to the highest reduction of soluble CX3CL1 released into the medium,
they were used in combination in further experiments.
Fig. 3-2: Analysis of the conditioned media of hCX3CL1 and mCX3CL1 tranfected HEK293 cells Human [A] and mouse [B] CX3CL1 were expressed in HEK293 cells and analysed for shedding in the presence of the inhibitors A10 and A10/17 (10 µM) by ELISA for human and mouse CX3CL1. DMSO served as control. ELISA data given in the diagram correlate with the CX3CL1 molecules, which were released into the medium. One well contained 1x 105 cells. The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using one-way ANOVA followed by Bonferroni post-hoc test. The p-values indicated as *, **, *** were smaller than 0.05, 0.01, 0,001.
A
B
control (1x)A10A10/17control (2x)A10 + A10/17
0
1
2
3
amou
ntC
X3C
L1 [p
mol
]am
ount
CX3
CL1
[pm
ol]
0
1
2
3
control (1x)A10A10/17control (2x)A10 + A10/17
** ***
* **
A
B
control (1x)A10A10/17control (2x)A10 + A10/17
0
1
2
3
amou
ntC
X3C
L1 [p
mol
]
control (1x)A10A10/17control (2x)A10 + A10/17
control (1x)A10A10/17control (2x)A10 + A10/17
0
1
2
3
0
1
2
3
amou
ntC
X3C
L1 [p
mol
]am
ount
CX3
CL1
[pm
ol]
0
1
2
3
control (1x)A10A10/17control (2x)A10 + A10/17
amou
ntC
X3C
L1 [p
mol
]
0
1
2
3
control (1x)A10A10/17control (2x)A10 + A10/17
control (1x)A10A10/17control (2x)A10 + A10/17
** ***
* **
rele
ased
CX3
CL1
in th
em
ediu
m[p
mol
]re
leas
edC
X3C
L1in
the
med
ium
[pm
ol]
A
B
control (1x)A10A10/17control (2x)A10 + A10/17
0
1
2
3
amou
ntC
X3C
L1 [p
mol
]am
ount
CX3
CL1
[pm
ol]
0
1
2
3
control (1x)A10A10/17control (2x)A10 + A10/17
** ***
* **
A
B
control (1x)A10A10/17control (2x)A10 + A10/17
0
1
2
3
amou
ntC
X3C
L1 [p
mol
]
control (1x)A10A10/17control (2x)A10 + A10/17
control (1x)A10A10/17control (2x)A10 + A10/17
0
1
2
3
0
1
2
3
amou
ntC
X3C
L1 [p
mol
]am
ount
CX3
CL1
[pm
ol]
0
1
2
3
control (1x)A10A10/17control (2x)A10 + A10/17
amou
ntC
X3C
L1 [p
mol
]
0
1
2
3
control (1x)A10A10/17control (2x)A10 + A10/17
control (1x)A10A10/17control (2x)A10 + A10/17
** ***
* **
rele
ased
CX3
CL1
in th
em
ediu
m[p
mol
]re
leas
edC
X3C
L1in
the
med
ium
[pm
ol]
Results 41
3.1.2 Structural determinants for shedding of mouse CX3CL1
3.1.2.1 Cleavage sites for human CX3CL1
The di-argine (R-R) motif was predicted to represent the cleavage site of human CX3CL1.
Mouse and human CX3CL1 share great sequence homology. Thus, the R-R motif can also be
found in the mouse CX3CL1. But furthermore, it was necessary to narrow down the cleavage
site in more detail and also check whether also more than one cleavage site within CX3CL1
is used by ADAM10.
For this purpose advantage was taken of the already generated 2zHis-tagged human CX3CL1
molecule. It contained the human CX3CL1 molecule fused to Xa-restriction site (4 amino
acids), a 2z-tag (138 amino acids) and a His tag (6 amino acids). By the use of this construct,
C-terminal fragments (CTFs) located within the cell membranes can be purified using protein
A and Ni-NTA. The construct was expressed in HEK293 cells and tandem purified from the
cell lysates according to section 2.4.5. The proteins were purified by sequential binding of
the IgG-bound Sepharose to the 2z-tag and subsequent binding of Ni-NTA-bound Agarose to
a six histidine containing tag. All fractions of the tandem purification were subjected to SDS-
PAGE followed by Western blotting (Fig. 3-3).
Fig. 3-3: Tandem purification of hCX3CL1 The human CX3CL1-2zHis vector was transfected into HEK293 cells and after 48 h the cell lysate was harvested and subjected to protein batch purification using IgG-Sepharose (IgG), NAP10 purification colums (NAP) and Ni-NTA-Agarose (Ni-NTA). The cell lysate (L) and selected fractions, like binding (B), washing (W) and elution (E), were analysed by SDS PAGE followed by Western blotting using the rabbit α-hCX3CL1 and the α-rabbit HRP antibodies. The arrows indicate the C-terminal fragments CTF1-3.
100
40
1525
kDa L B W E B E B W E B E
IgG Ni-NTANAP NAP
CTF3CTF2CTF1
100
40
1525
kDa L B W E B E B W E B E
IgG Ni-NTANAP NAP
100
40
1525
kDa100
40
1525
kDa L B W E B E B W E B E
IgG Ni-NTANAP NAP
CTF3CTF2CTF1
42 Chapter 3
For the detection of the C-terminal fragments an antibody was used, which binds the 2z-tag
of the molecule allowing the detection of all fragments with an intact C-terminus. Western
blot analysis indicated that the 2zHis-tagged human CX3CL1 was purified from the cell
lysate already by the first IgG-Sepharose purification step and even more specific by the
following Ni-NTA purification step. Additionally, after the tandem purification three CTFs
were attached via the 2zHis tag. The CTF1 migrated at approximately 18 kDA, whereas the
CTF2 and the CTF3 had a size of approximately 22 and 24 kDa.
The mucin-like stalk of CX3CL1 contains 26 potential O-glycosylations at serine and
threonine residues52. Since potential O-glycosylations are also found in the membrane
proximal region, the CTFs might also carry O-glycosylations.
To address this question the purified 2zHis human CX3CL1 and untagged human CX3CL1
were O–deglycosylated using the endo-α-N-acetylgalactosaminidase in combination with the
α2-3,6,8,9-neuraminidase according to section 2.4.6. The protein was then subjected to 15%
SDS-PAGE and Western blotting (Fig. 3-4). Three CTFs with the sizes of approximately 23,
24 and 25 kDa were found. However, upon O-deglycosylation only the two smaller CTFs at
23 and 24 kDa were detected. The experiments indicated that only the CTF3 rises from
different glycosylation. This suggested that maximal two cleavage sites exist, represented by
the CTF1 and CTF2.
Fig. 3-4: Deglycosylation of hCX3CL1 The purified protein CX3CL1-2zHis (2zHis) was untreated (-) and treated (+) using Endo-α-N-acetylgalactosaminidase and the α2-3,6,8,9-Neuraminidase. Untagged human CX3CL1 (wt) served as control. The samples were then analysed by 15% SDS-PAGE followed by Western blotting using the rabbit α-hCX3CL1 and the α-rabbit HRP antibodies. The arrows indicate three C-terminal-fragments (CTF) with a size of approximately 23, 24 and 25kDa.
40
7055
15
25
22
kDa + -
wt
+ -
2zHis
CTF3CTF2CTF1
40
7055
15
25
22
kDa + -
wt
+ -
2zHis
40
7055
15
25
22
kDa + -
wt
+ -
2zHis
CTF3CTF2CTF1
Results 43
3.1.2.2 Substitution of the cleavage region
The data above demonstrated that the cleavage/shedding of human CX3CL1 takes place at
the extra-cellular part of the protein proximal to the membrane and involves more than one
cleavage site. The release of mouse CX3CL1 appears to be ADAM10- and ADAM17-
dependent as indicated by the profiles of specific inhibitors A10 and A10/17. However, the
region containing the cleavage sites of CX3CL1 not necessarily represents the determinants
for the recognition of CX3CL1 through ADAM10 or ADAM17. Therefore, mutants for
studying the structural determinants for CX3CL1 shedding were generated. These
investigations not only addressed the membrane proximal cleavage region within CX3CL1,
but also analysed the chemokine domain, the transmembrane domain and the intracellular C-
terminal part (Fig. 3-5). Analogous domains within mouse CX3CL1 were replaced by
corresponding structures of related molecules or completely deleted and in a next step the
amounts of released versus cell-associated variants were analysed by ELISA.
Fig. 3-5: Potential target structures to analyse mCX3CL1 shedding
Since CX3CL1 appears to be cleaved proximal to the membrane at two potential cleavage
sites this region seemed to be a promising target to define the structural determinants for the
shedding process by ADAM10 and ADAM17.
For this purpose, the following chimeras and variants of mCX3CL1 were generated. First, the
mCX3CL1/CD4 chimera was generated containing the extracellular Ig-like C2-type 3
domain (57 amino acids) and the extracellular juxtamembrane domain (21 amino acids) of
mouse CD4. The two domains replaced the amino acids 262 to 339 of mouse CX3CL1,
which are the first 78 amino acids in the extracellular mucin-like stalk orientated from the
membrane. Secondly, a mCX3CL1 poly-L variant containing a 50 amino acid poly-(glycine-
serine) residue (poly-L) replacing the corresponding part of mCX3CL1 from amino acids 290
CX3CCX3C CX3CCX3CCX3CCX3CCX3CCX3C CX3CCX3CCX3CCX3C
44 Chapter 3
to 339 was also generated. The mCX3CL1/CD4 and the mCX3CL1 poly-L variant
expression vectors and the sequence of the chimetic genes are shown in the supplement
section (Sup.-Fig. 2a, b, c). To generate the vectors, the cDNAs for the Ig-like C2-type 3
domain of mouse CD4 and the poly-(glycine-serine) residue were synthesized (Genscript,
USA) and provided within a pUC57 expression vector. They were then subcloned into the
mCX3CL1_3.1+ using Eco81I and XhoI restriction enzymes and verified by sequencing.
Furthermore a mCX3CL1 variant (mCX3CL1 del) with a deletion of 50 amino acids from
290 to 339 was also generated. The vector map and the sequence are shown in the
supplement section (Sup.-Fig. 3a, b). For the generation of the mCX3CL1 del variant, which
was derived from the mCX3CL1 poly-L chimera, the BamHI restriction enzyme was used.
The structure of all generated chimeras and variants is schematically shown in Fig. 3-6 [A].
Fig. 3-6: Substitution and deletion of the membrane proximal part of mCX3CL1 by an Ig-like domain of mCD4 and a poly-(glycine-serine) linker [A] Schematic structure of the mCX3CL1 chimeras/variants with a substitution or deletion in the membrane proximal part of mCX3CL1 are shown. The indicated mCX3CL1 chimeras/variants were expressed in HEK293 cells and analysed for shedding by ELISA. ELISA data in the diagram were shown as the released CX3CL1 in the medium [B], the released and cell-associated CX3CL1 in the medium and the cell lysate [C] and the release rate [D] representing the ratio between the amount of soluble CX3CL1 released in the medium and the total amount of all CX3CL1 molecules found in the medium and cell lysates. The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using one-way ANOVA.
mCX3CL1 mCX3CL1 poly-L
mCX3CL1/CD4
mCX3CL1 del
B
CX3C CX3C
Poly-L
CX3C
Ig-likeC2-type 3
CX3C
A
mCX3CL1 mCX3CL1 poly-L
mCX3CL1/CD4
mCX3CL1 del
0
1
2
3
4
5
mCX3CL1 mCX3CL1 poly-L
mCX3CL1/CD4
mCX3CL1 del
0
25
50
75
rele
ase
rate
[%]
D
C
mCX3CL1 mCX3CL1 poly-L
mCX3CL1/CD4
mCX3CL1 del
0
2
4
6
8
rele
ased
CX3
CL1
in th
em
ediu
m[p
mol
]re
leas
ed&
cel
l-ass
ocia
ted
CX3
CL1
[pm
ol]
mCX3CL1 mCX3CL1 poly-L
mCX3CL1/CD4
mCX3CL1 del
B
CX3C CX3C
Poly-L
CX3C
Ig-likeC2-type 3
CX3CCX3CCX3C CX3C
Poly-L
CX3CCX3C
Poly-L
CX3C
Ig-likeC2-type 3
CX3CCX3C
Ig-likeC2-type 3
CX3CCX3CCX3C
A
mCX3CL1 mCX3CL1 poly-L
mCX3CL1/CD4
mCX3CL1 del
0
1
2
3
4
5
0
1
2
3
4
5
mCX3CL1 mCX3CL1 poly-L
mCX3CL1/CD4
mCX3CL1 del
0
25
50
75
rele
ase
rate
[%]
D
C
mCX3CL1 mCX3CL1 poly-L
mCX3CL1/CD4
mCX3CL1 del
0
2
4
6
8
rele
ased
CX3
CL1
in th
em
ediu
m[p
mol
]re
leas
ed&
cel
l-ass
ocia
ted
CX3
CL1
[pm
ol]
Results 45
The mCX3CL1, the mCX3CL1/CD4 chimera, the mCX3CL1 poly-L and the mCX3CL1 del
variants were expressed in HEK293 cells and analysed for the presence of soluble and cell
associated mouse CX3CL1 by ELISA. As indicated in Fig. 3-6 [B-D] the amount of soluble
CX3CL1 in the medium and total amount of CX3CL1 in medium and cell lysate varied
among the constructs.
To compare the release of different variants, a release rate was defined, representing the ratio
(in percent) between the amount of soluble CX3CL1 released in the medium and the total
amount of all CX3CL1 molecules found in the medium and cell lysates (for details see
section 2.4.4). This release rate appears to better represent the release of CX3CL1, since it
relates the released forms in medium to the total amount of released and cell-associated
forms. In this experiment the wt form of mouse CX3CL1 showed a release rate of 50%. The
release rates of the mCX3CL1 poly-L and the mCX3CL1 del variants were slightly
increased. Only the mCX3CL1/CD4 chimera showed a slight reduction in the release rate
compared to mCX3CL1.
3.1.2.3 Substitution of the N-terminal region
Unexpectedly, the release of mouse CX3CL1 was significantly affected neither by the
substitution of the membrane proximal region by that of a mouse CD4 domain, nor by an
artificial poly glycine-serine linker nor by a total deletion. It was therefore speculated that
other determinants might influence the ADAM10 and ADAM17 shedding of CX3CL1. Thus,
the involvement of the chemokine domain in CX3CL1 release was analysed. CCL5 plays an
active role in the recruitment of the leukocytes into the inflammatory sites. It was reported to
be involved in the monocyte arrest151. Since it has a similar function as CX3CL1, it was
decided to change the chemokine domain of mouse CX3CL1 to that of human CCL5.
The CCL5/mCX3CL1 chimera was generated by substitution of the chemokine domain of
mouse CX3CL1 (76 amino acids) by that of human CCL5 (68 amino acids) including the
signal peptide motif (23 amino acids) of CCL5. The CCL5/mCX3CL1 expression vector
(RANmCX3CL1_3.1+) and the sequence of the gene are also shown in the supplement
section (Sup.-Fig. 4a, b). The vector was generated by amplification of CCL5 from a CCL5-
pCDNA3.1+ vector construct (kindly provided by Priv.-Doz. Dr. Rory Koenen, IMCAR,
RWTH Aachen) using the 5hRANEcoRI_fo and 3hRANAgeI_re primers at an annealing
temperature of 60°C. The upper part of the mucin-like stalk of CX3CL1 was amplified from
the mCX3CL1_3.1+ vector using the 5mFKNAgeI_fo and 3mFKNPflAge_re primers also at
46 Chapter 3
an annealing temperature of 60°C. Both PCR-products were subcloned into the pCR2.1 Topo
before the sequence for the upper part of the mCX3CL1 stalk region was ligated behind the
CCL5 sequence using the AgeI restriction site. The orientation of the gene sequences was
verfied by sequencing before the total sequences was back ligated into mCX3CL1_3.1+
vector using EcoRI and PflMI restriction sites. The schematic structure of this construct is
shown in Fig. 3-7 [A]. The CCL5/mCX3CL1 chimera was then transiently expressed in
HEK293 cells in the absence or presence of both specific inhibitors for ADAM10 (A10) and
ADAM10/17 (A10/17). Subsequently medium and cell lysates were subjected to the ELISA
for the determination of the release rate (Fig. 3-7 [B]).
Since the changing of the CX3C-chemokine domain also destroyed the epitope for the mouse
CX3CL1 ELISA, an ELISA for CCL5 had to be used. This ELISA revealed that the release
rate of the CCL5/mCX3CL1 chimera was increased up to nearly 80%, whereas the release
rate of the wt mCX3CL1 shown in the previous experiment was only 50%. The A10 and
A10/17 inhibitors, however, could not reduce the release of the CCL5/mCX3CL1 chimera to
a significant extent.
Fig. 3-7: Substitution of the chemokine domain of mCX3CL1 by the chemokine CCL5 [A] The schematic structure of the CCL5/mCX3CL1 is shown. [B] HEK293 cells were transiently transfected with the CCL5/mCX3CL1_3.1+ vector. Conditioned medium and cell lysate was analysed for the release and inhibition by A10 and A10/17 using the ELISA for CCL5. ELISA data presented in the diagram are shown as release rate. The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using paired two-tailed t-test.
ACCL5
rele
ase
rate
[%]
B
0
20
40
60
80
100controlA10 + A10/17
ACCL5CCL5
rele
ase
rate
[%]
B
0
20
40
60
80
100controlA10 + A10/17
3.1.2.4 Substitution and removal of the transmembrane and the C-terminal region
Obviously none of the introduced mutations led to a pronounced reduction of CX3CL1
release. Hence, the focus was now changed to the C-terminal and the transmembrane regions
Results 47
of mCX3CL1. These two regions in combination with the membrane proximal region of
mouse CX3CL1 were replaced by that of the mouse CD4 analogous regions and analysed for
the release behaviour.
In the mCX3CL1/CD4 fusion chimera amino acids 262 to 395 of mouse CX3CL1 were
replaced by the C-terminal part of mouse CD4 including the cytoplasmic tail, the
transmembrane region and the Ig-like C2-type 3 domain. The mCX3CL1/CD4 fusion vector
(mCX3CL1/CD4fusion_3.1+) and the gene-sequence are shown in the supplement section
(Sup.-Fig. 5a, b). Before generating the fusion vector, the mouse CD4 vector (mCD4_3.1+)
was constructed. The vector map and the sequence are shown in Sup.-Fig. 6a, b. Therefore,
the mouse CD4 (mCD4; CD4_MOUSE (#P06332)) gene provided from RZPD (ImaGenes,
Germany) was amplified using 5mCD4EcoRI_fo and 3mCD4XhoI_re primers at an
annealing temperature of 55°C. It was subcloned into the pCR2.1 Topo vector, then verified
by sequencing and subsequently again subcloned into the pcDNA3.1+ vector upon EcoRI
and XhoI restriction enzyme digest. Thereafter, the upper part of the mCX3CL1/CD4
chimera including parts of the Ig-like C2-type 3 domain was amplified using the
5mFKNEcoRI_fo and 3mFKNCD4Bam_re primers also at an annealing temperature of 55°C
and cloned into the pCR2.1 Topo vector. Sequencing reactions and subcloning into the
mCD4_3.1+ vector via the BamHI restriction sites were performed afterwards, resulting in
the generation of the mCX3CL1/CD4 fusion vector. The schematic structures of the
mCX3CL1/CD4 fusion chimera, the mCX3CL1/CD4 chimera and mCX3CL1 are shown in
Fig. 3-8 [A]. The indicated chimeras were expressed in HEK293 cells. Subsequently,
conditioned medium and cell lysates were analysed for released and cell-associated variants
using SDS-PAGE and Western blotting (Fig. 3-8 [B]).
Soluble forms of mCX3CL1/CD4 and mCX3CL1/CD4 fusion chimeras were released into
the conditioned medium and migrated like mCX3CL1 at a molecular weight of
approximately 70 kDa, probably even slightly lower. Interestingly, two molecules of
approximately 55 and 60 kDA were seen in the medium of the mCX3CL1/CD4 chimera and
one molecule of approximately 65 kDa in the medium of the mCX3CL1/CD4 fusion
chimera. The analysis of the cell lysates revealed different molecules for all variants. Two
molecules at approximately 60 and 90 kDa were found in the cell lysate of HEK293 cells
expressing mCX3CL1. In the cell lysate of HEK293 cells expressing the CX3CL1/CD4
chimera also two proteins were detectable. One was detected at approximately 90 kDa,
whereas the second one was detected slightly lower than 60 kDa. This smaller protein was,
however, remarkably stronger expressed than the corresponding mCX3CL1 protein. In the
48 Chapter 3
HEK293 cell lysate of the mCX3CL1/CD4 fusion chimera two main molecules at
approximately 50 and 80 kDa were found.
