Renal Anemia Induced by Chronic Ingestion of Depleted Uranium in

TOXICOLOGICAL SCIENCES 103(2), 397–408 (2008)

doi:10.1093/toxsci/kfn052

Advance Access publication March 28, 2008

Renal Anemia Induced by Chronic Ingestion of Depleted Uranium in Rats

Hanaa Berradi,* Jean-Marc Bertho,* Nicolas Dudoignon,* Andre Mazur,† Line Grandcolas,* Cedric Baudelin,*

Stephane Grison,* Philippe Voisin,* Patrick Gourmelon,* and Isabelle Dublineau*,1

*Institut de Radioprotection et de Surete Nucleaire, Direction de la RadioProtection de l’Homme, Service de Radiobiologie et d’Epidemiologie, F-92262Fontenay-aux-Roses Cedex, France; and †Unite des Maladies Metaboliques et Micronutriments, Institut National de la Recherche Agronomique, Centre de

Clermont-Ferrand/Theix, F63122 Saint-Genes Champanelle, France

Received December 5, 2007; accepted March 2, 2008

Kidney disease is a frequent consequence of heavy metal

exposure and renal anemia occurs secondarily to the progression

of kidney deterioration into chronic disease. In contrast, little is

known about effects on kidney of chronic exposure to low levels of

depleted uranium (DU). Study was performed with rats exposed

to DU at 40 mg/l by chronic ingestion during 9 months. In the

present work, a ~20% reduction in red blood cell (RBC) count was

observed after DU exposure. Hence, three hypotheses were tested

to determinate origin of RBC loss: (1) reduced erythropoiesis,

(2) increased RBC degradation, and/or (3) kidney dysfunction.

Erythropoiesis was not reduced after exposure to DU as revealed

by erythroid progenitors, blood Flt3 ligand and erythropoietin

(EPO) blood and kidney levels. Concerning messenger RNA

(mRNA) and protein levels of spleen iron recycling markers from

RBC degradation (DMT1 [divalent metal transporter 1], iron

regulated protein 1, HO1, HO2 [heme oxygenase 1 and 2], cluster

of differentiation 36), increase in HO2 and DMT1 mRNA level

was induced after chronic exposure to DU. Kidneys of DU-

contaminated rats had more frequently high grade tubulo-

interstitial and glomerular lesions, accumulated iron more

frequently and presented more apoptotic cells. In addition,

chronic exposure to DU induced increased gene expression of

ceruloplasmin (312), of DMT1 (32.5), and decreased mRNA

levels of erythropoietin receptor (30.2). Increased mRNA level of

DMT1 was associated to decreased protein level (30.25). To

conclude, a chronic ingestion of DU leads mainly to kidney

deterioration that is probably responsible for RBC count decrease

in rats. Spleen erythropoiesis and molecules involved in erythro-

cyte degradation were also modified by chronic DU exposure.

Key Words: metal; iron homeostasis; chronic; ingestion; kidney;

depleted uranium.

The properties of kidney to reabsorb and accumulate

divalent metals make these tissues the first target of heavy

metal intoxication. For instance, acute exposure to chromium

leads to tubular necrosis, and tubular proteinuria observed in

workers suggests that chronic chromium exposure might also

induce tubular lesions (Wedeen and Qian, 1991). In a clinical

study, chronic exposure to dietary cadmium (Cd) was

associated with chronic end-stage renal failure (Satarug and

Moore, 2004). Experimentally, it has been shown that chronic

contamination to low levels of Cd induces tubular damages in

rat (Brzoska et al., 2003). Lead is well known to induce, among

others, renal insufficiency (Patrick, 2006).

Kidney is also particularly sensitive to uranium, a radioactive

heavy metal. In 1909, it was shown histologically for the first

time that acute uranium exposure induced nephrotoxicity

(Dickson, 1909). Because then, several authors evidenced the

consequences of acute exposure to high uranium concentrations

on kidney at histological, cellular, and molecular levels

(Bencosme et al., 1960; Goldman et al., 2006). However,

though the effects of acute uranium exposure on kidney are well

documented, the renal response to chronic contamination with

small depleted uranium (DU) doses remains unknown.