Fig. 3-8: Substitution of the membrane proximal part or the transmembrane and intracellular domains of mCX3CL1 by that of mCD4 [A] The mCX3CL1 variant and both mCX3CL1/CD4 and mCX3CL1/CD4 fusion chimeras are schematically shown. [B] Conditioned medium (M) and cell lysates (L) of HEK293 cells expressing the indicated chimeras were subjected to SDS-PAGE followed by Western blotting using the rabbit α-hCX3CL1 and α-rabbit HRP antibodies. The arrows indicate the soluble forms of the wt mCX3CL1 and the mCX3CL1 chimeras, which were released into the medium.
The Western blot analysis also showed that soluble forms were released into the conditioned
medium of the mCX3CL1 chimera transfected cells, most likely by proteolysis/shedding of
the mature forms from the surface. To clarify whether ADAM10 and ADAM17 are involved
in the shedding of the mCX3CL1/CD4 fusion chimera, this chimera was treated with the
inhibitor A10 and A10/17 and further analysed by ELISA. For this purpose the
mCX3CL1/CD4 and the mCX3CL1/CD4 fusion chimera were transiently expressed in
HEK293 cells. The transfected cells were incubated in the absence or presence of the specific
A
mCX3CL1/CD4 fusion
CX3C CX3C
Ig-likeC2-type 3
CX3C
mCD4
mCX3CL1/CD4mCX3CL1
B
kDa L L M M L L M M L L M M 10070
4055
mCX3CL1/CD4 fusion
mCX3CL1/CD4mCX3CL1
A
mCX3CL1/CD4 fusion
CX3CCX3C CX3C
Ig-likeC2-type 3
CX3CCX3C
Ig-likeC2-type 3
CX3C
mCD4
CX3CCX3C
mCD4
mCX3CL1/CD4mCX3CL1
B
kDa L L M M L L M M L L M M 10070
4055
mCX3CL1/CD4 fusion
mCX3CL1/CD4mCX3CL1
Results 49
inhibitors A10 and A10/17. The conditioned medium and cell lysates were subsequently
analysed by ELISA for mouse CX3CL1 (Fig. 3-9). The mCX3CL1 served as control.
A reduction of the release rate was again observed for the mCX3CL1/CD4 chimera
compared to the wt mCX3CL1, whereas for the mCX3CL1/CD4 fusion protein a slight
increase in the release rate could be seen. The release of all variants was diminished by the
A10 and A10/17 inhibitors to a similar degree of 25%.
Fig. 3-9: Analysis of the release of mCX3CL1/CD4 and mCX3CL1/CD4 fusion The indicated mCX3CL1/CD4 and mCX3CL1/CD4 fusion chimeras were expressed in HEK293 cells and analysed for the release in the absence or presence of the inhibitors for A10 and A10/17 by ELISA. ELISA data given in the diagram are shown as release rate. The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using two-way ANOVA followed by Bonferroni post-hoc test. The p-values indicated as *, ** were smaller than 0.05, 0.01.
Shedding of CD4 has not yet been reported, in particular not by ADAM10- and ADAM17-
mediated mechanisms. The unexpected observations that the mCX3CL1/CD4 and the
mCX3CL1/CD4 fusion chimeras were still shed, led also to the investigation of the potential
shedding of mouse CD4 itself. The mCD4_3.1+ expression vector map and sequence is
shown in the supplement section and the generation was already described above. The
schematic structure of the mouse CD4 molecule is shown in Fig. 3-10 [A]. The mCD4_3.1+
was also transiently transfected in HEK293 cells, after 48 h the medium and the cell lysates
were subjected to SDS-PAGE and Western blotting (Fig. 3-10 [B]).
As a result, two soluble forms of mCD4 were released into the conditioned medium with a
size of approximately 55 and 60kDa. The full size molecule present in the cell lysate
migrated at approximately at 60 kDa. This indicated that also mouse CD4 is shed to some
degree from the cell surface.
mCX3CL1 mCX3CL1/CD4
rele
ase
rate
[%]
0
20
40
60
80
mCX3CL1/CD4 fusion
controlA10 + A10/17**
*****
mCX3CL1 mCX3CL1/CD4
rele
ase
rate
[%]
0
20
40
60
80
mCX3CL1/CD4 fusion
controlA10 + A10/17controlA10 + A10/17**
*****
50 Chapter 3
Fig. 3-10: Release of mCD4 [A] Mouse CD4 was amplified and subcloned into the pcDNA3.1+ vector. [B] HEK293 cells were transiently transfected with the mCD4_3.1+ vector and analysed for the release into the conditioned medium by Western blotting using the rat α-mCD4 antibody and the α-rat HRP antibody for detection.
The results described above indicated that the replacement of the membrane proximal and the
C-terminal parts by that of analogous mouse CD4 regions does not lead to a reduction in the
ADAM10- or ADAM17-mediated release. The mCX3CL1/CD4 and the mCX3CL1/CD4
fusion showed no significant reduction in shedding, Even shedding of the total mouse CD4
molecule was observed, questioning whether other molecules can be used as replacement
molecules in order to reduce shedding by ADAM10 or ADAM17.
Other studies reported that C-terminal interactions are involved in the processes of ADAM12
mediated shedding of the epidermal growth factor (EGF) Receptor Ligand152. A more
interesting target to mediate shedding was therefore seen in the C-terminal cytoplasmic part
of CX3CL1 containing a potential SH2-binding domain motif, which could be responsible
for potential interactions.
The C-terminal cytoplasmic tails of the mCX3CL1 and mCX3CL1/CD4 chimera were
therefore truncated and then investigated for shedding via ADAM10 and ADAM17. The
mCX3CL1 trunc and mCX3CL1/CD4 trunc chimeras were generated by truncation of the
cytoplasmic tail of the CX3CL1 molecules, integrating a stop codon five amino acids
proximal to the membrane on the intracellular C-terminal site at the amino acid 362 of the
mouse CX3CL1 molecule. This seemed to be enough to anchor the protein within the
membrane on the one hand and on the other hand to destroy all possibilities for CX3CL1 to
bind ADAM10 or ADAM17 at the cytosolic part. Both expression vectors for the mCX3CL1
trunc (mCX3CL1 trunc_3.1+) and mCX3CL/CD4 trunc (mCX3CL1/CD4 trunc_3.1+) and
the gene-sequences are shown in the supplement section (Sup.-Fig. 7a, b & Sup.-Fig. 8a, b).
To generate the vectors, the partial genes from both mCX3CL1_3.1+ and
kDaM M L L M M L L
130
70
4055
mCD4pcDNAA B
Ig-likeC2-type 3
kDaM M L L M M L L
130
70
4055
mCD4pcDNAkDa
M M L L M M L L 130
70
4055
mCD4pcDNAA B
Ig-likeC2-type 3
Results 51
mCX3CL1/CD4_3.1+ vectors were amplified using 5mFKNPflI_fo and 3mFKNStopI_re
primers at an annealing temperature of 55°C. Both PCR-products were subcloned into the
pCR2.1 Topo vector and then verified by sequencing. They were afterwards back subcloned
into the mCX3CL1_3.1+ and mCX3CL1/CD4_3.1+ vectors upon PflMI and XhoI restriction
enzyme digest. The schematic structures of both truncated mCX3CL1 and mCX3CL1/CD4
chimeras and of the untruncated mCX3CL1 form are shown in Fig. 3-11 [A]. The indicated
truncated mCX3CL1 variant and the truncated mCX3CL1/CD4 chimera were also transiently
expressed in HEK293 cells and again analysed for the release into the conditioned medium
by SDS-PAGE and Western blotting (Fig. 3-11 [B]).
Fig. 3-11: Truncation of the cytoplasmic tail of mCX3CL1 and mCX3CL1/CD4 [A] The intracellular C-terminal cytoplamic tail of mouse CX3CL (mCX3CL1 trunc) and of mCX3CL1/CD4 (mCX3CL1/CD4 trunc) was truncated at the amino acids 362 of mouse CX3CL1. [B] Conditioned medium (M) and cell lysates (L) of the indicated truncated variants/chimeras and the untruncated mCX3CL1, expressed in HEK293 cells, were subjected to SDS-PAGE followed by Western blotting using the rabbit α-hCX3CL1 antibody and α-rabbit HRP detection antibody.
It was observed that soluble forms of mCX3CL1 trunc and mCX3CL1/CD4 trunc chimeras
were released into the conditioned medium and migrated like mCX3CL1 at a molecular
A
mCX3CL1 mCX3CL1trunc
mCX3CL1/CD4 trunc
CX3C CX3C CX3C
Ig-likeC2-type 3
A
mCX3CL1 mCX3CL1trunc
mCX3CL1/CD4 trunc
CX3CCX3C CX3CCX3CCX3C CX3CCX3C
Ig-likeC2-type 3
B
kDa M M L L M M L L M M L L
10070
4055
mCX3CL1/CD4 trunc
mCX3CL1truncmCX3CL1
B
kDa M M L L M M L L M M L L
10070
4055
mCX3CL1/CD4 trunc
mCX3CL1truncmCX3CL1
kDa M M L L M M L L M M L L
10070
4055
mCX3CL1/CD4 trunc
mCX3CL1truncmCX3CL1
52 Chapter 3
weight of approximately 70 kDa. The mCX3CL1/CD4 trunc showed a faint additional
molecule in the medium at approximately 65 kDa. The analysis of the cell lysate showed that
both truncated chimeras were expressed as two molecules of approximately 55 and 80 kDa,
whereas the untruncated mCX3CL1 was expressed as two molecules of approximately 60
and 90 kDa, as it was already shown above.
The Western blotting revealed that the truncated mCX3CL1 variant and the truncated
mCX3CL1/CD4 chimera were expressed in the cell lysate as approximately 80 kDa mature
proteins. Proteins of approximately 70 kDa were found in the conditioned medium,
indicating that shedding also occurred for the truncated variants/chimeras. It was then
important to know if and how the shedding of these truncated chimeras is affected by
ADAM10- and ADAM17-mediated mechanisms. The mCX3CL1 trunc and the
mCX3CL1/CD4 trunc were therefore again transiently expressed in HEK293 cells and
incubated in the absence or presence of specific A10 and A10/17 inhibitors. They were
afterwards analysed for soluble forms found in the conditioned medium and cell associated
forms in the cell lysate by ELISA (Fig. 3-12). The wt mCX3CL1 served as control.
Fig. 3-12: Release of mCX3CL1 trunc and mCX3CL1/CD4 trunc The truncated mCX3CL1 and mCX3CL1/CD4 chimeras were expressed in HEK293 cells, then analysed for shedding in the presence of the inhibitors A10 and A10/17 and compared to the untruncated mCX3CL1. ELISA data shown in the diagram are presented as release rate. The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using two-way ANOVA followed by Bonferroni post-hoc test. The p-values indicated as **, *** were smaller than 0.01, 0,001.
The analysis by ELISA showed that C-terminal truncation of mCX3CL1 led to a reduction in
the release rate to a degree of 30%. This reduction, however, was only slightly further
mCX3CL1 mCX3CL1trunc
rele
ase
rate
[%]
mCX3CL1/CD4 trunc
controlA10 + A10/17
0
10
20
30
40
50
60 *****
**
mCX3CL1 mCX3CL1trunc
rele
ase
rate
[%]
mCX3CL1/CD4 trunc
controlA10 + A10/17controlA10 + A10/17
0
10
20
30
40
50
60
0
10
20
30
40
50
60 *****
**
Results 53
reduced by an inhibition of ADAM10 and ADAM17. Shedding of the truncated
mCX3CL1/CD4 chimera was also reduced to a degree of 40%. This reduction was, however,
not as strong as the reduction observed for the truncated mCX3CL1 form. Inhibition of
ADAM10 and ADAM17 reduced the release rate to a degree of 25% for all analysed
variants/chimeras. The level was about the same as that for mCX3CL1. This indicates that
the level of ADAM10 and ADAM17 independent shedding is the same for all variants.
All previous results on the N-terminal, the cleavage region and the C-terminal associated
variants/chimeras revealed that the C-terminal truncation of mCX3CL1 caused the most
pronounced reduction in the release of mCX3CL1 into the conditioned medium. Next, the
influence of the C-terminal truncation of mCX3CL1 was investigated in a model of induced
shedding by inomycin. Treatment with ionomycin leads to increased intracellular Ca++ and to
activation of ADAM proteins. In case of CX3CL1 this ionomycin-induced shedding is
exclusively mediated by ADAM10-activity146.
HEK293 cells were therefore transiently transfected with the mCX3CL1 and the truncated
mCX3CL1 vectors for 72 h. The A10 inhibitor was then added for 10 min before an
incubation with ionomycin for 20 min. After this incubation period conditioned medium and
cells lysates were harvested and analysed by ELISA (Fig. 3-13).
Fig. 3-13: Ionomycin-induced release of the truncated mCX3CL1 and mCX3CL1/CD4 chimeras The truncated mouse CX3CL1 chimera (mCX3CL1 trunc) and mCX3CL1 (mCX3CL1) (mCX3CL1/CD4 trunc) were transfected in HEK293 cells. After 72 h cells were treated with or without 10 µM of specific ADAM10 inhibitor for 10 min and afterwards for 20 min with 1 µM ionomycin or left totally untreated at standard cell culture conditions. Conditioned medium and cell lysat were harvested and analysed for the presence of mouse CX3CL1 by ELISA. Data shown in are shown as release rate. The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using two-way ANOVA followed by Bonferroni post-hoc test. The p-values indicated as *, ** were smaller than 0.05, 0.01.
mCX3CL1 mCX3CL1 trunc
rele
ase
rate
[%]
controlionomycinionomycin & A10
0
3
6
9
12
15 ***
*
mCX3CL1 mCX3CL1 trunc
rele
ase
rate
[%]
controlionomycinionomycin & A10
controlionomycinionomycin & A10
0
3
6
9
12
15 ***
*
54 Chapter 3
It was found that the release rate of mCX3CL1 after 20 min of ionomycin treatment was
significantly increased, which was not the case for the truncated mCX3CL1. Ionomycin-
induced release of mCX3CL1 and truncated mCX3CL1 was suppressed by the inhibitor A10.
This experiment also indicates that the release rates were as expected again reduced for the
truncated variants of mCX3CL1 in comparison to the wt mCX3CL1.
The experiments above demonstrated that truncation of mCX3CL1 results in the strongest
reduction in constitutive and ionomycin-induced release. In a next step it was analysed
whether the reduced release of the truncated mCX3CL1 variant could be potentially
influenced by a different cellular distribution compared to wt mCX3CL1. Therefore,
HEK293 cells were transiently transfected with the truncated and wt mCX3CL1 vectors, as
described in section 2.3.6 (Fig. 3-14).
Fig. 3-14: Confocal analysis of mCX3CL1 and mCX3CL1 trunc The mCX3CL1 [A, C] and the truncated mCX3CL1 [B, D] variants were transfected in HEK293 cells and analysed for the cellular distribution using confocal microscopy. Cells were stained using the goat α-mCX3CL1 antibody in combination with the α-goat 488 antibody for the detection. Representative pictures of two independent experiments are shown. Arrows indicate mCX3CL1 variants within the cell surface membrane (yellow), the perinuclear golgi-like structures (red) and the vesicle-like structures (white).
A B
C D
A B
C D
Results 55
The microscopic analysis of transfected and stained cells showed that both truncated and full-
lenght variants were expressed on the cell surface, as expected. Interestingly, both variants
were also found within the cells in perinuclear golgi-like structures. However, the truncated
mCX3CL1 variant showed a rather equal distribution within the cell, whereas the wt
mCX3CL1 seemed to be expressed also in distinct vesicle-like structures within the cell.
3.1.3 Generation and characterisation of HEK293 cells stably expressing wt and
truncated mCX3CL1
The results above showed that the release rate of truncated mCX3CL1 was reduced
compared to mCXCL1, which was also seen for the ionomycin-induced release rates.
Microscopic analysis indicated that although they were both expressed on the cell surface
and showed perinuclear staining in golgi-like structures, the truncated mCX3CL1 variant
showed no additional staining of vesicle-like structures. All these results led to the hypothesis
that the release of these mCX3CL1 variants may not be necessarily due to different shedding.
Effects of different protein expression and trafficking have to be considered as well. A
uniform surface expression of both variants could help to understand the influence of the C-
terminal tail of CX3CL1 on ADAM mediated shedding in more detail.
Therefore, HEK293 cells were transiently transfected with the mCX3CL1, the truncated
mCX3CL1 variant and the truncated mCX3CL1/CD4 chimera for 48 h and subsequently
analysed for surface expression by flow cytometry (Fig. 3-15).
All three analysed mCX3CL1 variants seemed to display similar surface expression profiles.
But the specific analysis of cells expressing higher levels of mCX3CL1 (> 97% of isotype
control; gated M1-M3) indicated a higher expression degree (median) for the wt mCX3CL1
variant as for the truncated mCX3CL1 and mCX3CL1/CD4 chimera.
56 Chapter 3
Fig. 3-15: Flow cytometric analysis of the truncated mCX3CL1 variants and mCX3CL1/CD4 chimera [A] The previously generated truncated variants/chimeras were transfected in HEK293 cells and subsequently analysed for surface expression by flow cytometry using the goat α-mCX3CL1 antibody. The goat IgG antibody served as an isotype control and the α-goat FITC antibody was used for the detection. The wt mCX3CL1 served as control. A representative figure of three measurements is shown. [B] The mouse CX3CL1 wt (wt), the mouse CX3CL1 trunc (trunc) and the mouse CX3CL1/CD4 trunc (CD4 trunc) were gated (M1-3) for approximately 3% of isotype control. The median of the gated cells of three flow cytometric measurements is shown as mean and as standard deviation (SD). Statistical analysis was performed using one-way ANOVA followed by Dunnett post-hoc test. The p-values indicated as ** were smaller than 0.01.
In order to get a high and uniform expression of all CX3CL1 variants, HEK293 cells were
then stably transfected with mCX3CL1 and truncated mCX3CL1. Transfected HEK293 cells
were selected by mCX3CL1 geneticin (G418) treatment for 3-4 weeks. The cells were pre-
screened by ELISA for high concentrations of shed mouse CX3CL1 in the medium and
subsequently analysed by flow cytometry for similar surface expression profiles. According
to their similar surface expression profiles the following two cell clones were chosen for
further analysis: Clone #12 stably expressing mCX3CL1 and clone #16 stably expressing the
truncated mCX3CL1. Both surface expression profiles are shown in Fig. 3-16.
fluorescence intensity (log)
even
tsM1 M2 M3
wt trunc CD4 truncA
control
α-mCX3CL1
0
50
100
150
wttruncCD4 truncm
edia
n
B ****
fluorescence intensity (log)
even
tsM1 M2 M3
wt trunc CD4 truncA
control
α-mCX3CL1
fluorescence intensity (log)
even
tsM1 M2 M3
wt trunc CD4 truncA
control
α-mCX3CL1
0
50
100
150
wttruncCD4 truncm
edia
n
B ****
0
50
100
150
wttruncCD4 trunc
wttruncCD4 truncm
edia
n
B ****
Results 57
Fig. 3-16: Flow cytometric analysis of stable mCX3CL1- and mCX3CL1 trunc-HEK293 cells [A] Hek293 cells stably expressing mouse CX3CL1 (mCX3CL1-HEK293) and mouse CX3CL1 trunc (mCX3CL1 trunc-HEK293) were generated according to section 2.3.4 and subsequently analysed for CX3CL1 expression by flow cytometry using the goat α-mCX3CL1 antibody as indicated before. A representative figure of three independent experiments of the indicated cell lines is shown in [B].
After screening the HEK293 cell clones for similar surface expression, they were analysed
for the release of soluble mCX3CL1 in the absence or presence of the inhibitors for A10 and
A10/17. Conditioned medium and cell lysates of the mCX3CL1-HEK293 cells and
mCX3CL1 trunc-HEK293 cells were analysed for soluble and cell-associated forms of
mouse CX3CL1 by ELISA (Fig. 3-17).
A
forward scatter (lin)
side
scat
ter(
log)
B
even
ts
control
α-mCX3CL1
control
α-mCX3CL1
fluorescence intensity (log)
mCX3CL1-HEK293 mCX3CR1 trunc-HEK293
A
forward scatter (lin)
side
scat
ter(
log)
A
forward scatter (lin)
side
scat
ter(
log)
B
even
ts
control
α-mCX3CL1
control
α-mCX3CL1
fluorescence intensity (log)
mCX3CL1-HEK293 mCX3CR1 trunc-HEK293B
even
ts
control
α-mCX3CL1
control
α-mCX3CL1
fluorescence intensity (log)
mCX3CL1-HEK293 mCX3CR1 trunc-HEK293
58 Chapter 3
Fig. 3-17: Release of soluble mCX3CL1 in stable mCX3CL1-HEK293 and mCX3CL1 trunc-HEK293 cells using the A10 and A10/17 inhibitors The previously generated HEK293 cells stably expressing mouse CX3CL1 (mCX3CL1) and truncated mouse CX3CL1 (mCX3CL1 trunc) were analysed for shedding in the absence and presence of the specific inhibitors A10 and A10/17. ELISA data shown in the diagram are presented as released CX3CL1 in the medium [A], as released and cell-associated CX3CL1 in the medium and the cell lysate [B] and as release rate [C] representing the ratio between the amount of soluble CX3CL1 released in the medium and the total amount of all CX3CL1 molecules found in the medium and cell lysates (for details see section 2.4.4). The means and standard deviations (SD) of three independent experiments, performed as duplicates or triplicates, are shown. Statistical analysis was performed using two-way ANOVA followed by Bonferroni post-hoc test. The p-values indicated as *, **, *** were smaller than 0.05, 0.01, 0,001.
Interestingly, the amount of the shed CX3CL1 from the truncated variant was more than
twice as high as from the wt mCX3CL1. Release of mCX3CL1 trunc and mCX3CL1 were
B
A
rele
ased
CX3
CL1
in
the
med
ium
[pm
ol]
mCX3CL1 mCX3CL1 trunc0
2
4
6
C
controlA10A10/17
controlA10A10/17
rele
ased
& c
ell-a
ssoc
iate
dC
X3C
L1 [p
mol
]
mCX3CL1 mCX3CL1 trunc0
5
10
15
**
***
*
rele
ase
rate
[%]
0
20
40
60
80
mCX3CL1 mCX3CL1 trunc
controlA10A10/17
******
**
***
B
A
rele
ased
CX3
CL1
in
the
med
ium
[pm
ol]
mCX3CL1 mCX3CL1 trunc0
2
4
6
C
controlA10A10/17
controlA10A10/17
rele
ased
& c
ell-a
ssoc
iate
dC
X3C
L1 [p
mol
]
mCX3CL1 mCX3CL1 trunc0
5
10
15
0
5
10
15
**
***
*
rele
ase
rate
[%]
0
20
40
60
80
mCX3CL1 mCX3CL1 trunc
controlA10A10/17
controlA10A10/17
******
**
***
Results 59
similar inhibited by ADAM10. Notably, the cell-associated of truncated mCX3CL1 were
higher expressed than the wt mCX3CL1. Therefore, the release rate for the truncated variant
of mCX3CL1 was reduced compared to the wt (untruncated) variant. In the presence of the
inhibitors, the release rates of the truncated and un-truncated variants were both reduced to
about 25%.
In the experiments above HEK293 cells were generated expressing both mCX3CL1 variants
to a similar surface. Although even more soluble forms of truncated mCX3CL1 were found
in the medium, the A10 inhibitor showed similar inhibition ratios (approximately 75%) for
shedding of truncated and wt mCX3CL1. Therefore, a similar role for ADAM10 for the
release of both variants has to be considered. To analyse this effect more specifically
lentiviral shRNA knockdown of ADAM10 and ADAM17 was used in the stable HEK293
cells.
The lentiviral derived expression systems using shRNA sequences for ADAM10 and
ADAM17 knockdown were used (for details see section 2.3.5). Briefly, the shRNA
sequences were inserted into the lentiviral expression vector pLVTHM upon MluI and ClaI
restriction enzyme digest. They were then screened using EcoRI and ClaI and subsequently
verified by sequencing. Afterwards the HEK293 cells stably expressing mCX3CL1 and
mCX3CL1 trunc were transduced with the psPAX2 packaging vector, the pMD2.G envelope
vector and the pLVTHM vector containing the target sequences for ADAM10, ADAM17 and
control knockdown. Subsequently, the lentivirally transduced GFP expressing HEK293 cells
were first screened for GFP expression by flow cytometry. GFP positive cells were further
screened for the ADAM10 expression using the α-hA10 antibody (Fig. 3-18 [A]). The
generated HEK293 cell lines were then analysed for the release of soluble mCX3CL1 into
the medium by ELISA (Fig. 3-18 [B, C]).
Flow cytometry revealed that the ADAM10 shRNA knockdown occurred to a similar extent
for both truncated and untruncated mCX3CL1-expressing HEK293 cells. As shown in the
figure, the truncated mCX3CL1 variant was again released approximately 3-fold more as the
wt mCX3CL1. The specific shRNA knockdown for ADAM10 correlated with the reduced
release of the wt and the truncated mCX3CL1. Specific shRNA knockdown ADAM17,
however, did not reduce the release of mCX3CL1 and the mCX3CL1 variant, indicating that
ADAM10 rather than ADAM17 contributes to constitutive shedding of mouse CX3CL1.
60 Chapter 3
Fig. 3-18: Release of soluble mCX3CL1 by stable mCX3CL1-HEK293 and mCX3CL1 trunc-HEK293 cells using ADAM10 and ADAM17 shRNA knockdown The previously generated HEK293 cells stably expressing mouse CX3CL1 (mCX3CL1) and truncated mouse CX3CL1 (mCX3CL1 trunc) were transduced with specific double stranded RNA sequences for ADAM10 and ADAM17 using lentivral derived shRNA knockdown technology. [A] Control-shRNA and A10-shRNA transduced mCX3CL1-HEK293 cells and mCX3CL1 trunc-HEK293 cells were then screened for ADAM10 surface expression by gating for GFP positive cells and a following analysis by flow cytometry using the α-hA10, the mouse IgG2B isotype and the α-mouse APC antibodies. The mCX3CL1-HEK293 cells [B] and the mCX3CL1 trunc-HEK293 cells [C] were then analysed for the release of soluble CX3CL1 by ELISA. Data shown in the diagram are presented as released CX3CL1 in the medium. The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using two-way ANOVA followed by Bonferroni post-hoc test. The p-values indicated as *, ** were smaller than 0.05, 0.01.
As a summary, the release of soluble mCX3CL1 into the medium is influenced by different
domains distinct from the membrane proximal cleavage sites as shown by experiments using
transiently transfected HEK293 cells. Truncation of the C-terminal cytoplasmic tail of
mCX3CL1 showed the most pronounced reduction in the release of soluble CX3CL1 for
transient transfected cells. However, the truncation does not reduce the release of soluble
molecules into the conditioned medium, for the stably transfected HEK293 cells upon
selection for similar surface expression. This release of the truncated mCX3CL1 was also
shown to be inhibited to a similar degree as the release of the wt mCX3CL1 by shRNA
knockdown for ADAM10.
Are
leas
edC
X3C
L1
in th
em
ediu
m[p
mol
]
mCX3CL1 mCX3CL1 trunc
B
even
tsof
max
[%]
fluorescence intensity (log)
mCX3CL1-HEK293 mCX3CR1 trunc-HEK293
control-shRNA + isotype
Control-shRNA + α-hA10A10-shRNA + α-hA10
0
1
2
3
4
5
0
3
6
9
12
15* **control-shRNAA10-shRNAA17-shRNA
rele
ased
CX3
CL1
in
the
med
ium
[pm
ol] control-shRNA
A10-shRNAA17-shRNA
C
Are
leas
edC
X3C
L1
in th
em
ediu
m[p
mol
]
mCX3CL1 mCX3CL1 trunc
B
even
tsof
max
[%]
fluorescence intensity (log)
mCX3CL1-HEK293 mCX3CR1 trunc-HEK293
control-shRNA + isotype
Control-shRNA + α-hA10A10-shRNA + α-hA10
even
tsof
max
[%]
fluorescence intensity (log)
mCX3CL1-HEK293 mCX3CR1 trunc-HEK293
control-shRNA + isotype
Control-shRNA + α-hA10A10-shRNA + α-hA10
0
1
2
3
4
5
0
3
6
9
12
15* **control-shRNAA10-shRNAA17-shRNA
control-shRNAA10-shRNAA17-shRNA
rele
ased
CX3
CL1
in
the
med
ium
[pm
ol] control-shRNA
A10-shRNAA17-shRNA
control-shRNAA10-shRNAA17-shRNA
C
Results 61
3.2 The role of mouse CX3CL1 in adhesion and transmigration
In published data the function of human CX3CL1 has been predominately analysed. The
function of mouse CX3CL1 in adhesion and transmigration remains less understood. Here
the function of mouse CX3CL1 was analysed in these processes.
3.2.1 Adhesion of mouse CX3CL1
As shown in section 3.1 the HEK293 cells stably expressing the wt mouse CX3CL1 and the
truncated mouse CX3CL1 showed no differences in the constitutive release of soluble
CX3CL1 mediated by ADAM10. Since the truncated CX3CL1 contain no C-terminal
cytoplasmic tail, it was speculated that truncation of the cytoplasmic tail could alter the
function of CX3CL1 as an adhesion molecule, due to an impaired anchoring within the cell
surface membrane or impaired upstream signalling. It was therefore decided to test the
adhesion of both mCX3CL1 variants without the influence of the mouse CX3CR1 receptor
first.
For this purpose, the HEK293 cells stably expressing the wt and truncated mCX3CL1 were
seeded onto a 96-well plate that was coated with the rat α-mCX3CL1 antibody (for details
see section 2.3.8). Before and after several washing steps cell number were calculated upon
measuring the β-glucoronidase within the cells according to section 2.4.3 (Fig. 3-19). This
static adhesion assay showed that both truncated and untruncated mCX3CL1 variants
mediated up to 3-fold increase in adhesion after a single washing step compared to wt
HEK293 cells serving as control. After three times of washing, 40% of HEK293 cells stably
expressing the mCX3CL1 variants still remain attached to the antibody whereas the wt
HEK293 cells were nearly completely detached. However, there was no significant
difference in adhesion to a coated α-mCX3CL1 antibody after the first washing and the third
washing observed for the wt mCX3CL1 cells and the cells expressing the truncated
mCX3CL1 variant.
62 Chapter 3
Fig. 3-19: Adhesion of mCX3CL1 and mCX3CL1 trunc Wt HEK293 (control), mouse CX3CR1-expressing HEK293 cells (mCX3L1) and truncated mouse CX3CL1-expressing HEK293 cells (mCX3CL1 trunc) were seeded onto the rat α-mCX3CL1 antibody coated 96-well plate using 1,000 g for 1 min before the cells were washed up to four times with pre-warmed PBS. The cell number of the first [black] and the third [grey] washing step was related to the cell number of the seeded cells and shown in the diagram as percent adhered cells. The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using two-way ANOVA followed by Bonferroni post-hoc test. The p-values indicated as *, ** were smaller than 0.05, 0.01.
0
20
40
60
80
control
one washing stepthree washing steps
adhe
red
cells
[%]
mCX3CL1 mCX3CL1 trunc
****
0
20
40
60
80
0
20
40
60
80
control
one washing stepthree washing stepsone washing stepthree washing steps
adhe
red
cells
[%]
mCX3CL1 mCX3CL1 trunc
****
3.2.2 Transmigration of mouse CX3CL1
The results of the adhesion assay showed the adhesive capacity of the mouse CX3CL1.
Moreover, the truncated mCX3CL1 was shown above to have no influence on the adhesion
compared to the wt mCX3CL1. The capacity of mouse CX3CL1 in transmigration still
remains unclear. Since internal studies in the laboratory of Prof. Dr. Ludwig indicated that
the human CX3CR1 receptor functionally answers to mouse CX3CL1 by calcium influx, the
role of both wt and truncated mCX3CL1 variants in the process of leukocyte transmigration
using human isolated PBMCs was studied
For the transmigration analysis, a transwell system was established, in which the HEK293
cells expressing the wt and cells expressing the truncated mCX3CL1 variants functioned as a
cell monolayer in the upper well. As pre-test, human neutrophils were used which were
already well established in transmigration assays. They were isolated from blood of three
different donors aged between 28 to 42 years (for details see section 2.3.2) and then analysed
for the transmigration potency towards human IL-8 as stimulus in the lower chamber of the
transwell system containing ECV304 and HEK293 cells as a cell monolayer. From these pre-
experiments HEK293 cells were shown to be of comparable use for the transmigration assay
as the established ECV304 cells (data not shown).
Results 63
In a second step, human peripheral blood mononuclear cells (PBMCs) expressing the
receptor CX3CR1 were isolated from blood of three different donors aged around 30 years
(for details see section 2.3.2). They were examined for the surface expression of the human
receptor CX3CR1 by flow cytometry (Fig. 3-20 [A, B]).
In case the surface expression of the CX3CR1 within monocytic population was as high as
shown in the histogram, the PBMCs were further used for transmigration assays using
soluble human CX3CL1 and soluble human MCP-1 as stimuli. The number of cells in the
lower chamber and the number of cells at the beginning of the assay in the upper chamber
was measured using the β-glucoronidase assay and shown as percent migrated cells. As
shown in Fig. 3-20 [C, D], CX3CL1 resulted in an approximately 1.5-fold increased
transmigration rate compared to the non-stimulated control. MCP-1 mediated transmigration
of human PBMCs was found to be 2-fold increased compared to the non-stimulated control.
Fig. 3-20: Transmigration of PBMCs across wt HEK293 cells by soluble CX3CL1 and MCP-1 [A] The human PBMCs were isolated and screened for CX3CR1 expression by flow cytometry using the rat α-hCX3CR1-PE and IgG2bκ-PE isotype antibody. The total cell population was gated for monocyte population. [B] The fluorescence intensity of the gated population is shown. [C] The PBMCs with a minimum of CX3CR1 expressing rate as shown were studied for transmigration for 2.5 h towards 12 nM soluble human CX3CL1 with wt HEK293 cells. [D] PBMCs were also studied for transmigration towards 6 nM MCP-1. The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using paired two-tailed t-test. The p-values indicated as * were smaller than 0.05.
BA
side
scat
ter(
log)
C
controlhCX3CL1
mig
rate
dce
lls[%
] *
0
2
4
6
8
forward scatter (lin)
even
ts
fluorescence intensity (log)
control
α-hCX3CR1-PE
D
controlMCP-1
mig
rate
dce
lls[%
]
0
5
10
15
20
25 *
BA
side
scat
ter(
log)
C
controlhCX3CL1controlhCX3CL1
mig
rate
dce
lls[%
] *
0
2
4
6
8
forward scatter (lin)
even
ts
fluorescence intensity (log)
control
α-hCX3CR1-PE
D
controlMCP-1controlMCP-1
mig
rate
dce
lls[%
]
0
5
10
15
20
25 *
64 Chapter 3
The result described above showed that CX3CR1-expressing PBMCs could transmigrate
across HEK293 cells towards soluble hCX3CL1 as a stimulus. Recent findings showed for
the first time that transmembrane human CX3CL1 expressed on activated endothial cells
induces transmigration without soluble CX3CL1 as stimulus85. It was therefore interesting to
know, whether this effect might also be detectable for the mouse CX3CL1 and whether this
potential transmembrane CX3CL1-mediated transmigration is affected by the truncation of
C-terminal cytoplasmic tail.
For the transmigration assay wt HEK293 cells and HEK293 cells stably expressing
mCX3CL1 and mCX3CL1 trunc were seeded onto the transwell filter. Isolated human
PBMCs were then studied for transmigration in the absence of soluble human CX3CL1 (Fig.
3-21). This experiment showed that the percentage of migrated cell was increased from
approximately 4% to 7% when HEK293 cells expressed the mCX3CL1 variants. This
indicates that transmembrane mouse CX3CL1 is able to induce the transmigratory processes
of human PBMCs. However, there was no significant difference detectable between the
truncated mCX3CL1 and the un-truncated mCX3CL1 variant.
Fig. 3-21: Transmigration of PBMCs across HEK293 cells by transmembrane mouse CX3CL1 Human Peripheral Blood Mononuclear Cell (PBMCs) were isolated and screened for at least moderate CX3CR1 expression rates as shown above. They were then studied for transmigration for 2.5 h in the absence of soluble CX3CL1 using wt HEK293 cells and HEK293 cells stably expressing mouse CX3CL1 (mCX3CL1) and truncated mouse CX3CL1 (mCX3CL1 trunc). The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using one-way ANOVA followed by Bonferroni post-hoc test. The p-values indicated as * were smaller than 0.05.
The experiment above showed that transmembrane expressed mouse CX3CL1 is able to
induce transmigration of PBMCs expressing human CX3CR1. To finally test whether
transmembrane mCX3CL1 and the C-terminal truncated mCX3CL1 variant affect
*
mig
rate
dce
lls[%
] wtmCX3CL1mCX3CL1 trunc
*
0
2
4
6
8
10 *
mig
rate
dce
lls[%
] wtmCX3CL1mCX3CL1 trunc
wtmCX3CL1mCX3CL1 trunc
*
0
2
4
6
8
10
Results 65
transmigration induced by soluble CX3CL1, isolated PBMCs were studied for transmigration
across a HEK293 cell monolayer expressing no mCX3CL1 and both mCX3CL1 variants.
Additionally, soluble CX3CL1 and soluble MCP-1 were applied in the lower chamber of the
transwell system. As shown in Fig. 3-22, the percentage of migrated cell upon CX3CL1
stimulation was around 7-8% for all cell lines, which was approximately 1.5-fold higher than
the basal transmigration. However, no significant difference between wt HEK293 cells and
both mCX3CL1 and truncated mCX3CL1 expressing HEK293 cells was detectable. In
addition, the rate of MCP-1 induced migrated PBMCs across all cell lines was approximately
equal at around 15%, also showing 2-fold increase compared to basal transmigration. As for
the induced transmigration by soluble CX3CL1, the MCP-1-mediated transmigration was
affected neither by wt HEK293 cells, nor by mCX3CL1-HEK293 cells nor by mCX3CL1
trunc-HEK293 cells.
Fig. 3-22: Transmigration of PBMCs across mCX3CL1 variants expressing HEK293 cells by soluble CX3CL1 and MCP-1 Human Peripheral Blood Mononuclear Cell (PBMCs) were isolated and screened for like shown above. They were then studied for transmigration for 2.5 h in the presence of 12 nM soluble CX3CL1 [A] and 6 nM soluble MCP-1 [B] using wt HEK293 cells and HEK293 cells stably expressing mouse CX3CL1 (mCX3CL1) and truncated mouse CX3CL1 (mCX3CL1 trunc). The means and standard deviations (SD) of three independent experiments are shown. Statistical analysis was performed using one-way ANOVA. The dashed line represents the basal non-stimulated transmigration across HEK293 as obtained in the previous experiments mentioned above.
The mCX3CL1 variants with similar surface expression levels were studied for the
involvement of intracellular cytoplasmic tail of mouse CX3CL1 in adhesion and
transmigration. The experiments demonstrated that truncation of the cytoplasmic tail of
CX3CL1 does not affect the function of CX3CL1 in adhesion and transmigration.
BA
mig
rate
dce
lls[%
]
wtmCX3CL1mCX3CL1 trunc
0
3
6
9
12
mig
rate
dce
lls[%
]
wtmCX3CL1mCX3CL1 trunc
wtmCX3CL1mCX3CL1 trunc
0
3
6
9
12
mig
rate
dce
lls[%
]
wtmCX3CL1mCX3CL1 trunc
0
5
10
15
20
25
mig
rate
dce
lls[%
]
wtmCX3CL1mCX3CL1 trunc
wtmCX3CL1mCX3CL1 trunc
0
5
10
15
20
25
66 Chapter 4
4 4 DISCUSSION
Inflammatory leukocyte recruitment is mediated by many regulators like selectins,
glycosylated selectin ligands, proteoglycans, chemokines, chemokine receptors, intergrins,
cellular adhesion molecule as well as cellular junction molecules. Among the large family of
chemokines that induce directional cell migration an unusual member the CX3CL1
(fractalkine) is described, existing as a transmembrane mediating adhesion and
transmigration of leukocytes carrying the receptor CX3CR1. The transmembrane CX3CL1
can be converted into a soluble form that mediate directional cell migration. Thus, cleavage
by ADAM protein was proposed and indeed ADAM10 and ADAM17 were shown to cleave
CX3CL1141,146. However, it remains unclear whether mouse CX3CL1 would undergo a
similar cleavage and fulfil similar functions as the human CX3CL1.