Nowadays the biological effects of chronic exposure to DU

are becoming an increasing concern. Extensive civil and

military applications using DU lead to increased environmental

contamination which means it is important to address the

consequences of its ingestion via the food chain and/or drinking

water on human health (Abu-Qare and Abou-Donia, 2002).

There is accumulating evidence that shows effects of chronic

exposure to small doses of DU on the central nervous system

(Lestaevel et al., 2005), liver (Gilman et al., 1998; Pellmar

et al., 1999a, b; Souidi et al., 2005; Tissandie et al., 2007),

intestine (Dublineau et al., 2007), lung (Souidi et al., 2005), and

kidney (Donnadieu-Claraz et al., 2007; Taulan et al., 2004). In

light of the previous data concerning kidney and acute uranium

exposure, investigations about the effects of daily DU exposure

on kidney are of public health interest. As it is broadly accepted

that renal deterioration may lead to the progression of chronic

kidney disease responsible for anemia, it could be hypothesized

that chronic long-term ingestion of DU may result in

progressive kidney deterioration, which would induce hemato-

logical changes. To test this hypothesis, rats were subjected to

9-month contamination with 40 mg DU/l in their drinking

water. Their blood cell count was then examined. A decrease

1 To whom correspondence should be addressed at Institut de Radioprotection

et de Surete Nucleaire, Direction de la RadioProtection de l’Homme, Service de

Radiobiologie et d’Epidemiologie, Laboratoire de Radiotoxicologie

Experimentale, IRSN, B. P. n�17, F 92262 Fontenay-aux-Roses Cedex, France.

Fax: þ33-1-58-35-84-67. E-mail: [email protected].

� The Author 2008. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved.For Permissions, please email: [email protected].

The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article fornon-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publicationwith the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. Forcommercial re-use, please contact [email protected].

Dow

nloaded from https://academ

ic.oup.com/toxsci/article/103/2/397/1618553 by guest on 17 February 2022

was observed in their red blood cell (RBC) content. To explain

this reduction, three hypotheses were tested: reduced erythro-

poiesis, elevated RBC degradation and renal deterioration. The

present study demonstrates that the diminution of RBC number

induced by chronic exposure to DU was mainly due to renal

deterioration. In spleen, erythropoiesis was slightly increased,

as well as iron recycling (via increased messenger RNA

[mRNA] levels of DMT1 [divalent metal transporter 1]).

MATERIALS AND METHODS

Animals. Sprague–Dawley male rats (Charles River, France) weighed 250 g

at the beginning of the experiment. The rats were housed in pairs, with a 12-h

light/12-h dark cycle (light on: 08:00 h/20:00 h) and a temperature of 22 ± 1�C.

Animals were given ad libitum standard diet (Safe, R04 chow, France).

Drinking mineral water was also delivered ad libitum. All experimental

procedures were approved by the Animal Care Committee of the Institute of

Radiation protection and Nuclear Safety and complied with French regulations

for animal experimentation (Ministry of Agriculture Act No. 87-848, October

19, 1987, modified 29 May 2001).

DU exposure. Rats (3 months old) were divided into two groups: an

experimental group exposed to DU (DU-contaminated rats) in their drinking

mineral water for 9 months and a second group of control rats that received the

same drinking mineral water without DU. The mineral water used for DU

exposure has the following composition (in mg/l): Ca2þ, 78; Mg2þ, 24; Naþ, 5;

Kþ, 1; SO42�, 10; HCO3

�, 357; Cl�, 4,5. The DU concentration in water was 40

mg/l (specific activity, 25.103 Bq/g; 238U, 99.28%; 235U, 0.72%; 234U,

0.0056%; Merck, Strasbourg, France). The DU dose chosen in the present

study was twice the highest environmental concentrations found in Finland

(20 mg/l; Juntunen, 1991). In rat, this concentration corresponded to a daily

ingestion of 1 mg per animal. DU-contaminated and control rats were raised in

the same conditions with weekly measurement of their body weight, food, and

water intake during the whole experiment.