To address this, distinct domains in mouse CX3CL1 that mediate cleavage by ADAM10 (and
ADAM17) and the function of mouse CX3CL1 as an adhesion and a transmigration molecule
were analysed and were as follows. The release of mouse CX3CL1 also involved ADAM10-
dependent cleavage mechanisms. Transient transfections of HEK293 cells also suggested that
the constitutive release of mouse CX3CL1 is not only affected by the mucin-like stalk region
containing the two potential cleavage site, but also by the extracellular chemokine domain,
the transmembrane domain and the intracellular cytoplasmic tail of mouse CX3CL1. The
cytoplasmic tail also seems to influence the trafficking of the molecule within the cell. After
selection for similar surface expression levels, the cytoplasmic tail, however, was shown not
to be involved in the ADAM10-mediated shedding. Furthermore, it was shown that the
cytoplasmic tail is not relevant for the function of mouse CX3CL1 as an adhesion and
transmigration molecule.
4.1 Characterisation of mouse CX3CL1
By Western blot analysis, the release of mouse CX3CL1 from transiently transfected human
HEK293 cells was characterised in comparison to the well known human CX3CL1 release.
Soluble forms of human and mouse CX3CL1 were shown to be released in the medium of
the transfected HEK293 cells. For the human CX3CL1 it was reported that a soluble form of
Discussion 67
approximately 70 kDa results from the shedding of the fully glycosylated mature
transmembrane form of CX3CL1 (90 kDA)141,146. For mouse CX3CL1 a soluble variant
slightly smaller than 70 kDa and a cell-associated 90 kDa variant were also detected.
The smaller mouse CX3CL1 proteins found in the cell lysates may represent not fully
glycosylated and therefore unmaturated forms of CX3CL1 as they have been already
described in the literature for human CX3CL152. In studies performed with surface
biotinylation of a CX3CL1/gp130 chimera it was shown that only the mature form of human
CX3CL1 is expressed on the surface (Institute of Biochemistry, Christian-Albrecht-
University zu Kiel, AG Ludwig, Diploma thesis by Ulrike Winter). This also suggested that
the soluble CX3CL1 represents the shed ectodomain of the mature 90 kDa chemokine. In this
thesis, pharmacological or transcriptional inhibition of endogenous ADAMs was not
performed, neither the deglycosylation of the smaller cell-associated form of CX3CL1.
However interestingly, the smaller protein found in the cell lysate differ slightly in size from
approximately 55 kDa (human) to approximately 60 kDa (mouse). The difference is maybe
due to differential glycosylation of the human and the mouse CX3CL1 in human embryonic
kidney cells.
Quantification of released forms of mouse and human CX3CL1 demonstrated that both
human and mouse CX3CL1 proteolytic cleavage was considerably suppressed by applying
the inhibitors separately or in combination. Although the inhibitor for ADAM10 (A10, IC50-
ADAM10 5.3 nM) was shown to be the more effective against ADAM10 than the dual-
specific inhibitor for ADAM10 and ADAM17 (A10/17, IC50-ADAM10 11.5 nM)146, the
results showed that the A10/17 inhibitor more efficiently blocks the release of both human
and mouse CX3CL1. However, the combinatorial application of both ADAM inhibitors (A10
and A10/17) resulted in the most significant inhibition. The residual release (one-fourth) of
human and mouse CX3CL1 forms suggest that other proteolytic cleavage processes could be
involved in the release of soluble CX3CL1. By the use of iTRAQTM labelling already an
involvement of the matrix metalloproteinase MMP-2 in the proteolytic cleavage of CX3CL1
was suggested153. In the brain also cathepsin S was shown to be involved in the release of
soluble CX3CL1154. These findings could be linked to recent studies on salivary glands,
which showed the release of a soluble 17 kDA CX3CL1 fragment155. This could suggest that
the generation of this smaller fragment could be due to further cleavage via MMP-2 or
cathepsin S.
68 Chapter 4
4.2 Analysis the shedding and trafficking of mouse CX3CL1
Cleavage sites for hCX3CL1
Purification of a 2zHis-tag fused human CX3CL1 molecule led to the identification of three
C-terminal fragments (CTFs) with an approximate size of 23, 24 and 25 kDa. After
deglycosylation of the terminal sialic acid residues and unsubstituted galactose disaccharides
found located in the O-glycosylated mucin-like stalk of CX3CL1, only the two smaller
fragments were detectable.
To narrow down the amino acid residues involved in the cleavage the theoretical molecular
mass of hCX3CL1-2zHis was calculated using a protein calculator (protein calculator v3.3,
copyright Chris Putman, The Scripps research institute). The cytoplasmic tail and the
transmembrane region together were calculated to be 22.44 kDa. The juxtamembrane mucin-
like stalk region of human CX3CL1 from amino acid 313 to 341 is described as EPIHATMD
PQRLGVILTPVPDAQAATRRQ, including the potentially O-glycosylated threonine (T)
residue at position 329 of the protein and the di-arginine motif (RR) at position 339 to 340.
The theoretical molecular mass of C-terminal fragments including both arginines was
calculated to be 22.017 kDa, whereas the fragment including the first threonine residues was
calculated to be 23.409 kDa. The next possible O-glycosylated threonine residue is located at
position 318 of the protein, which are 11 amino acids (1.242 kDa) upstream towards the N-
terminus. This suggested that one cleavage site could be located at or in close proximity to
the RR-motif, as already predicted52 and represented by the 23 kDa CTF1. The second
cleavage site is very likely to be located between the first two threonine residues (amino
acids 317 and 329) as indicated by the presence of the 24 kDa CTF2. These results further
supported the view that only two cleavage sites proximal to the membrane are used for the
cleavage of CX3CL1.
In this study the generated construct on the basis of human CX3CL1 was used, because the
mouse juxtamembrane sequence share great homology (311-EPIHATADPQ
KLSVILTPVPDTRQAATRRQ-339) to the human sequence as indicated by the non-
underlined amino acids. To clarify the cleavage of mouse CX3CL1 in more detail, a
constructs generated with this part of mouse CX3CL1 and the 2zHis tag could still be used.
The ectodomain cleavage of molecules from the cell surface by ADAM proteinases was
reported to be highly variable and is not dependent on consensus sequences within the
Discussion 69
cleaved proteins115,116. Hence, cleavage sites for the ADAM10 and/or ADAM17 in the
CX3CL1 protein cannot be predicted in detail so far.
Cleavage region of mouse CX3CL1
The deletion of the membrane proximal part of the mucin-like stalk of mCX3CL1 and its
substitution of the mucin-like stalk of mCX3CL1 by a poly glycine-serine linker resulted in
similar release rates of soluble mCX3CL1 compared to the wt mCX3CL1. Only the
substitution of the mucin-like stalk by that of an analogous mouse Ig-like C2-type 3 domain
CD4 domain showed a slight reduction in the release of the soluble form into the medium.
The results described in this thesis , however, are contrary to the reported CD4-CX3CL1
chimeras141, which clearly showed a considerably reduced release into the medium. These
studies were performed on the basis of earlier studies on the proteoglycan syndecan-1, which
reported to reduce PMA-induced shedding after substitution of the first 15 juxtamembrane
amino acids of the syndecan-1 by analogous human CD4156. Furthermore, the exchange of
the first 45 amino acids of the mucin-like stalk of CX3CL1 to that of analogous human CD4
sequences resulted in decreased PMA-induced ADAM17-mediated release of the chimera
into the conditioned medium. However, in the reported literature only exchange of the
juxtamembrane amino acids 15-30 and 1-45 resulted in a decreased release of soluble
CX3CL1, which was not the case for the changes of the amino acids 31-45, 1-30 and 1-15141.
This is also contrary to reports in which mutation of the R-R motif to a S-A motif, located
within the juxtamembrane amino acids 1-15, resulted in an decreased PMA-induced release
of the soluble human CX3CL1 into conditioned cell medium74,157.
One reasons for this contradictory data could be that the substitution by CD4 were slightly
different. In the published study by Garton et al. the juxtamembrane sequence of human CD4
(352-SKREKAVWV LNPEAGMWQC LLSDSGQVLL ESNIKVLPTW STPVQP-396) was
used, whereas here the sequence of mouse CD4 (317-MKVA QLNNTLTCEV
MGPTSPKMRL TLKQENQEAR VSEEQKVVQV VAPETGLWQC LLSEGDKVKM
DSRIQVLSRG VNQT-394) was used. Both sequences, however, do not share high
similarity, which might explain the different shedding behaviour.
Another interesting fact explaining differences in the shedding behaviour is that within the
studies by Garton et al. human CD4-CX3CL1 chimeras were investigated by the use of PMA
as an inducer for ADAM17-mediated shedding. Experiments in this thesis were performed in
70 Chapter 4
the absence of PMA in order to study rather the constitutive ADAM10-mediated shedding,
which might also explain the different observations of this thesis and the reported study141.
Although, mutations of the membrane proximal region of CX3CL1 might prevent ADAM17-
dependent cleavage141, the data in this thesis suggested that constitutive ADAM10-dependent
shedding may still occur and depend on more determinants than only the membrane proximal
region.
N-terminal chemokine domain of mouse CX3CL1
Exchange of the N-terminal chemokine domain to that of CCL5 resulted in an increased
overall release compared to the wt mCX3CL1.
The N-terminal chemokine domain was reported to be crucial for binding to the receptor
CX3CR1 and therefore also crucial for the function as a adhesion molecule for circulating
leukocytes78,79. In these studies single amino acid residues within the chemokine domain
were mutated or the total chemokine domain was substituted to that of IL-8, MCP-1 and
CCL5. However, in these reports the role of the chemokine domain in ADAM10-mediated
shedding processes was not studied.
The data presented in this study suggested that the chemokine domain of CX3CL1 could
even have an inhibitory function for ADAM10. The fact that the overall shedding of this
CCL5/mCX3CL1 was increased could probably explain reported data showing reduced flow
adhesion of the CCL5-human CX3CL1 chimera78.
Transmembrane and C-terminal region of mouse CX3CL1
Substitution of C-terminal part mouse CX3CL1 (from amino acid 262 on) by analogous
regions of mouse CD4 containing the Ig-like C2-type 3 domain, the transmembrane domain
and the intracellular C-terminal cytoplasmic tail resulted in increased release compared to wt
mCX3CL1, which was due to an increase in ADAM10-dependent mechanisms.
Moreover, this increase release was supported by the findings that mouse CD4 itself was also
released into the medium. The involvement of ADAM10- and/or ADAM17-mediated
mechanisms was not further investigated, but could still lead to interesting observation about
CD4, which seems to be proteolycically processed. This cleavage could be performed by
proteinases and maybe also in particular by ADAM10 and ADAM17, which would explain
that shedding of mCX3CL1 still occurs after substitution by analogous CD4 domains.
Discussion 71
Since ADAM10 and its substrate CX3CL1 are molecules expressed on the cell surface and
contain an intracellular cytoplasmic tail, this tail might be a region of interaction, maybe by
direct contact or indirectly through binding of adaptor molecules leading to the regulation of
shedding by ADAM10 and ADAM17. At least for ADAM12 an intracellular interaction with
an adaptor molecule Eve-1 was shown to regulate the shedding of EGF receptor ligands152.
It was shown by Western blotting that truncation of the intracellular cytoplasmic tail of wt
mouse CX3CL1 and of the chimeric mouse CX3CL1/CD4 molecule did not affect the correct
expression on the cell surface. A release of both truncated mCX3CL1 variants was still
observed. But this reduced release was most pronounced for the truncated mCX3CL1, which
was due to a reduction of ADAM10-mediated release. Interestingly, the truncation of the
mCX3CL1/CD4 could not further reduce the release of this molecules compared to the full-
length mCX3CL1/CD4 chimera. This release was shown to be mediated also by ADAM10-
dependent mechanisms.
From these experiments with transiently transfected cells, it seems that truncation of the
intracellular cytoplasmic tail blocks the ADAM10-mediated release as shown for the
mCX3CL1. This corresponded with the findings in this thesis that ionomyin-induced
ADAM10-activity lead to enhanced shedding of the wt mCX3CL1, but only slightly
increased the shedding for the truncated mCX3CL1. However, the truncation of mCX3CL1
did not further reduce the degree of release, indicating that truncation of the cytoplasmic tail
of CX3CL1 is also not affecting ADAM10 independent proteolytic cleavage by other
proteinases. The question still rises, what other protein could proteolytically cleave CX3CL1.
As already mentioned MMP-2 and cathepsin S could be involved in the cleavage of
CX3CL1153,154.
Analysis of wt and truncated mouse CX3CL1 regarding shedding and trafficking
Both variants were expressed on the cell surface and could be found within the cells in
perinuclear golgi-like structures as shown by immunomicroscopy. However, distinct vesicle-
like structures within the cell as observed for the wt CX3CL1 form could not be detected.
These findings are consistent with current studies, showing that the cargo adaptor protein
(AP2) binds to the intracellular cytoplasmic tail of human CX3CL1 and is thereby involved
in the clathrin dependent internalisation of CX3CL1 from the cell surface54. The comparison
of amino acid sequences of the cytoplasmic tails of human and mouse forms also revealed
that also mouse CX3CL1 contains an AP2 protein binding motif (360-YQSL-363) suggesting
72 Chapter 4
a clathrin dependent internalisation also of the mouse CX3CL1. Furthermore, human
CX3CL1 was shown to be associated with soluble N-ethylmaleimide-sensitive-factor
attachment receptor (SNARE) proteins responsible for the fusion of trafficking vesicles57. A
further hint for the regulation of endocytosis by CX3CL1 was provided by studies with a
truncated human CX3CL154. This mutant was reported to be expressed in elevated levels on
the cell surface probably due to an impaired endocytosis. Data of this thesis obtained by
transient transfection also indicated high expression of truncated CX3CL1. But confocal
microscopic analysis could not exactly reveal whether trafficking to the cell surface or re-
internalisation of mouse CX3CL1 from the cell surface is affected by truncation of the
cytoplasmic tail or not.
Cells stably expressing the truncated and the wt mCX3CL1 were then generated and selected
for similar surface expression levels of CX3CL1. Notably, increased levels of released
molecules of the truncated mCX3CL1 variant were detected in the cell lysate suggesting an
altered trafficking upon C-terminal truncation. Furthermore, the released forms of the
truncated mCX3CL1 were remarkably increased in the medium suggesting that shedding via
ADAM10 could not be affected upon truncation. Pharmacological targeting of the ADAM10
by the inhibitor A10 results in similar inhibitory rate for the truncated as for the wt CX3CL1,
which was contradictory to experiments using transient transfections.
Lentivirally derived short hairpin RNA (shRNA) knockdown technology was used to
downregulate ADAM10 and ADAM17 in HEK293 stably expressing either the wt or the
truncated mCX3CL1. Only the specific ADAM10 shRNA knockdown resulted in a
decreased release of wt and truncated mCX3CL1 in the medium, whereas the specific
knockdown of ADAM17 did not influence the mCX3CL1 release.
This is a clear evidence for the involvement of ADAM10 in the constitutive shedding of
mouse CX3CL1 in human embryonic kidney cells, although it has to be considered that the
specific ADAM10 and ADAM17 shRNA knockdowns were not totally efficient. Since the
transcriptional targeting of ADAM10 was not as efficient as the pharmacological targeting it
has also been considered that the inhibitor for ADAM10 could inhibit other proteinases,
which could be potentially involved in the shedding of mCX3CL1 (e.g. MMP-2153).
But still, results on mouse CX3CL1 shedding mediated by ADAM10 are in line with data,
showing that ADAM10 is responsible for the constitutive shedding of human CX3CL1146,
whereas ADAM17 could responsible for the PMA-induced shedding of human CX3CL1141.
Discussion 73
Thus, it can be concluded that in the experiments described above constitutive release of
mCX3CL1 was mainly mediated by ADAM10-dependent mechanisms.
Therefore it finally became clear that truncation of the intracellular cytoplasmic tail is not
affecting the shedding/release of mCX3CL1 by ADAM10, as it was suggested by transient
transfections of HEK293 cells.
Therefore, it has to be considered that the reduced release rate of the stable mCX3CL1-
HEK293 cells is not necessarily a result of different release/shedding behaviour, but maybe
related to a different protein expression level and/or different cellular trafficking behaviour.
As shown by ELISA for released CX3CL1 in the medium, shedding still occurs to a similar
degree, regardless of the truncation of the intracellular cytoplasmic tail.
Despite the mutations in different domains of the CX3CL1 molecules, a non-cleavable and
even a less-cleavable mouse CX3CL1 variant could not be generated. This is in accordance
to the fact that no consensus sequence for ADAMs in general, nor for ADAM10 and
ADAM17 in particular, could be found. This could also support the view that not the
substrate itself drives the ADAMs to cleave, but maybe more the structural organisation
within “lipid environment” or maybe just the membrane itself. This idea , however, is still
contrary to the reported studies on non/less-cleavable L-selectin, TNF-α, in which deletion of
the amino acids of the juxtamembrane region (7 amino acids for L-selectin, 14 amino acids
for TNF-α) nearly completely decreased shedding of these molecules mediated by
ADAM17158,159. Although contrary to the reported study on the mutation of the potential
cleavage site (R-R to S-A) for CX3CL1, the study by Garton et al. described a reduced
shedding/release of mutated CX3CL1 to a CD4-CX3CL1 chimeric molecules141. But it has to
be mentioned that both molecules described above were analysed for PMA-induced shedding
by ADAM17 and not for constitutive ADAM10-mediated shedding. The relevance of this
artificial PMA-induced shedding model in a more physiological background, however, can
still be questioned.
4.3 The cytoplasmic tail in the function of mouse CX3CL1
The truncation of the intracellular C-terminal cytoplasmic tail of mouse CX3CL1 had no
influence on ADAM10-mediated shedding. It was then speculated that the cytoplasmic tail
could still have an influence on the function of CX3CL1 as a domain mediating adhesion and
74 Chapter 4
transmigration, because the cytoplamic tail could either affect anchoring of the molecule
within the cell membrane or could also affect signalling via potential tyrosine motifs located
within the cytoplasmic tail function as interaction/ binding motifs for various cellular
molecules.
Adhesion of cells expressing the mouse CX3CL1 to an anti-mCX3CL1 antibody was
increased compared to cells not expressing mouse CX3CL1. However, this increased
adhesion was not affected by the truncation of mouse CX3CL1.
This clearly supported the view that mouse CX3CL1 can also function as an adhesion
molecule independently of the C-terminus. This proposed function of mouse CX3CL1
matches with the first description of human CX3CL1, which was reported to be involved in
the adhesion of leukocyte subsets expressing the receptor CX3CR1. These studies also
showed that the interaction for the adhesion of the chemokine to its receptor occurs at the N-
terminal chemokine domain and not with the mucin-like stalk78,79. So far the influence of the
C-terminus in the adhesion process was not investigated. But tyrosine motifs within the
cytoplasmic tail of the chemokine were proposed to be involved in the binding of adaptor
molecules involved in cellular trafficking54,57. At least for ADAM12 and EGF receptor
ligands an adaptor protein Eve-1 was shown to be involved in the cleavage152.
From the data obtained in this thesis it has to be considered that the intracellular cytoplasmic
tail, however, is not affecting the function of mouse CX3CL1 as an adhesion molecule.
CX3CL1, which is expressed in the cell membrane, was shown to induce transmigration of
PBMCs across the cell monolayer. In contrast to MCP-1 the soluble form of CX3CL1 was
not able to further increase the transmigration rate already mediated by the transmembrane
form of CX3CL1.
This indicates that CX3CL1 as its transmembrane form can induce transmigration
independent of soluble CX3CL1 acting as a chemotatic stimulus. These results are supported
by other current studies providing evidence for a Gi-protein signalling dependent
transmigration of CX3CR1-expressing cells mediated by binding of human transmembrane
CX3CL1 to its receptor CX3CR185. It can also be considered that mouse CX3CL1 functions
as a transmigration molecule as it was also shown for human CX3CL1 recruiting several
leukocyte subpopulations52,71,160. But it also needs to be mentioned that there are other studies
published demonstrating that soluble MCP-1 induce higher transmigration rate than soluble
CX3CL161,161,162, as this was also indicated in the experiments in this thesis.
Discussion 75
Truncation of the intracellular C-cytoplasmic tail did not reduce or increase transmigration of
PBMCs neither by transmembrane CX3CL1, nor by soluble CX3CL1 and nor by MCP-1.
This clearly suggests that the cytoplasmic part of mouse CX3CL1 is neither relevant for
adhesion nor for transmigration in response to transmembrane CX3CL1. The truncation of
the mouse CX3CL1 had no influence on the ADAM10-mediated shedding. Thus, a
connection of mCX3CL1 truncation and transmigration across a cell monolayer via
ADAM10 cannot be drawn. Therefore, shedding of CX3CL1 could still be involved in the
regulation of this transmigration, which was for example directly shown for the cell junction
associated molecules VE-cadherin and JAM-A145,163.
The cytoplasmic tail of CX3CL1 contains tyrosine residues within potential adaptor molecule
binding sites (360-YQSL-363 & 390-YVLV-393), suggesting their role in signalling events
and therefore maybe also in the process of transmigration. From these data, however, it
seems unlikely that also the intracellular signalling events induced by the cytoplasmic tail of
CX3CL1 contribute to the function of mouse CX3CL1 as an adhesion and a transmigration
molecule.
Hence, it was shown that mouse CX3CL1 similar to human CX3CL1 is a chemokine
involved in adhesion on the one hand, and in transmigration on the other hand. Both
processes are independent of a potential regulation by the intracellular tail as it was shown by
experiments using a truncated CX3CL1 variant.
76 Chapter 5
5 5 CONCLUSIONS AND OUTLOOK
In this thesis the determinants involved in the shedding of mouse CX3CL1 by ADAM10 and
ADAM17 and the role of the intracellular cytoplasmic tail of mouse CX3CL1 for adhesion
and transmigration was studied. The results obtained in this thesis led to following
conclusions:
1. By pharmacological inhibition, mouse CX3CL1 was shown to be shed by
ADAM10- (and ADAM17)-mediated mechanisms. Constitutive shedding of mouse
CX3CL1 predominantly occurs via ADAM10- and not via ADAM17-mediated
mechanisms. The obtained results confirm published data on human CX3CL1
shedding mediated by ADAM family proteases.
2. ADAM10-mediated constitutive shedding of mouse CX3CL1 occurs closely to
the membrane at two cleavage sites, most likely at/close to the R-R motif and
between the first two membrane proximal threonine residues. This shedding is likely
to be influenced by multiple determinants such as the chemokine domain, the mucin-
like stalk, as shown by transient transfection of cells with mutated mouse CX3CL1
chimeras/variants.
3. Truncation of the cytoplasmic tail of mouse CX3CL1 affects cellular
trafficking as indicated by its absence in vesicular-like structures within the cell.
4. When wt and truncated mouse CX3CL1 were selected for similar surface
expression levels, ADAM10-mediated shedding was not affected in the absence of
the cytoplasmic tail. The truncation does also not affect the function of the
transmembrane mouse CX3CL1 as an adhesion and a transmigration molecule. This
suggests that signalling events of mouse CX3CL1 are not involved in the regulation
of the leukocyte transmigration.
Conclusions and outlook 77
ADAM10 mCX3CL1
CX3C
Fig. 5-1: Shedding and function of mouse CX3CL1 In this thesis it was demonstrated that mouse CX3CL1 is predominately shed by ADAM10-dependent mechanisms [1] at two cleavage sites proximal to the membrane [2]. The cytoplasmic tail of mouse CX3CL1 affects the cellular trafficking [3], but not the function of mouse CX3CL1 in adhesion and transmigration [4].
ADAM10
CX3C
truncatedmCX3CL1
COOH
COOH
CX3C
1
Protein biosynthesis
2
3
3
4 4
2 ?
1
CX3CR1 CX3CR1
ADAM10 mCX3CL1
CX3C
ADAM10
CX3C
truncatedmCX3CL1
COOH
COOH
CX3CCX3C
11
Protein biosynthesis
22
33
33
44 44
22 ?
11
CX3CR1 CX3CR1
78 Chapter 5
One open question is still how ADAM10- and ADM17-mediated shedding of CX3CL1, in
particular mouse CX3CL1, is exactly regulated. The exact cleavage sites for ADAM family
proteases could be still useful for further studies. By usage of the human CX3CL1-2zHis
construct, N-terminal sequencing (Edman degradation) of the C-terminal fragments or peptide
mapping in combination with LC-MS/MS (liquid chromatography with tandem mass
spectrometry detection) could identify the first amino acids of the CTFs and thereby the
respective cleavage sites. Same experiments could also be performed with the mouse
CX3CL1. A point, which is also still not clear, is whether ADAM17 use the same two
potential cleavage sites, shown to be involved in the constitutive shedding by ADAM10.
It could also still be that the cleavage site itself maybe in combination with other domains
within the CX3CL1 molecule regulates shedding. And if so, how can these domains now be
exactly characterised? From the obtained data, which suggest the involvement of multiple
domains in the shedding process, it seems to be a very difficult task to generate CX3CL1
molecules constitutively non-cleavable by ADAM10. This is underlined by the fact that all
published data were performed on mutated molecules (L-selectin, TNF-α and hCX3CL1),
which were only shown to be resistant against ADAM17-mediated mechanisms. In this
context, however, it can be questioned, if these PMA-induced shedding by ADAM17 can be
used as a relevant activator for physiological or patho-physiological shedding events. Apart
from that, it could still be that also the orientation of the ADAMs and their substrates within
the membrane (e.g. lipid rafts) drives the cleavage process.
Another interesting focus could be the targeting of mouse ADAM10 and ADAM17, since all
performed experiments were pharmacological and transcriptional targeting human ADAM10
and ADAM17. Since high residual ADAM10- and ADAM17-independent shedding was
observed in this thesis it could also be worthwhile to screen for further proteinases potentially
cleaving human and mouse CX3CL1.
The obtained data clearly showed the function of mouse CX3CL1 as an adhesion and a
transmigration molecule, as this was also shown for the human CX3CL1. Although it was
found that truncation of mouse CX3CL1 seems to have no influence on the shedding
behaviour it could be still of interest to see whether pharmacological or transcriptional
targeting of ADAM10 could have an impact in adhesion or transmigration assays mediated by
truncated mouse CX3CL1. This could still further answer questions (if and) how shedding of
mouse CX3CL1-mediated by ADAM10 and ADAM17 is involved in these processes. But
Conclusions and outlook 79
since the C-terminus of CX3CL1 is most likely to be not involved in the regulation of these
processes, it can also be questioned what mechanisms drive adhesion and transmigration. To
further answer these questions the C-terminus of the ADAMs could also become focus, since
signalling events could be important on this site.
Furthermore, these assays could be transferred on the other transmembrane chemokine
CXCL16, which is also shed by ADAM10 and ADAM17. It would be very interesting to see,
how the intracellular cytoplasmic tail of CX3CL1 affects shedding by ADAM10 and
ADAM17 and also its function as an adhesion molecule for leukocytes.
It was indicated in this thesis that transmembrane mouse CX3CL1 can induce transmigration.
This transmigration which was not further increased by soluble CX3CL1, the function of
soluble CX3CL1 in transmigration could also be questioned. It would be interesting to see,
whether the CX3C-chemokine domain presented by proteoglycans could also lead to
shedding by the ADAMs and/or also can induce transmigration. This could further identify
the function of this exceptional chemokine presented on endothelial cell by a mucin-like stalk.
An interaction of the N-terminal chemokine domain of CX3CL1 to its CX3CR1 was already
shown for the human CX3CL1. To see whether this would be true for the mouse CX3CL1,
generation of cells stably expressing the CCL5/mCX3CL1 chimeric protein could be useful.
Interestingly, the C-terminus of mouse CX3CL1 seems to be involved in the trafficking to /
from the cell surface membrane. To further characterise this involvement in trafficking,
screening for trafficking vesicles associated molecules like clathrin, snare protein, rab
proteins, or the early endosomal antigen 1 (EEA1) might be useful. As an example, an
association of other adhesion molecules with trafficking associated molecules was already
shown for the interaction of the proteoglycan syndecan-1 with the rab5 molecule, which
regulated the ectodomain shedding of syndecan-1164.
To further analyse a more physiological setting of leukocyte recruitment within this disease
with regards to the mouse CX3CL1-CX3CR1 interaction, stable cell lines expressing the
mouse CX3CL1 could be generated. This could be obtained with the help of lentiviral derived
gene transduction as this was already successfully shown for the shRNA knockdown of
ADAM10. This shRNA targeting could be also used to knockdown human CX3CL1 by
targeting the untranslated regions of the CX3CL1 gene in human umbilical vein endothelial
80 Chapter 5
cells (HUVECs) and further reconstitute these cells with the mouse CX3CL1 to generate a
rather physiological background of primary cells.
It is clear from the published data that the CX3CL1-CX3CR1 interaction, in addition to other
chemokine interactions, contributes to the accumulation of monocytes in inflammatory
associated atherosclerotic lesions. While the study was in progress transgenic mice have been
recently generated using baculovirus derived gene delivery vectors. The mice either express
the wt CX3CL1, the soluble chemokine domain of CX3CL1 or the C-terminal truncated
CX3CL1 under an endogenous gene promoter. These animals could still reveal the role of
soluble CX3CL1 and the role of the C-terminus of CX3CL1 in progression of diseases such
as atherosclerosis.
Summary 81
6 6 SUMMARY
Leukocytes are recruited from the blood vessel wall towards the inflamed tissue. This process
occurs in multiple steps and is regulated in part by chemokines. Among the large family of
chemokines that mediate directional cell migration an unusual member the CX3CL1
(fractalkine) is described existing as a transmembrane and a soluble molecule. The generation
of this soluble CX3CL1 molecule occurs upon ectodomain shedding by metalloproteinases, in
particular by ADAM10. By binding to the receptor CX3CR1 the transmembrane CX3CL1
mediates adhesion and transmigration of leukocytes subpopulations. Up to date, it is not clear
how ADAM10 contributes to the function of mouse CX3CL1. The goal of this thesis was to
characterise the molecular determinants of mouse CX3CL1 for shedding and function of this
molecule.
Results of this study demonstrated that mouse CX3CL1 is predominately shed by ADAM10-
dependent mechanisms as shown by pharmacological inhibition and transcriptional silencing.
As described for human CX3CL1, shedding of mouse CX3CL1 is enhanced by ionomycin
treatment, which also involves ADAM10-activity. Deletion and replacement of the cleavage
region of mouse CX3CL1 could not further abrogate its release suggesting that other domains
of mouse CX3CL1 may influence this process. And indeed, release of mouse CX3CL1 was
found to be further influenced by the chemokine domain and also the cytoplasmic tail.
However, truncation of the cytoplasmic tail led also to impaired cellular trafficking. In fact,
when wt mouse CX3CL1 and the truncated variant were sufficiently expressed on the cell
surface, both were still shed. Additionally, adhesion and transmigration experiments with
human PBMCs revealed that the truncation did not affect the function of the transmembrane
mouse CX3CL1 as an adhesion and a transmigration molecule. This latter finding suggests
that potential signalling events induced by the cytoplasmic tail of CX3CL1 are not involved in
the recruitment of leukocytes to the inflamed tissue.
This work indicates that multiple molecular determinants within mouse CX3CL1 influence its
shedding via ADAM10, suggesting that exchange of several domains of mouse CX3CL1
cannot completely prevent its shedding. The cytoplasmic tail of mouse CX3CL1 appears to be
relevant for correct trafficking of mouse CX3CL1 but neither for shedding, adhesion or
transmigration. Nevertheless, shedding of CX3CL1 by ADAM10 and ADAM17 could still
represent a crucial step within the leukocyte recruitment process in developing vascular
diseases such as atherosclerosis.
References 83
7 7 REFERENCES
1. Janeway, C.A. Immunobiology, (Garland Science Publishing Group, 2001). 2. Dinarello, C.A. The IL-1 family and inflammatory diseases. Clinical and
experimental rheumatology 20, S1-13 (2002). 3. Hamilton, T.A., Ohmori, Y. & Tebo, J. Regulation of chemokine expression by
antiinflammatory cytokines. Immunologic research 25, 229-245 (2002). 4. Luster, A.D. Chemokines--chemotactic cytokines that mediate inflammation. The
New England journal of medicine 338, 436-445 (1998). 5. Medzhitov, R. Recognition of microorganisms and activation of the immune
response. Nature 449, 819-826 (2007). 6. Bargatze, R.F., Jutila, M.A. & Butcher, E.C. Distinct roles of L-selectin and
integrins alpha 4 beta 7 and LFA-1 in lymphocyte homing to Peyer's patch-HEV in situ: the multistep model confirmed and refined. Immunity 3, 99-108 (1995).
7. Springer, T.A. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76, 301-314 (1994).
8. von Andrian, U.H., et al. Two-step model of leukocyte-endothelial cell interaction in inflammation: distinct roles for LECAM-1 and the leukocyte beta 2 integrins in vivo. Proceedings of the National Academy of Sciences of the United States of America 88, 7538-7542 (1991).
9. Ley, K., Laudanna, C., Cybulsky, M.I. & Nourshargh, S. Getting to the site of inflammation: the leukocyte adhesion cascade updated. Nature reviews 7, 678-689 (2007).
10. DeFranco, Locksley & Robertson. Figure 3-41 (Recruitment of leukocytes to sites of infection). in Primers in Biology - Immunity http://www.new-science-press.com/info/illustration_files/nsp-immunity-3-14-13_41.jpg (New Science Press Ltd., Oxford, UK, 11.08.2009).
11. Bevilacqua, M.P., Stengelin, S., Gimbrone, M.A., Jr. & Seed, B. Endothelial leukocyte adhesion molecule 1: an inducible receptor for neutrophils related to complement regulatory proteins and lectins. Science (New York, N.Y 243, 1160-1165 (1989).
12. Ley, K. & Kansas, G.S. Selectins in T-cell recruitment to non-lymphoid tissues and sites of inflammation. Nature reviews 4, 325-335 (2004).
13. McEver, R.P., Moore, K.L. & Cummings, R.D. Leukocyte trafficking mediated by selectin-carbohydrate interactions. The Journal of biological chemistry 270, 11025-11028 (1995).
14. Dimitroff, C.J., Lee, J.Y., Fuhlbrigge, R.C. & Sackstein, R. A distinct glycoform of CD44 is an L-selectin ligand on human hematopoietic cells. Proceedings of the National Academy of Sciences of the United States of America 97, 13841-13846 (2000).
15. Zimmerman, T. & Blanco, F.J. Inhibitors targeting the LFA-1/ICAM-1 cell-adhesion interaction: design and mechanism of action. Current pharmaceutical design 14, 2128-2139 (2008).
16. Staunton, D.E., Dustin, M.L. & Springer, T.A. Functional cloning of ICAM-2, a cell adhesion ligand for LFA-1 homologous to ICAM-1. Nature 339, 61-64 (1989).
17. Furie, M.B., Tancinco, M.C. & Smith, C.W. Monoclonal antibodies to leukocyte integrins CD11a/CD18 and CD11b/CD18 or intercellular adhesion molecule-1
84 Chapter 7
inhibit chemoattractant-stimulated neutrophil transendothelial migration in vitro. Blood 78, 2089-2097 (1991).
18. Luscinskas, F.W., et al. Cytokine-activated human endothelial monolayers support enhanced neutrophil transmigration via a mechanism involving both endothelial-leukocyte adhesion molecule-1 and intercellular adhesion molecule-1. The Journal of immunology 146, 1617-1625 (1991).
19. Smith, C.W., et al. Recognition of an endothelial determinant for CD 18-dependent human neutrophil adherence and transendothelial migration. The Journal of clinical investigation 82, 1746-1756 (1988).
20. Alon, R., et al. The integrin VLA-4 supports tethering and rolling in flow on VCAM-1. The Journal of cell biology 128, 1243-1253 (1995).
21. Huo, Y. & Ley, K. Adhesion molecules and atherogenesis. Acta physiologica Scandinavica 173, 35-43 (2001).
22. Huang, S., Paulauskis, J.D., Godleski, J.J. & Kobzik, L. Expression of macrophage inflammatory protein-2 and KC mRNA in pulmonary inflammation. The American journal of pathology 141, 981-988 (1992).
23. Smith, W.B., Gamble, J.R., Clark-Lewis, I. & Vadas, M.A. Interleukin-8 induces neutrophil transendothelial migration. Immunology 72, 65-72 (1991).
24. Middleton, J., Patterson, A.M., Gardner, L., Schmutz, C. & Ashton, B.A. Leukocyte extravasation: chemokine transport and presentation by the endothelium. Blood 100, 3853-3860 (2002).
25. Muller, W.A., Weigl, S.A., Deng, X. & Phillips, D.M. PECAM-1 is required for transendothelial migration of leukocytes. The Journal of experimental medicine 178, 449-460 (1993).
26. Garrido-Urbani, S., Bradfield, P.F., Lee, B.P. & Imhof, B.A. Vascular and epithelial junctions: a barrier for leucocyte migration. Biochemical society transactions 36, 203-211 (2008).
27. Pruessmeyer, J. & Ludwig, A. The good, the bad and the ugly substrates for ADAM10 and ADAM17 in brain pathology, inflammation and cancer. Seminars in cell & developmental biology (2008).
28. Bixel, G., et al. Mouse CD99 participates in T-cell recruitment into inflamed skin. Blood 104, 3205-3213 (2004).
29. Bixel, M.G., et al. A CD99-related antigen on endothelial cells mediates neutrophil but not lymphocyte extravasation in vivo. Blood 109, 5327-5336 (2007).
30. Dejana, E., Spagnuolo, R. & Bazzoni, G. Interendothelial junctions and their role in the control of angiogenesis, vascular permeability and leukocyte transmigration. Thrombosis and haemostasis 86, 308-315 (2001).
31. Shaw, S.K., Bamba, P.S., Perkins, B.N. & Luscinskas, F.W. Real-time imaging of vascular endothelial-cadherin during leukocyte transmigration across endothelium. The Journal of immunology 167, 2323-2330 (2001).
32. Charo, I.F. & Ransohoff, R.M. The many roles of chemokines and chemokine receptors in inflammation. The New England journal of medicine 354, 610-621 (2006).
33. Moser, B., Wolf, M., Walz, A. & Loetscher, P. Chemokines: multiple levels of leukocyte migration control. Trends in immunology 25, 75-84 (2004).
34. Kelner, G.S., et al. Lymphotactin: a cytokine that represents a new class of chemokine. Science (New York, N.Y 266, 1395-1399 (1994).
35. Kelner, G.S. & Zlotnik, A. Cytokine production profile of early thymocytes and the characterization of a new class of chemokine. Journal of leukocyte biology 57, 778-781 (1995).
References 85
36. Charo, I.F. & Taubman, M.B. Chemokines in the pathogenesis of vascular disease. Circulation research 95, 858-866 (2004).
37. Schober, A. Chemokines in vascular dysfunction and remodeling. Arteriosclerosis, thrombosis, and vascular biology 28, 1950-1959 (2008).
38. Kobayashi, Y. Neutrophil infiltration and chemokines. Critical reviews in immunology 26, 307-316 (2006).
39. Huo, Y., et al. The chemokine KC, but not monocyte chemoattractant protein-1, triggers monocyte arrest on early atherosclerotic endothelium. The Journal of clinical investigation 108, 1307-1314 (2001).
40. Gerard, C. & Rollins, B.J. Chemokines and disease. Nature immunology 2, 108-115 (2001).
41. Rossi, D. & Zlotnik, A. The biology of chemokines and their receptors. Annual review of immunology 18, 217-242 (2000).
42. Fernandez, E.J. & Lolis, E. Structure, function, and inhibition of chemokines. Annual review of pharmacology and toxicology 42, 469-499 (2002).
43. Murphy, P.M. International Union of Pharmacology. XXX. Update on chemokine receptor nomenclature. Pharmacological reviews 54, 227-229 (2002).
44. Zlotnik, A. & Yoshie, O. Chemokines: a new classification system and their role in immunity. Immunity 12, 121-127 (2000).
45. Murphy, P.M., et al. International union of pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacological reviews 52, 145-176 (2000).
46. Murdoch, C. & Finn, A. Chemokine receptors and their role in vascular biology. Journal of vascular research 37, 1-7 (2000).