Plasma and organ sampling. Rats were anesthetized by inhalation (TEM

anesthesia, Angers, France) of 95% air/5% isoflurane (Forene, Abbott, Rungis,

France) and killed by intracardiac puncture with a 10-ml syringe to collect blood.

Spleen and kidney were then excised, weighed, quickly frozen in liquid nitrogen and

stored at �80�C. One third of the spleen and one femur were placed in washing

medium composed of RPMI (Roswell Park Memorial Institute) 1640 medium

supplemented with penicillin, streptocin, and 1% fetal calf serum (all from

Invitrogen, le Pont de Claix, France) until they were processed for cell culture.

Blood analysis. A complete blood cell count was carried out immediately

after blood collection on an automated cell counter, MS9 (Melet Schloesing

Laboratoires, Osny, France). Blood was centrifuged at 40003 g at 4�C for 10 min

to collect serum or plasma. Serum and plasma were aliquoted and stored at�80�C.

The serum unsaturated iron binding capacity (UIBC) of control and

DU-contaminated rats was estimated colorimetrically at 600 nm using

a colorimetric kit (UIBC-Test or Fer-CTF, Biolabo, Maizy, France) according

to the manufacturer’s instructions. The total iron binding capacity (TIBC) was

then calculated as the sum of the UIBC and serum iron concentration.

Plasma concentrations of Flt3 ligand (Flt3l) and erythropoietin (EPO) were

measured by a sandwich enzyme-linked immunosorbent assays according to

the manufacturer’s recommendation (R&D Systems, Abington, UK). The

sensitivity of the assays was 5 pg/ml for Flt3 ligand and 12.5 pg/ml for EPO.

Plasma urea and creatinine of DU-contaminated and control rats were

measured using kit reagents and automated Konelab 20 apparatus (Thermo

Electron Corporation, Courtaboeuf, France).

Colony-forming cell assays. Spleen was crushed into a tissue grinder and

femurs were flushed using a 10-ml syringe mounted with a 19-G needle with

washing medium. Cell suspensions were centrifuged 10 min at 400 3 g. Cells

were counted in the presence of 1:10 dilution of trypan blue dye. This allowed

the determination of cell viability by trypan blue exclusion. Spleen and bone

marrow cells were then plated at 5 3 105 and 5 3 104 cells, respectively, in 1.1

ml of complete methyl cellulose medium with recombinant cytokines (Stem

Cell Technologies, Vancouver, Canada). Cultures were incubated at 37�Cin 95% air/5% CO2 in a humidified atmosphere. Colony-forming units–

granulocyte macrophage (CFU-GM), burst-forming units–erythroid (BFU-E),

and CFU-granulocyte erythrocyte monocyte megakaryocytes were scored when

composed of more than 50 white cells and/or red cells onto an inverted

microscope on day 12 of culture.

Gene expression analysis. Total RNA from spleen and kidney of both

control and DU-contaminated rats were extracted with the RNeasy total RNA

isolation Kit (Qiagen, Courtaboeuf, France) according to the manufacturer’s

instructions. Firstly, a lysis buffer containing 1% beta-mercaptoethanol was

added to tissues that were then crushed using ribolyser (Hybaid, Thermo-

scientific, Courtaboeuf, France). After a 3-min centrifugation at 11,000 3 g, the

tissue lysates were homogenized with 70% ethanol and distributed on RNeasy

column with silica resin. Different steps of elution and centrifugation were then

applied. ARN was finally eluted with 40 ll of RNAse free water. The RNA

quality was assessed by electrophoresis on ethidium bromide-stained agarose

gel and by A260/A280 nm absorption ratio. One microgram of total RNA was

reverse transcribed in complimentary DNA (cDNA) using BD Sprint PowerScript

PrePrimed 96 Plate (BD Biosciences Clontech, Erembodegem, Belgium).