47. Rodriguez-Frade, J.M., Mellado, M. & Martinez, A.C. Chemokine receptor dimerization: two are better than one. Trends in immunology 22, 612-617 (2001).
48. Rajagopalan, L. & Rajarathnam, K. Structural basis of chemokine receptor function--a model for binding affinity and ligand selectivity. Bioscience reports 26, 325-339 (2006).
49. Murdoch, C. & Finn, A. Chemokine receptors and their role in inflammation and infectious diseases. Blood 95, 3032-3043 (2000).
50. Murphy, P.M. The molecular biology of leukocyte chemoattractant receptors. Annual review of immunology 12, 593-633 (1994).
51. Dorsam, R.T. & Gutkind, J.S. G-protein-coupled receptors and cancer. Nature reviews cancer 7, 79-94 (2007).
52. Bazan, J.F., et al. A new class of membrane-bound chemokine with a CX3C motif. Nature 385, 640-644 (1997).
53. Pan, Y., et al. Neurotactin, a membrane-anchored chemokine upregulated in brain inflammation. Nature 387, 611-617 (1997).
54. Huang, Y.W., et al. Constitutive endocytosis of the chemokine, CX3CL1, prevents its degradation by cell surface metalloproteases. The Journal of biological chemistry (2009).
55. Gendler, S.J. & Spicer, A.P. Epithelial mucin genes. Annual review of physiology 57, 607-634 (1995).
56. Hansen, J.E., et al. Prediction of O-glycosylation of mammalian proteins: specificity patterns of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase. The Biochemical journal 308 (Pt 3), 801-813 (1995).
57. Liu, G.Y., et al. Recycling of the membrane-anchored chemokine, CX3CL1. The Journal of biological chemistry 280, 19858-19866 (2005).
86 Chapter 7
58. Imaizumi, T., Yoshida, H. & Satoh, K. Regulation of CX3CL1/fractalkine expression in endothelial cells. Journal of atherosclerosis and thrombosis 11, 15-21 (2004).
59. Schwaeble, W.J., et al. Neuronal expression of fractalkine in the presence and absence of inflammation. FEBS letters 439, 203-207 (1998).
60. Lucas, A.D., et al. The transmembrane form of the CX3CL1 chemokine fractalkine is expressed predominantly by epithelial cells in vivo. The American journal of pathology 158, 855-866 (2001).
61. Ludwig, A., Berkhout, T., Moores, K., Groot, P. & Chapman, G. Fractalkine is expressed by smooth muscle cells in response to IFN-gamma and TNF-alpha and is modulated by metalloproteinase activity. The Journal of immunology 168, 604-612 (2002).
62. Sukkar, M.B., et al. Fractalkine/CX3CL1 production by human airway smooth muscle cells: induction by IFN-gamma and TNF-alpha and regulation by TGF-beta and corticosteroids. American journal of physiology 287, L1230-1240 (2004).
63. Ludwig, A., et al. Metalloproteinase inhibitors for the disintegrin-like metalloproteinases ADAM10 and ADAM17 that differentially block constitutive and phorbol ester-inducible shedding of cell surface molecules. Combinatorial chemistry & high throughput screening 8, 161-171 (2005).
64. Garcia, G.E., et al. NF-kappaB-dependent fractalkine induction in rat aortic endothelial cells stimulated by IL-1beta, TNF-alpha, and LPS. Journal of leukocyte biology 67, 577-584 (2000).
65. Yoshikawa, M., et al. TNF-alpha and IL-4 regulate expression of fractalkine (CX3CL1) as a membrane-anchored proadhesive protein and soluble chemotactic peptide on human fibroblasts. FEBS letters 561, 105-110 (2004).
66. Matsumiya, T., et al. Soluble interleukin-6 receptor alpha inhibits the cytokine-Induced fractalkine/CX3CL1 expression in human vascular endothelial cells in culture. Experimental cell research 269, 35-41 (2001).
67. Combadiere, C., Ahuja, S.K. & Murphy, P.M. Cloning and functional expression of a human eosinophil CC chemokine receptor. The Journal of biological chemistry 270, 16491-16494 (1995).
68. Raport, C.J., Schweickart, V.L., Eddy, R.L., Jr., Shows, T.B. & Gray, P.W. The orphan G-protein-coupled receptor-encoding gene V28 is closely related to genes for chemokine receptors and is expressed in lymphoid and neural tissues. Gene 163, 295-299 (1995).
69. Goda, S., et al. CX3C-chemokine, fractalkine-enhanced adhesion of THP-1 cells to endothelial cells through integrin-dependent and -independent mechanisms. The Journal of immunology 164, 4313-4320 (2000).
70. Nishimura, M., et al. Dual functions of fractalkine/CX3C ligand 1 in trafficking of perforin+/granzyme B+ cytotoxic effector lymphocytes that are defined by CX3CR1 expression. The Journal of immunology 168, 6173-6180 (2002).
71. Imai, T., et al. Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell 91, 521-530 (1997).
72. Yoneda, O., et al. Fractalkine-mediated endothelial cell injury by NK cells. The Journal of immunology 164, 4055-4062 (2000).
73. Dichmann, S., et al. Fractalkine induces chemotaxis and actin polymerization in human dendritic cells. Inflammation research 50, 529-533 (2001).
74. Harrison, J.K., et al. Role for neuronally derived fractalkine in mediating interactions between neurons and CX3CR1-expressing microglia. Proceedings of the
References 87
National Academy of Sciences of the United States of America 95, 10896-10901 (1998).
75. Barlic, J., et al. Interleukin (IL)-15 and IL-2 reciprocally regulate expression of the chemokine receptor CX3CR1 through selective NFAT1- and NFAT2-dependent mechanisms. The Journal of biological chemistry 279, 48520-48534 (2004).
76. Barlic, J., Sechler, J.M. & Murphy, P.M. IL-15 and IL-2 oppositely regulate expression of the chemokine receptor CX3CR1. Blood 102, 3494-3503 (2003).
77. Sechler, J.M., Barlic, J., Grivel, J.C. & Murphy, P.M. IL-15 alters expression and function of the chemokine receptor CX3CR1 in human NK cells. Cellular immunology 230, 99-108 (2004).
78. Haskell, C.A., Cleary, M.D. & Charo, I.F. Unique role of the chemokine domain of fractalkine in cell capture. Kinetics of receptor dissociation correlate with cell adhesion. The Journal of biological chemistry 275, 34183-34189 (2000).
79. Harrison, J.K., et al. Mutational analysis of the fractalkine chemokine domain. Basic amino acid residues differentially contribute to CX3CR1 binding, signaling, and cell adhesion. The Journal of biological chemistry 276, 21632-21641 (2001).
80. Fong, A.M., et al. Ultrastructure and function of the fractalkine mucin domain in CX(3)C chemokine domain presentation. The Journal of biological chemistry 275, 3781-3786 (2000).
81. Combadiere, C., Gao, J., Tiffany, H.L. & Murphy, P.M. Gene cloning, RNA distribution, and functional expression of mCX3CR1, a mouse chemotactic receptor for the CX3C chemokine fractalkine. Biochemical and biophysical research communications 253, 728-732 (1998).
82. Combadiere, C., et al. Identification of CX3CR1. A chemotactic receptor for the human CX3C chemokine fractalkine and a fusion coreceptor for HIV-1. The Journal of biological chemistry 273, 23799-23804 (1998).
83. Fong, A.M., et al. Fractalkine and CX3CR1 mediate a novel mechanism of leukocyte capture, firm adhesion, and activation under physiologic flow. The Journal of experimental medicine 188, 1413-1419 (1998).
84. Haskell, C.A., Cleary, M.D. & Charo, I.F. Molecular uncoupling of fractalkine-mediated cell adhesion and signal transduction. Rapid flow arrest of CX3CR1-expressing cells is independent of G-protein activation. The Journal of biological chemistry 274, 10053-10058 (1999).
85. Schwarz, N., et al. Sequential steps of leukocyte recruitment via the transmembrane chemokine CX3CL1. The Journal of immunology (submitted) (2009).
86. Combadiere, C., et al. Decreased atherosclerotic lesion formation in CX3CR1/apolipoprotein E double knockout mice. Circulation 107, 1009-1016 (2003).
87. Lesnik, P., Haskell, C.A. & Charo, I.F. Decreased atherosclerosis in CX3CR1-/- mice reveals a role for fractalkine in atherogenesis. The Journal of clinical investigation 111, 333-340 (2003).
88. Cardona, A.E., et al. Control of microglial neurotoxicity by the fractalkine receptor. Nature neuroscience 9, 917-924 (2006).
89. Furuichi, K., Gao, J.L. & Murphy, P.M. Chemokine receptor CX3CR1 regulates renal interstitial fibrosis after ischemia-reperfusion injury. The American journal of pathology 169, 372-387 (2006).
90. Niess, J.H., et al. CX3CR1-mediated dendritic cell access to the intestinal lumen and bacterial clearance. Science (New York, N.Y 307, 254-258 (2005).
88 Chapter 7
91. Faure, S., et al. Rapid progression to AIDS in HIV+ individuals with a structural variant of the chemokine receptor CX3CR1. Science (New York, N.Y 287, 2274-2277 (2000).
92. McDermott, D.H., et al. Genetic polymorphism in CX3CR1 and risk of HIV disease. Science (New York, N.Y 290, 2031 (2000).
93. Moatti, D., et al. Polymorphism in the fractalkine receptor CX3CR1 as a genetic risk factor for coronary artery disease. Blood 97, 1925-1928 (2001).
94. McDermott, D.H., et al. Chemokine receptor mutant CX3CR1-M280 has impaired adhesive function and correlates with protection from cardiovascular disease in humans. The Journal of clinical investigation 111, 1241-1250 (2003).
95. McDermott, D.H., et al. Association between polymorphism in the chemokine receptor CX3CR1 and coronary vascular endothelial dysfunction and atherosclerosis. Circulation research 89, 401-407 (2001).
96. Cook, D.N., et al. Generation and analysis of mice lacking the chemokine fractalkine. Molecular and cellular biology 21, 3159-3165 (2001).
97. Teupser, D., et al. Major reduction of atherosclerosis in fractalkine (CX3CL1)-deficient mice is at the brachiocephalic artery, not the aortic root. Proceedings of the National Academy of Sciences of the United States of America 101, 17795-17800 (2004).
98. Saederup, N., Chan, L., Lira, S.A. & Charo, I.F. Fractalkine deficiency markedly reduces macrophage accumulation and atherosclerotic lesion formation in CCR2-/- mice: evidence for independent chemokine functions in atherogenesis. Circulation 117, 1642-1648 (2008).
99. Wong, B.W., Wong, D. & McManus, B.M. Characterization of fractalkine (CX3CL1) and CX3CR1 in human coronary arteries with native atherosclerosis, diabetes mellitus, and transplant vascular disease. Cardiovascular pathology 11, 332-338 (2002).
100. Soriano, S.G., et al. Mice deficient in fractalkine are less susceptible to cerebral ischemia-reperfusion injury. Journal of neuroimmunology 125, 59-65 (2002).
101. McComb, J.G., et al. CX3CL1 up-regulation is associated with recruitment of CX3CR1+ mononuclear phagocytes and T lymphocytes in the lungs during cigarette smoke-induced emphysema. The American journal of pathology 173, 949-961 (2008).
102. Stocker, W., et al. The metzincins--topological and sequential relations between the astacins, adamalysins, serralysins, and matrixins (collagenases) define a superfamily of zinc-peptidases. Protein science 4, 823-840 (1995).
103. Bode, W., Gomis-Ruth, F.X. & Stockler, W. Astacins, serralysins, snake venom and matrix metalloproteinases exhibit identical zinc-binding environments (HEXXHXXGXXH and Met-turn) and topologies and should be grouped into a common family, the 'metzincins'. FEBS letters 331, 134-140 (1993).
104. Jongeneel, C.V., Bouvier, J. & Bairoch, A. A unique signature identifies a family of zinc-dependent metallopeptidases. FEBS letters 242, 211-214 (1989).
105. Schlondorff, J. & Blobel, C.P. Metalloprotease-disintegrins: modular proteins capable of promoting cell-cell interactions and triggering signals by protein-ectodomain shedding. Journal of cell science 112 ( Pt 21), 3603-3617 (1999).
106. Reiss, K., Ludwig, A. & Saftig, P. Breaking up the tie: disintegrin-like metalloproteinases as regulators of cell migration in inflammation and invasion. Pharmacology & therapeutics 111, 985-1006 (2006).
References 89
107. Gould, R.J., et al. Disintegrins: a family of integrin inhibitory proteins from viper venoms. Proceedings of the society for experimental biology and medicine 195, 168-171 (1990).
108. McLane, M.A., Marcinkiewicz, C., Vijay-Kumar, S., Wierzbicka-Patynowski, I. & Niewiarowski, S. Viper venom disintegrins and related molecules. Proceedings of the society for experimental biology and medicine 219, 109-119 (1998).
109. Blobel, C.P., et al. A potential fusion peptide and an integrin ligand domain in a protein active in sperm-egg fusion. Nature 356, 248-252 (1992).
110. Wolfsberg, T.G., Primakoff, P., Myles, D.G. & White, J.M. ADAM, a novel family of membrane proteins containing A Disintegrin And Metalloprotease domain: multipotential functions in cell-cell and cell-matrix interactions. The Journal of cell biology 131, 275-278 (1995).
111. Wolfsberg, T.G. & White, J.M. ADAMs in fertilization and development. Developmental biology 180, 389-401 (1996).
112. Kuno, K., et al. Molecular cloning of a gene encoding a new type of metalloproteinase-disintegrin family protein with thrombospondin motifs as an inflammation associated gene. The Journal of biological chemistry 272, 556-562 (1997).
113. Murphy, G. The ADAMs: signalling scissors in the tumour microenvironment. Nat Rev Cancer 8, 929-941 (2008).
114. Van Wart, H.E. & Birkedal-Hansen, H. The cysteine switch: a principle of regulation of metalloproteinase activity with potential applicability to the entire matrix metalloproteinase gene family. Proceedings of the National Academy of Sciences of the United States of America 87, 5578-5582 (1990).
115. Black, R.A., et al. Substrate specificity and inducibility of TACE (tumour necrosis factor alpha-converting enzyme) revisited: the Ala-Val preference, and induced intrinsic activity. Biochemical Society symposium, 39-52 (2003).
116. White, J.M. ADAMs: modulators of cell-cell and cell-matrix interactions. Current opinion in cell biology 15, 598-606 (2003).
117. Wewer, U.M., et al. ADAM12 is a four-leafed clover: the excised prodomain remains bound to the mature enzyme. The Journal of biological chemistry 281, 9418-9422 (2006).
118. Huovila, A.P., Turner, A.J., Pelto-Huikko, M., Karkkainen, I. & Ortiz, R.M. Shedding light on ADAM metalloproteinases. Trends in biochemical sciences 30, 413-422 (2005).
119. Blobel, C.P., Myles, D.G., Primakoff, P. & White, J.M. Proteolytic processing of a protein involved in sperm-egg fusion correlates with acquisition of fertilization competence. The Journal of cell biology 111, 69-78 (1990).
120. Black, R.A., et al. A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature 385, 729-733 (1997).
121. Inoue, D., et al. Cloning and initial characterization of mouse meltrin beta and analysis of the expression of four metalloprotease-disintegrins in bone cells. The Journal of biological chemistry 273, 4180-4187 (1998).
122. Moss, M.L., et al. Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-alpha. Nature 385, 733-736 (1997).
123. Pan, D. & Rubin, G.M. Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis. Cell 90, 271-280 (1997).
90 Chapter 7
124. Sotillos, S., Roch, F. & Campuzano, S. The metalloprotease-disintegrin Kuzbanian participates in Notch activation during growth and patterning of Drosophila imaginal discs. Development (Cambridge, England) 124, 4769-4779 (1997).
125. Weskamp, G., Kratzschmar, J., Reid, M.S. & Blobel, C.P. MDC9, a widely expressed cellular disintegrin containing cytoplasmic SH3 ligand domains. The Journal of cell biology 132, 717-726 (1996).
126. Yagami-Hiromasa, T., et al. A metalloprotease-disintegrin participating in myoblast fusion. Nature 377, 652-656 (1995).
127. Pruessmeyer, J. & Ludwig, A. The good, the bad and the ugly substrates for ADAM10 and ADAM17 in brain pathology, inflammation and cancer. Seminars in cell & developmental biology 20, 164-174 (2009).
128. Buxbaum, J.D., et al. Evidence that tumor necrosis factor alpha converting enzyme is involved in regulated alpha-secretase cleavage of the Alzheimer amyloid protein precursor. The Journal of biological chemistry 273, 27765-27767 (1998).
129. Lammich, S., et al. Constitutive and regulated alpha-secretase cleavage of Alzheimer's amyloid precursor protein by a disintegrin metalloprotease. Proceedings of the National Academy of Sciences of the United States of America 96, 3922-3927 (1999).
130. Postina, R., et al. A disintegrin-metalloproteinase prevents amyloid plaque formation and hippocampal defects in an Alzheimer disease mouse model. The Journal of clinical investigation 113, 1456-1464 (2004).
131. Vincent, B. ADAM proteases: protective role in Alzheimer's and prion diseases? Current Alzheimer research 1, 165-174 (2004).
132. Vincent, B., et al. The disintegrins ADAM10 and TACE contribute to the constitutive and phorbol ester-regulated normal cleavage of the cellular prion protein. The Journal of biological chemistry 276, 37743-37746 (2001).
133. Brou, C., et al. A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Molecular cell 5, 207-216 (2000).
134. Hartmann, D., et al. The disintegrin/metalloprotease ADAM 10 is essential for Notch signalling but not for alpha-secretase activity in fibroblasts. Human molecular genetics 11, 2615-2624 (2002).
135. Solomon, K.A., Pesti, N., Wu, G. & Newton, R.C. Cutting edge: a dominant negative form of TNF-alpha converting enzyme inhibits proTNF and TNFRII secretion. The Journal of immunology 163, 4105-4108 (1999).
136. Matthews, V., et al. Cellular cholesterol depletion triggers shedding of the human interleukin-6 receptor by ADAM10 and ADAM17 (TACE). The Journal of biological chemistry 278, 38829-38839 (2003).
137. Peschon, J.J., et al. An essential role for ectodomain shedding in mammalian development. Science (New York, N.Y 282, 1281-1284 (1998).
138. Hafezi-Moghadam, A., Thomas, K.L., Prorock, A.J., Huo, Y. & Ley, K. L-selectin shedding regulates leukocyte recruitment. The Journal of experimental medicine 193, 863-872 (2001).
139. Singh, R.J., et al. Cytokine stimulated vascular cell adhesion molecule-1 (VCAM-1) ectodomain release is regulated by TIMP-3. Cardiovascular research 67, 39-49 (2005).
140. Garton, K.J., et al. Stimulated shedding of vascular cell adhesion molecule 1 (VCAM-1) is mediated by tumor necrosis factor-alpha-converting enzyme (ADAM 17). The Journal of biological chemistry 278, 37459-37464 (2003).
References 91
141. Garton, K.J., et al. Tumor necrosis factor-alpha-converting enzyme (ADAM17) mediates the cleavage and shedding of fractalkine (CX3CL1). The Journal of biological chemistry 276, 37993-38001 (2001).
142. Tsou, C.L., Haskell, C.A. & Charo, I.F. Tumor necrosis factor-alpha-converting enzyme mediates the inducible cleavage of fractalkine. The Journal of biological chemistry 276, 44622-44626 (2001).
143. Chantry, A., Gregson, N.A. & Glynn, P. A novel metalloproteinase associated with brain myelin membranes. Isolation and characterization. The Journal of biological chemistry 264, 21603-21607 (1989).
144. Lichtenthaler, S.F., et al. The cell adhesion protein P-selectin glycoprotein ligand-1 is a substrate for the aspartyl protease BACE1. The Journal of biological chemistry 278, 48713-48719 (2003).
145. Schulz, B., et al. ADAM10 regulates endothelial permeability and T-Cell transmigration by proteolysis of vascular endothelial cadherin. Circulation research 102, 1192-1201 (2008).
146. Hundhausen, C., et al. The disintegrin-like metalloproteinase ADAM10 is involved in constitutive cleavage of CX3CL1 (fractalkine) and regulates CX3CL1-mediated cell-cell adhesion. Blood 102, 1186-1195 (2003).
147. Arduise, C., et al. Tetraspanins regulate ADAM10-mediated cleavage of TNF-alpha and epidermal growth factor. The Journal of immunology 181, 7002-7013 (2008).
148. Le Naour, F., Andre, M., Boucheix, C. & Rubinstein, E. Membrane microdomains and proteomics: lessons from tetraspanin microdomains and comparison with lipid rafts. Proteomics 6, 6447-6454 (2006).
149. Sambrook & Russell. Molecular Cloning - A Laboratory Manual, (Cold Spring Harbor, New York, 2001).
150. Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685 (1970).
151. von Hundelshausen, P., et al. RANTES deposition by platelets triggers monocyte arrest on inflamed and atherosclerotic endothelium. Circulation 103, 1772-1777 (2001).
152. Tanaka, M., et al. ADAM binding protein Eve-1 is required for ectodomain shedding of epidermal growth factor receptor ligands. The Journal of biological chemistry 279, 41950-41959 (2004).
153. Dean, R.A. & Overall, C.M. Proteomics discovery of metalloproteinase substrates in the cellular context by iTRAQ labeling reveals a diverse MMP-2 substrate degradome. Molecular and cellular proteomics 6, 611-623 (2007).
154. Clark, A.K., Yip, P.K. & Malcangio, M. The liberation of fractalkine in the dorsal horn requires microglial cathepsin S. The Journal of neuroscience 29, 6945-6954 (2009).
155. Delaleu, N. & Jonsson, R. Altered fractalkine cleavage results in an organ-specific 17 kDa fractalkine fragment in salivary glands of NOD mice. Arthritis research & therapy 10, 114 (2008).
156. Fitzgerald, M.L., Wang, Z., Park, P.W., Murphy, G. & Bernfield, M. Shedding of syndecan-1 and -4 ectodomains is regulated by multiple signaling pathways and mediated by a TIMP-3-sensitive metalloproteinase. The Journal of cell biology 148, 811-824 (2000).
157. Vitale, S., et al. Tissue-specific differential antitumour effect of molecular forms of fractalkine in a mouse model of metastatic colon cancer. Gut 56, 365-372 (2007).
92 Chapter 7
158. Diwan, A., et al. Targeted overexpression of noncleavable and secreted forms of tumor necrosis factor provokes disparate cardiac phenotypes. Circulation 109, 262-268 (2004).
159. Venturi, G.M., et al. Leukocyte migration is regulated by L-selectin endoproteolytic release. Immunity 19, 713-724 (2003).
160. Fraticelli, P., et al. Fractalkine (CX3CL1) as an amplification circuit of polarized Th1 responses. The Journal of clinical investigation 107, 1173-1181 (2001).
161. Umehara, H., et al. Fractalkine, a CX3C-chemokine, functions predominantly as an adhesion molecule in monocytic cell line THP-1. Immunology and cell biology 79, 298-302 (2001).
162. Vitale, S., et al. Soluble fractalkine prevents monocyte chemoattractant protein-1-induced monocyte migration via inhibition of stress-activated protein kinase 2/p38 and matrix metalloproteinase activities. The Journal of immunology 172, 585-592 (2004).
163. Koenen, R.R., et al. Regulated release and functional modulation of junctional adhesion molecule A by disintegrin metalloproteinases. Blood 113, 4799-4809 (2009).
164. Hayashida, K., Stahl, P.D. & Park, P.W. Syndecan-1 ectodomain shedding is regulated by the small GTPase Rab5. The Journal of biological chemistry 283, 35435-35444 (2008).
Abbreviations 93
8 8 ABBREVIATIONS
α alpha
A10 inhibitor of ADAM10
A10/17 inhibitor of ADAM10 and ADAM17
ADAM a disintegrin and metalloproteinase
ampR ampicillin resistance
ANOVA analysis of variances
AP2 adaptor protein-2
APC allophycocyanin
ApoE appolipoprotein E
APP amyloid precursor protein
APS ammonium persulphate
ATP adenosine triphosphate
β beta
bp(s) base pairs
BSA bovine serum albumine
Ca++ calcium
CaCl2 calcium chloride
cDNA complementary DNA
CNS central nervous system
CR cysteine rich
CTF c-terminal fragment
°C degrees Celsius
Da dalton
DAPI 4’, 6-Diamidino-2-phenylindole
DMEM Dulbecco’s modified Eagle’s medium
DMSO dimethyl sulphoxide
DNA deoxyribonucleic acid
E. coli Escheririchia coli
ECL enhanced chemiluminescence
EDTA ethylenediamine tetra-acetic acid
EEA1 early endosomal antigen-1
EGF epidermal growth factor
94 Chapter 8
ELISA enzyme-linked immunosorbent assay
ERK extracellular-signal regulated kinase
EtOH ethanol
FCS fetal calf serum
FITC fluorescein isothiocyanate
FKN fractalkine
γ gamma
g g-force
G-CSF granulocyte-colony stimulating factor
GDP guanosine diphosphate
GFP green fluorescent protein
gp130 glycoprotein 130
GPCRs G-protein coupled receptors
GTP guanosine triphosphate
H2O water
HEK human embryonic kidney
HRP horseradish peroxidase
h hours
HSPG heparan-sulphate proteoglycan
IC inhibitory concentration
ICAM inter-cellular adhesion molecule
IFN interferon
IL interleukin
Ig immunoglobulin
IP3 inositol triphosphat
kDa kilodalton
KCl potassium chloride
KH2PO4 potassium di-hrydogen orthophosphate
KHCO3 potassium hydrogen carbonate
LB lysogeny broth
LFA-1 lymphocyte-function associated antigen-1
M molar
mA milliamps
MAB monoclonal antibody
Abbreviations 95
MCP-1 monocyte chemoattractant protein-1
MCS multiple cloning site
MgCl2 magnesium chloride
MgSO4 magnesium sulphate
min minutes
ml millilitre
µg microgram
µl microlitre
mM millimolar
MMP matrix metalloproteinase
MP metalloproteinase
mRNA messenger RNA
N normality
Ni nickel
NH4Cl ammonium chloride
NaCl sodium chloride
Na2HPO4 di-sodium hydrogen orthophosphate
NaH2PO4 sodium di-hydrogen orthophosphate
NK natural killer
neoR neomycin resistance
nm nanometre
OD optical density
p probability
PAGE polyacrylamide gel electrophoresis
PBMCs periphal blood mononuclear cell
PBS phosphate buffered saline
PCR polymerase chain reaction
PD prodomain
PDVF polyvinylidene fluoride
PE phycoerythrin
PECAM platelet/endothelial cell adhesion molecule
PFA paraformaldehyd
PIP2 phosphatidylinositol 4,5-bisphosphate
PLC phospolipase C
96 Chapter 8
PKC protein kinase C
PMA phorbol 12-myristate 13-acetate
PrP prion protein
PSGL-1 p-selection glycoprotein ligand-1
RNA ribonucleic acid
rpm revolutions per minute
rcf relative centrifugal force
SD standard deviation
SDS sodium docecyl sulphate
s second
shRNA short hairpin ribonucleic acid
SNARE soluble N-ethylmaleimide-sensitive-factor
attachment receptor
TACE tumor necrosis factor-alpha converting enzyme
TEMED N,N,N’,N’-tetramethylene-ethylenediamine
TGF transforming growth factor
TNF-α tumor necrosis factor-alpha
Tris tris (hydroxymethyl) aminomethane
Tween20 polyoxyethylenesorbitan monolaurate
U units
V volts
VCAM vascular cell adhesion molecule
VLA-4 very late antigen-4
wt wildtype
Zn zinc
List of figures 97
9 9 LIST OF FIGURES
Fig. 1-1: Leukocyte recruitment to inflamed tissue10 ................................................. 2
Fig. 1-2: Schematic structure of chemokine classes ................................................... 4
Fig. 1-3: Schematic structure of human and mouse CX3CL1 .................................... 6
Fig. 1-4: The schematic structure of ADAM proteins113 .......................................... 10
Fig. 1-5: Ectodomain shedding of CX3CL1 by ADAM10 and ADAM17.............. 13
Fig. 3-1: Shedding of hCX3CL1 and mCX3CL1 into the medium of HEK293 cells39
Fig. 3-2: Analysis of the conditioned media of hCX3CL1 and mCX3CL1 tranfected
HEK293 cells ............................................................................................ 40
Fig. 3-3: Tandem purification of hCX3CL1 ............................................................. 41
Fig. 3-4: Deglycosylation of hCX3CL1................................................................... 42
Fig. 3-5: Potential target structures to analyse mCX3CL1 shedding........................ 43
Fig. 3-6: Substitution and deletion of the membrane proximal part of mCX3CL1 by an
Ig-like domain of mCD4 and a poly-(glycine-serine) linker .................... 44
Fig. 3-7: Substitution of the chemokine domain of mCX3CL1 by the chemokine
CCL5......................................................................................................... 46
Fig. 3-8: Substitution of the membrane proximal part or the transmembrane and
intracellular domains of mCX3CL1 by that of mCD4.............................. 48
Fig. 3-9: Analysis of the release of mCX3CL1/CD4 and mCX3CL1/CD4 fusion... 49
Fig. 3-10: Release of mCD4 ..................................................................................... 50
Fig. 3-11: Truncation of the cytoplasmic tail of mCX3CL1 and mCX3CL1/CD4 .. 51
Fig. 3-12: Release of mCX3CL1 trunc and mCX3CL1/CD4 trunc.......................... 52
Fig. 3-13: Ionomycin-induced release of the truncated mCX3CL1 and
mCX3CL1/CD4 ........................................................................................ 53
Fig. 3-14: Confocal analysis of mCX3CL1 and mCX3CL1 trunc ........................... 54
Fig. 3-15: Flow cytometric analysis of the truncated mCX3CL1 variants and
mCX3CL1/CD4 chimera .......................................................................... 56
Fig. 3-16: Flow cytometric analysis of stable mCX3CL1- and mCX3CL1 trunc-
HEK293 cells ............................................................................................ 57
Fig. 3-17: Release of soluble mCX3CL1 in stable mCX3CL1-HEK293 and
mCX3CL1 trunc-HEK293 cells using the A10 and A10/17 inhibitors .... 58
98 Chapter 9
Fig. 3-18: Release of soluble mCX3CL1 by stable mCX3CL1-HEK293 and
mCX3CL1 trunc-HEK293 cells using ADAM10 and ADAM17 shRNA
knockdown ................................................................................................60
Fig. 3-19: Adhesion of mCX3CL1 and mCX3CL1 trunc .........................................62
Fig. 3-20: Transmigration of PBMCs across wt HEK293 cells by soluble CX3CL1 and
MCP-1 .......................................................................................................63
Fig. 3-21: Transmigration of PBMCs across HEK293 cells by transmembrane mouse
CX3CL1 ....................................................................................................64
Fig. 3-22: Transmigration of PBMCs across mCX3CL1 variants expressing HEK293
cells by soluble CX3CL1 and MCP-1.......................................................65
Fig. 5-1: Shedding and function of mouse CX3CL1.................................................77
Supplements 99
10 10 SUPPLEMENTS
Sup.-Fig. 1a: Map of the mouse CX3CL1
(mCX3CL1_3.1+) expression vector
EcoRI ןP →+1 GAATTCGCCACCATGGCTCCCTCGCCGCTCGCGTGGCTGCTGCGCCTGGCCGCGTTCTTCCATTTGTGTACTCTGCTGCCGGGTCAGCACCTCGGCATGACGAAATGCGAAATCATGTGCGACAAGATGACCTCACGAATCCCAGTGGCTTTGCTCATCCGCTATCAGCTAAACCAGGAGTCCTGCGGCAAGCGTGCCATTGTCCTGGAGACGACACAGCACAGACGCTTCTGTGCTGACCCGAAGGAGAAATGGGTCCAAGACGCCATGAAGCATCTGGATCACCAGGCTGCTGCCCTCACTAAAAATGGTGGCAAGTTTGAGAAGCGGGTGGACAATGTGACACCTGGGATCACCTTGGCCACTAGGGGACTGTCCCCATCTGCCCTGACAAAGCCTGAATCCGCCACATTGGAAGACCTTGCTTTGGAACTGACTACTATTTCCCAGGAGGCCAGGGGGACCATGGGGACTTCCCAAGAGCCACCGGCAGCAGTGACCGGATCATCTCTCTCAACTTCCGAGGCACAGGATGCAGGGCTTACGGCTAAGCCTCAGAGCATTGGAAGTTTTGAGGCGGCTGACATCTCCACCACCGTTTGGCCGAGTCCTGCTGTCTACCAATCTGGATCTAGCTCCTGGGCTGAGGAAAAAGCTACTGAGTCCCCCTCCACTACAGCCCCATCTCCTCAGGTGTCCACTACTTCACCTTCAACCCCAGAGGAAAATGTTGGGTCCGAAGGCCAACCCCCATGGGTCCAGGGACAGGACCTCAGTCCAGAGAAGTCTCTAGGGTCTGAGGAGATAAACCCAGTTCATACTGATAATTTCCAGGAGAGGGGGCCTGGCAACACAGTCCACCCCTCAGTGGCTCCCATCTCCTCTGAAGAGACCCCCAGCCCAGAGCTGGTGGCCTCGGGCAGCCAGGCTCCTAAGATAGAGGAACCCATCCATGCCACTGCAGATCCCCAGAAACTGAGTGTGCTTATCACTCCTGTCCCCGACACCCAGGCAGCCACAAGGAGGCAGGCAGTGGGGCTACTGGCTTTCCTTGGTCTTCTTTTCTGCCTAGGGGTGGCCATGTTTGCTTACCAGAGCAGAGCCTTCAGGGCTGTCCCCGCAAAATGGCGGGGGAAATGGTAGAAGGCCTCCGCTACGTCCCCCGTAGCTGTGGCAGTAACTCATACGTCCTGGTGCCAGTGTGACTCGAG
Stop XhoI
Sup.-Fig. 1b: Sequence of mouse CX3CL1
mCX3CL1 wt_3.1+mCX3CL1 wt_3.1+
100 Chapter 10
Sup.-Fig. 2a: Map of the mouse CX3CL1/poly-L and mouse CX3CL1/CD4 (mCX3CL1/CD4_3.1+, mCX3CL1/poly-L) expression vectors
EcoRI ןP →+1 GAATTCGCCACCATGGCTCCCTCGCCGCTCGCGTGGCTGCTGCGCCTGGCCGCGTTCTTCCATTTGTGTACTCTGCTGCCGGGTCAGCACCTCGGCATGACGAAATGCGAAATCATGTGCGACAAGATGACCTCACGAATCCCAGTGGCTTTGCTCATCCGCTATCAGCTAAACCAGGAGTCCTGCGGCAAGCGTGCCATTGTCCTGGAGACGACACAGCACAGACGCTTCTGTGCTGACCCGAAGGAGAAATGGGTCCAAGACGCCATGAAGCATCTGGATCACCAGGCTGCTGCCCTCACTAAAAATGGTGGCAAGTTTGAGAAGCGGGTGGACAATGTGACACCTGGGATCACCTTGGCCACTAGGGGACTGTCCCCATCTGCCCTGACAAAGCCTGAATCCGCCACATTGGAAGACCTTGCTTTGGAACTGACTACTATTTCCCAGGAGGCCAGGGGGACCATGGGGACTTCCCAAGAGCCACCGGCAGCAGTGACCGGATCATCTCTCTCAACTTCCGAGGCACAGGATGCAGGGCTTACGGCTAAGCCTCAGAGCATTGGAAGTTTTGAGGCGGCTGACATCTCCACCACCGTTTGGCCGAGTCCTGCTGTCTACCAATCTGGATCTAGCTCCTGGGCTGAGGAAAAAGCTACTGAGTCCCCCTCCACTACAGCCC Eco81I CATCTCCTCAGGTGTCCACTACTTCACCTTCAACCCCAGAGGAAAATGTTGGGTCCGAAGGCCAACCCCCATGGGTCCAGGGACAGGACCTCAGTCCAGAGAAGTCTCTAGGGTCTAAAGTGGCTCAGCTCAACAATACTTTGACCTGTGAGGTGATGGGACCTACCTCTCCCAAGATGAGACTGACCCTGAAGCAGGAGAACCAGGAGGCCAGGGTCTCTGAGGAGCAGAAAGTAGTTCAAGTGGTGGCCCCTGAGACAGGGCTGTGGCAGTGTCTACTGAGTGAAGGTGATAAGGTCAAGATGGACTCCAGGATCCAGGTTTTATCCAGAGGGGTGAACCAGACAGCAGTGGGGCTACTGGCTTTCCTTGGTCTTCTTTTCTGCCTAGGGGTGGCCATGTTTGCTTACCAGAGCCTTCAGGGCTGTCCCCGCAAAATGGCGGGGGAAATGGTAGAAGGCCTCCGCTACGTCCCCCGTAGCTGTGGCAGTAACTCATACGTCCTGGTGCCAGTGTGACTCGAG
Stop XhoI
Sup.-Fig. 2b: Sequence of mouse CX3CL1/CD4 (CD4 sequence in bold)
mCX3CL1/CD4 or poly-L
mCX3CL1/CD4_3.1+mCX3CL1/poly-L_3.1+
mCX3CL1/CD4 or poly-L
mCX3CL1/CD4_3.1+mCX3CL1/poly-L_3.1+
Supplements 101
EcoRI ןP →+1 GAATTCGCCACCATGGCTCCCTCGCCGCTCGCGTGGCTGCTGCGCCTGGCCGCGTTCTTCCATTTGTGTACTCTGCTGCCGGGTCAGCACCTCGGCATGACGAAATGCGAAATCATGTGCGACAAGATGACCTCACGAATCCCAGTGGCTTTGCTCATCCGCTATCAGCTAAACCAGGAGTCCTGCGGCAAGCGTGCCATTGTCCTGGAGACGACACAGCACAGACGCTTCTGTGCTGACCCGAAGGAGAAATGGGTCCAAGACGCCATGAAGCATCTGGATCACCAGGCTGCTGCCCTCACTAAAAATGGTGGCAAGTTTGAGAAGCGGGTGGACAATGTGACACCTGGGATCACCTTGGCCACTAGGGGACTGTCCCCATCTGCCCTGACAAAGCCTGAATCCGCCACATTGGAAGACCTTGCTTTGGAACTGACTACTATTTCCCAGGAGGCCAGGGGGACCATGGGGACTTCCCAAGAGCCACCGGCAGCAGTGACCGGATCATCTCTCTCAACTTCCGAGGCACAGGATGCAGGGCTTACGGCTAAGCCTCAGAGCATTGGAAGTTTTGAGGCGGCTGACATCTCCACCACCGTTTGGCCGAGTCCTGCTGTCTACCAATCTGGATCTAGCTCCTGGGCTGAGGAAAAAGCTACTGAGTCCCCCTCCACTACAGCCC
Eco81I CATCTCCTCAGGTGTCCACTACTTCACCTTCAACCCCAGAGGAAAATGTTGGGTCCGAAGGCCAACCCCCATGGGTCCAGGGACAGGACCTCAGTCCAGAGAAGTCTCTAGGGTCTGAGGAGATAAACCCAGTTCATACTGATAATTTCCAGGAGAGGGGGCCTGGCAACACAGTCCACCCCTCAG BamHI TGGCTCCCATCGGATCCGGAGGTGGGTCATCTGGAAGAAGCGGTGGCGGTGGGAGTTCAGGCGGGGAAAGCGGAGGCGGGTCTGGAGGTGGCGGAGAGGGAGGCTCAGGAGGTGGGAGCGGGAG
BamHI TGGAGGGTCTAGAGGATCGGGAGGTGGGAGCGGATCCGCAGTGGGGCTACTGGCTTTCCTTGGTCTTCTTTTCTGCCTAGGGGTGGCCATGTTTGCTTACCAGAGCCTTCAGGGCTGTCCCCGCAAAATGGCGGGGGAAATGGTAGAAGGCCTCCGCTACGTCCCCCGTAGCTGTGGCAGTAACTCATACGTCCTGGTGCCAGTGTGACTCGAG Stop XhoI
Sup.-Fig. 2c: Sequence of mouse CX3CL1/poly-L (poly-L sequence in bold)
102 Chapter 10
Sup.-Fig. 3a: Map of the mouse CX3CL1 del (mCX3CL1del_3.1+) expression vector
EcoRI ןP →+1 GAATTCGCCACCATGGCTCCCTCGCCGCTCGCGTGGCTGCTGCGCCTGGCCGCGTTCTTCCATTTGTGTACTCTGCTGCCGGGTCAGCACCTCGGCATGACGAAATGCGAAATCATGTGCGACAAGATGACCTCACGAATCCCAGTGGCTTTGCTCATCCGCTATCAGCTAAACCAGGAGTCCTGCGGCAAGCGTGCCATTGTCCTGGAGACGACACAGCACAGACGCTTCTGTGCTGACCCGAAGGAGAAATGGGTCCAAGACGCCATGAAGCATCTGGATCACCAGGCTGCTGCCCTCACTAAAAATGGTGGCAAGTTTGAGAAGCGGGTGGACAATGTGACACCTGGGATCACCTTGGCCACTAGGGGACTGTCCCCATCTGCCCTGACAAAGCCTGAATCCGCCACATTGGAAGACCTTGCTTTGGAACTGACTACTATTTCCCAGGAGGCCAGGGGGACCATGGGGACTTCCCAAGAGCCACCGGCAGCAGTGACCGGATCATCTCTCTCAACTTCCGAGGCACAGGATGCAGGGCTTACGGCTAAGCCTCAGAGCATTGGAAGTTTTGAGGCGGCTGACATCTCCACCACCGTTTGGCCGAGTCCTGCTGTCTACCAATCTGGATCTAGCTCCTGGGCTGAGGAAAAAGCTACTGAGTCCCCCTCCACTACAGCCCCATCTCCTCAGGTGTCCACTACTTCACCTTCAACCCCAGAGGAAAATGTTGGGTCCGAAGGCCAACCCCCATGGGTCCAGGGACAGGACCTCAGTCCAGAGAAGTCTCTAGGGTCTGAGGAGATAAACCCAGTTCATACTGATAATTTCCAGGAGAGGGGGCCTGGCAACACAGTCCACCCCTCAG
BamHI TGGCTCCCATCGGATCCGCAGTGGGGCTACTGGCTTTCCTTGGTCTTCTTTTCTGCCTAGGGGTGGCCATGTTTGCTTACCAGAGCCTTCAGGGCTGTCCCCGCAAAATGGCGGGGGAAATGGTAGAAGGCCTCCGCTACGTCCCCCGTAGCTGTGGCAGTAACTCATACGTCCTGGTGCCAGTGTGACTCGAG
Stop XhoI
Sup.-Fig. 3b: Sequence of mouse CX3CL1 del
mCX3CL1del_3.1+ mCX3CL1del
mCX3CL1del_3.1+ mCX3CL1del
Supplements 103
Sup.-Fig. 4a: Map of the CCL5/mouse CX3CL1 (CCL5/mCX3CL1_3.1+) expression vector
EcoRI ןP →+1 GAATTCGCCACCATGAAGGTCTCCGCGGCAGCCCTCGCTGTCATCCTCATTGCTACTGCCCTCTGCGCTCCTGCATCTGCCTCCCCATATTCCTCGGACACCACACCCTGCTGCTTTGCCTACATTGCCCGCCCACTGCCCCGTGCCCACATCAAGGAGTATTTCTACACCAGTGGCAAGTGCTCCAACCCAGCAGTCGTCTTTGTCACCCGAAAGAACCGCCAAGTGTGTGCCAACCCAGAGAAGAAATGGGTTCGGGA AgeI GTACATCAACTCTTTGGAGATGAGCACCGGTGGCAAGTTTGAGAAGCGGGTGGACAATGTGACACCTGGGATCACCTTGGCCACTAGGGGACTGTCCCCATCTGCCCTGACAAAGCCTGAATCCGCCACATTGGAAGACCTTGCTTTGGAACTGACTACTATTTCCCAGGAGGCCAGGGGGACCATGGGGACTTCCCAAGAGCCACCGGCAGCAGTGACCGGATCATCTCTCTCAACTTCCGAGGCACAGGATGCAGGGC
PflMI TTACGGCTAAGCCTCAGAGCATTGGAAGTTTTGAGGCGGCTGACATCTCCACCACCGTTTGGCCGAGTCCTGCTGTCTACCAATCTGGATCTAGCTCCTGGGCTGAGGAAAAAGCTACTGAGTCCCCCTCCACTACAGCCCCATCTCCTCAGGTGTCCACTACTTCACCTTCAACCCCAGAGGAAAATGTTGGGTCCGAAGGCCAACCCCCATGGGTCCAGGGACAGGACCTCAGTCCAGAGAAGTCTCTAGGGTCTGAGGAGATAAACCCAGTTCATACTGATAATTTCCAGGAGAGGGGGCCTGGCAACACAGTCCACCCCTCAGTGGCTCCCATCTCCTCTGAAGAGACCCCCAGCCCAGAGCTGGTGGCCTCGGGCAGCCAGGCTCCTAAGATAGAGGAACCCATCCATGCCACTGCAGATCCCCAGAAACTGAGTGTGCTTATCACTCCTGTCCCCGACACCCAGGCAGCCACAAGGAGGCAGGCAGTGGGGCTACTGGCTTTCCTTGGTCTTCTTTTCTGCCTAGGGGTGGCCATGTTTGCTTACCAGAGCAGAGCCTTCAGGGCTGTCCCCGCAAAATGGCGGGGGAAATGGTAGAAGGCCTCCGCTACGTCCCCCGTAGCTGTGGCAGTAACTCATACGTCCTGGTGCCAGTGTGACTCGAG
Stop XhoI
Sup.-Fig. 4b: Sequence of CCL5/mouse CX3CL1 (CCL5 sequence in bold)
CCL5/mCX3CL1_3.1+
CCL5/mCX3CL1
CCL5/mCX3CL1_3.1+
CCL5/mCX3CL1
104 Chapter 10
Sup.-Fig. 5a: Map of the mouse CX3CL1/CD4 fusion (mCX3CL1/CD4fusion_3.1+) expression vector
EcoRI ןP →+1 GAATTCGCCACCATGGCTCCCTCGCCGCTCGCGTGGCTGCTGCGCCTGGCCGCGTTCTTCCATTTGTGTACTCTGCTGCCGGGTCAGCACCTCGGCATGACGAAATGCGAAATCATGTGCGACAAGATGACCTCACGAATCCCAGTGGCTTTGCTCATCCGCTATCAGCTAAACCAGGAGTCCTGCGGCAAGCGTGCCATTGTCCTGGAGACGACACAGCACAGACGCTTCTGTGCTGACCCGAAGGAGAAATGGGTCCAAGACGCCATGAAGCATCTGGATCACCAGGCTGCTGCCCTCACTAAAAATGGTGGCAAGTTTGAGAAGCGGGTGGACAATGTGACACCTGGGATCACCTTGGCCACTAGGGGACTGTCCCCATCTGCCCTGACAAAGCCTGAATCCGCCACATTGGAAGACCTTGCTTTGGAACTGACTACTATTTCCCAGGAGGCCAGGGGGACCATGGGGACTTCCCAAGAGCCACCGGCAGCAGTGACCGGATCATCTCTCTCAACTTCCGAGGCACAGGATGCAGGGCTTACGGCTAAGCCTCAGAGCATTGGAAGTTTTGAGGCGGCTGACATCTCCACCACCGTTTGGCCGAGTCCTGCTGTCTACCAATCTGGATCTAGCTCCTGGGCTGAGGAAAAAGCTACTGAGTCCCCCTCCACTACAGCCCCATCTCCTCAGGTGTCCACTACTTCACCTTCAACCCCAGAGGAAAATGTTGGGTCCGAAGGCCAACCCCCATGGGTCCAGGGACAGGACCTCAGTCCAGAGAAGTCTCTAGGGTCTAAAGTGGCTCAGCTCAACAATACTTTGACCTGTGAGGTGATGGGACCTACCTCTCCCAAGATGAGACTGACCCTGAAGCAGGAGAACCAGGAGGCCAGGGTCTCTGAGGAGCAGAAAGTAGTTCAAGTGGTGGCCCCTGAGACAGGGCTGTGGCAGTGTCTACTGAGTGAAGGTGATA
BamHI AGGTCAAGATGGACTCCAGGATCCAGGTTTTATCCAGAGGGGTGAACCAGACAGTGTTCCTGGCTTGCGTGCTGGGTGGCTCCTTCGGCTTTCTGGGTTTCCTTGGGCTCTGCATCCTCTGCTGTGTCAGGTGCCGGCACCAACAGCGCCAGGCAGCACGAATGTCTCAGATCAAGAGGCTCCTCAGTGAGAAGAAGACCTGCCAGTGCCCCCACCGGATGCAGAAGAGCCATAATCTCATCTGACTCGAG Stop XhoI
Sup.-Fig. 5b: Sequence of mouse CX3CL1/CD4 fusion (CD4 sequence in bold)
mCX3CL1/CD4fusion_3.1+ mCX3CL1/
CD4 fusion
, BamHI
mCX3CL1/CD4fusion_3.1+ mCX3CL1/
CD4 fusion
, BamHI
Supplements 105
Sup.-Fig. 6a: Map of the mouse CD4 (mCD4_3.1+) expression vector
EcoRI ןP →+1
GAATTCGCCACCATGTGCCGAGCCATCTCTCTTAGGCGCTTGCTGCTGCTGCTGCTGCAGCTGTCACAACTCCTAGCTGTCACTCAAGGGAAGACGCTGGTGCTGGGGAAGGAAGGGGAATCAGCAGAACTGCCCTGCGAGAGTTCCCAGAAGAAGATCACAGTCTTCACCTGGAAGTTCTCTGACCAGAGGAAGATTCTGGGGCAGCATGGCAAAGGTGTATTAATTAGAGGAGGTTCGCCTTCGCAGTTTGATCGTTTTGATTCCAAAAAAGGGGCATGGGAGAAAGGATCGTTTCCTCTCATCATCAATAAACTTAAGATGGAAGACTCTCAGACTTATATCTGTGAGCTGGAGAACAGGAAAGAGGAGGTGGAGTTGTGGGTGTTCAAAGTGACCTTCAGTCCGGGTACCAGCCTGTTGCAAGGGCAGAGCCTGACCCTGACCTTGGATAGCAACTCTAAGGTCTCTAACCCCTTGACAGAGTGCAAACACAAAAAGGGTAAAGTTGTCAGTGGTTCCAAAGTTCTCTCCATGTCCAACCTAAGGGTTCAGGACAGCGACTTCTGGAACTGCACCGTGACCCTGGACCAGAAAAAGAACTGGTTCGGCATGACACTCTCAGTGCTGGGTTTTCAGAGCACAGCTATCACGGCCTATAAGAGTGAGGGAGAGTCAGCGGAGTTCTCCTTCCCACTCAACTTTGCAGAGGAAAACGGGTGGGGAGAGCTGATGTGGAAGGCAGAGAAGGATTCTTTCTTCCAGCCCTGGATCTCCTTCTCCATAAAGAACAAAGAGGTGTCCGTACAAAAGTCCACCAAAGACCTCAAGCTCCAGCTGAAGGAAACGCTCCCACTCACCCTCAAGATACCCCAGGTCTCGCTTCAGTTTGCTGGTTCTGGCAACCTGACTCTGACTCTGGACAAAGGGACACTGCATCAGGAAGTGAACCTGGTGGTGATGAAAGTGGCTCAGCTCAACAATACTTTGACCTGTGAGGTGATGGGACCTACCTCTCCCAAGATGAGACTGACCCTGAAGCAGGAGAACCAGGAGGCCAGGGCTCTGAGGAGCAGAAAGTAGTTCAAGTGGTGGCCCCTGAGACAGGGCTGTGGCAGTGTCTACTGAGTGAAGGTGATAAGGTCAAGATGG BamHI ACTCCAGGATCCAGGTTTTATCCAGAGGGGTGAACCAGACAGTGTTCCTGGCTTGCGTGCTGGGTGGCTCCTTCGGCTTTCTGGGTTTCCTTGGGCTCTGCATCCTCTGCTGTGTCAGGTGCCGGCACCAACAGCGCCAGGCAGCACGAATGTCTCAGATCAAGAGGCTCCTCAGTGAGAAGAAGACCTGCCAGTGCCCCCACCGGATGCAGAAGAGCCATAATCTCATCTGATGACTCGAG
Stop XhoI
Sup.-Fig. 6b: Sequence of mouse CD4
mCD4_3.1+mCD4
mCD4_3.1+mCD4
106 Chapter 10
Sup.-Fig. 7a: Map of the mouse CX3CL1 trunc (mCX3CL1 trunc_3.1+) expression vector
EcoRI ןP →+1 GAATTCGCCACCATGGCTCCCTCGCCGCTCGCGTGGCTGCTGCGCCTGGCCGCGTTC TTCCATTTGTGTACTCTGCTGCCGGGTCAGCACCTCGGCATGACGAAATGCGAAATC ATGTGCGACAAGATGACCTCACGAATCCCAGTGGCTTTGCTCATCCGCTATCAGCTA AACCAGGAGTCCTGCGGCAAGCGTGCCATTGTCCTGGAGACGACACAGCACAGACGC TTCTGTGCTGACCCGAAGGAGAAATGGGTCCAAGACGCCATGAAGCATCTGGATCAC CAGGCTGCTGCCCTCACTAAAAATGGTGGCAAGTTTGAGAAGCGGGTGGACAATGTG ACACCTGGGATCACCTTGGCCACTAGGGGACTGTCCCCATCTGCCCTGACAAAGCCT GAATCCGCCACATTGGAAGACCTTGCTTTGGAACTGACTACTATTTCCCAGGAGGCC AGGGGGACCATGGGGACTTCCCAAGAGCCACCGGCAGCAGTGACCGGATCATCTCTC TCAACTTCCGAGGCACAGGATGCAGGGCTTACGGCTAAGCCTCAGAGCATTGGAAGT
PflMI TTTGAGGCGGCTGACATCTCCACCACCGTTTGGCCGAGTCCTGCTGTCTACCAATCT GGATCTAGCTCCTGGGCTGAGGAAAAAGCTACTGAGTCCCCCTCCACTACAGCCCCA TCTCCTCAGGTGTCCACTACTTCACCTTCAACCCCAGAGGAAAATGTTGGGTCCGAA GGCCAACCCCCATGGGTCCAGGGACAGGACCTCAGTCCAGAGAAGTCTCTAGGGTCT GAGGAGATAAACCCAGTTCATACTGATAATTTCCAGGAGAGGGGGCCTGGCAACACA GTCCACCCCTCAGTGGCTCCCATCTCCTCTGAAGAGACCCCCAGCCCAGAGCTGGTG GCCTCGGGCAGCCAGGCTCCTAAGATAGAGGAACCCATCCATGCCACTGCAGATCCC CAGAAACTGAGTGTGCTTATCACTCCTGTCCCCGACACCCAGGCAGCCACAAGGAGG CAGGCAGTGGGGCTACTGGCTTTCCTTGGTCTTCTTTTCTGCCTAGGGGTGGCCATG TTTGCTTACCAGAGCTGACTCGAG
Stop XhoI
Sup.-Fig. 7b: Sequence of mouse CX3CL1 trunc
mCX3CL1 trunc_3.1+
mCX3CL1trunc
6496 bp
mCX3CL1 trunc_3.1+
mCX3CL1trunc
6496 bp
Supplements 107
Sup.-Fig. 8a: Map of the mouse CX3CL1/CD4 trunc (mCX3CL1/CD4 trunc_3.1+) expression vector
EcoRI ןP →+1
GAATTCGCCACCATGGCTCCCTCGCCGCTCGCGTGGCTGCTGCGCCTGGCCGCGTTCTTCCATTTGTGTACTCTGCTGCCGGGTCAGCACCTCGGCATGACGAAATGCGAAATCATGTGCGACAAGATGACCTCACGAATCCCAGTGGCTTTGCTCATCCGCTATCAGCTAAACCAGGAGTCCTGCGGCAAGCGTGCCATTGTCCTGGAGACGACACAGCACAGACGCTTCTGTGCTGACCCGAAGGAGAAATGGGTCCAAGACGCCATGAAGCATCTGGATCACCAGGCTGCTGCCCTCACTAAAAATGGTGGCAAGTTTGAGAAGCGGGTGGACAATGTGACACCTGGGATCACCTTGGCCACTAGGGGACTGTCCCCATCTGCCCTGACAAAGCCTGAATCCGCCACATTGGAAGACCTTGCTTTGGAACTGACTACTATTTCCCAGGAGGCCAGGGGGACCATGGGGACTTCCCAAGAGCCACCGGCAGCAGTGACCGGATCATCTCTCTCAACTTCCGAGGCACAGGATGCAGGGCTTACGGCTAAGCCTCAGAGCATTGGAAGT
PflMI TTTGAGGCGGCTGACATCTCCACCACCGTTTGGCCGAGTCCTGCTGTCTACCAATCTGGATCTAGCTCCTGGGCTGAGGAAAAAGCTACTGAGTCCCCCTCCACTACAGCCCCATCTCCTCAGGTGTCCACTACTTCACCTTCAACCCCAGAGGAAAATGTTGGGTCCGAAGGCCAACCCCCATGGGTCCAGGGACAGGACCTCAGTCCAGAGAAGTCTCTAGGGTCTAAAGTGGCTCAGCTCAACAATACTTTGACCTGTGAGGTGATGGGACCTACCTCTCCCAAGATGAGACTGACCCTGAAGCAGGAGAACCAGGAGGCCAGGGTCTCTGAGGAGCAGAAAGTAGTTCAAGTGGTGGCCCCTGAGACAGGGCTGTGGCAGTGTCTACTGAGTGAAGGTGATAAGGTCAAGATGGACTCCAGGATCCAGGTTTTATCCAGAGGGGTGAACCAGACAGCAGTGGGGCTACTGGCTTTCCTTGGTCTTCTTTTCTGCCTAGGGGTGGCCATG TTTGCTTACCAGAGCTGACTCGAG Stop XhoI
Sup.-Fig. 8b: Sequence of mouse CX3CL1/CD4 trunc (CD4 sequence in bold)
mCX3CL1/CD4 trunc_3.1+
mCX3CL1/CD4 truncmCX3CL1/CD4
trunc_3.1+
mCX3CL1/CD4 trunc
108 Declaration
DECLARATION
I hereby declare, that this thesis was carried out at RWTH Aachen University,
within the Institute for Pharmacology and Toxicology and the Institute for
Molecular and Cardiovascular Research. It was exclusively performed by myself,
unless other wise stated in the text. To my knowledge, it contains no material used
in other publications or thesis, except where reference is made in the text.
Michael Andrzejewski
Acknowledgements 109
ACKNOWLEDGEMENTS
Special thanks go to my supervisor, Dr. Andreas Ludwig for the professional guidance
through these years and especially during the last months. In addition, I would like to
thank my co-supervisor, Prof. Dr. Elling, for reviewing this thesis. Thank you also to
Prof. Stefan Uhlig and Prof. Christian Weber for their technical and intellectual input.
Also I want to thank all members of the AG Ludwig laboratory for their support. Thank
you to Martin for helping me with the virus stuff. Special thanks go also to Tanja, without
your support many of these results could have never been obtained.
I would also like to thank the people of the Institute for Pharmacology and Toxicology
for sharing some funny moments. Thank you to Svenja, Martin H., Maik, Yvonne, Ali,
Birgit, Martin S. and Regina for a lot of great moments, especially during our poker
sessions.
Thank you to Herdis and Ute helping me writing this thesis. I am looking forward to
some sailing trips.
Barbara, thank you for being so patient and helpful and giving me a lot of support
through these years, not only during the scientific work.
Last but no least, I want to thank my parents, Helena and Siegfried, without their support
not only through the last years these doctoral studies never could have happened.
110 Curriculum vitae
CURRICULUM VITAE
PERSONAL DATA Name: Michael Andrzejewski Birthday: 09.05.1980 Town of birth: Torun (Poland) Citizenship: German PROFESSIONAL EXPERIENCE 2006-2009 Scientific staff, Ph.D. student
• RWTH Aachen Medical School, Institute for Pharmacology and Toxicology & Institute for Molecular and Cardiovascular Research
2005-2006 Diploma student
• The University of Melbourne Department of Biochemistry and Molecular Biology
2004-2005 Internship, followed by a research assistant position
• RWTH Aachen Medical School, The Institute of Biochemistry
EDUCATION
since 2006 RWTH Aachen University • Biology, cand. Dr. rer. nat • Economics, cand. Dipl.-Wirt.-Biol.
2000-2006 RWTH Aachen University & The University of Melbourne
• Biology, Dipl.-Biol. 1990-1999 Helmholtz-Gymnasium, Dortmund, Germany
• Abitur
Aachen, 13.01.2010