The following genes were studied: DMT1, Ireg1 (iron regulated protein 1),

HO1, HO2 (heme oxygenase 1 and 2), CD36 (cluster of differentiation 36),

EPO, erythropoietin receptor (EPOR), CP (ceruloplasmin), and the housekeep-

ing gene hypoxanthine–guanine phosphoribosyltransferase (HPRT). The

sequences for the forward and reverse primers used in the present study are

listed in Table 1. Except for Ireg1 primers which were chosen from literature

(Collins et al., 2005), primers were designed using PrimerTool (http://

biotools.umassmed.edu/bioapps/primer3_www.cgi, funded by Howard Hughes

Medical Institute and by the National Institutes of Health, National Human

Genome Research Institute). Experiments were performed with the ABI prism

7000 apparatus (Applied Biosystems, Courtaboeuf, France). Relative mRNA

levels were quantified using the comparative DDCT method. The relative

quantification of the target, normalized to an endogenous reference (HPRT) and

a relevant uncontaminated control, equals 2�DDCT , with DDCT defined as the

difference between the mean DCT (contaminated sample) and mean DCT (control

sample) and DCT as the difference between mean CT (interest gene) and CT (HPRT) as

the endogenous control. Each sample was monitored for fluorescent dyes, and

signals were regarded as significant if the fluorescence intensity significantly

exceeded (10-fold) the standard deviation of the baseline fluorescence, defined

as threshold cycles (CT). The data were thus expressed as the ratio of each

specific gene expression to HPRT used as housekeeping gene.

Protein analysis. The following proteins were studied: DMT1, HO1,

HO2, CD36, and the housekeeping protein glyceraldehyde-3-phosphate

dehydrogenase (GAPDH). Tissues extracted (~30 mg) from spleen of control

and DU-contaminated rats were homogenized in a cold cell lysis buffer (radio

immunoprecipitation assay buffer) containing protease-inhibitor cocktail

(Sigma Aldrich, St-Quentin-Fallavier, France). After 20 min of incubation on

ice, samples were centrifuged at 12,500x g at 4�C. Supernatants were aliquoted

and stored at �80�C. Protein concentrations were determined using the

Bio-Rad protein assay kit (Bio-Rad, Marnes-la-Coquette, France).

Tissue lysates (50 lg) were subjected to electrophoresis and Western blotted

using anti-rat DMT1 polyclonal rabbit antibody (Interchim, Montlucxon, France),

polyclonal goat anti-rat HO1, polyclonal goat anti-human HO2, polyclonal goat

anti-human CD36 (Tebu-bio, Le Perray-en-Yvelines, France) and anti-human

GAPDH rabbit polyclonal antibodies (Tebu-bio) used as the internal reference

antibody. Chemiluminescence was detected according to manufacturer’s protocol

(ECL, Millipore, Saint-Quentin-en-Yvelynes, France). Band densities were

quantified using the LAS3000 apparatus (Fujifilm, Raytest, Courbevoie, France)

and normalized to the total amount of control protein (GAPDH).

398 BERRADI ET AL.

Dow



http://biotools.umassmed.edu/bioapps/primer3_www.cgi

http://biotools.umassmed.edu/bioapps/primer3_www.cgi

Determination of iron level in rat kidney. Quantification of iron

concentration was performed in kidneys of both control and DU-contaminated

rats. This assay was based on a methodology kindly communicated by Dr

Schumacher (Mok et al., 2004). Tissue samples were digested in 3N HCl with

10% trichloroacetic acid at 65�C overnight. Colorimetric iron determination of

supernatants was performed using the Direct Method reagents (Biolabo)

according to the manufacturer’s instructions.

Histological analyses. Renal segments were fixed in a 4% formaldehyde

solution (Carlo Erba, Rueil Malmaison, France) at room temperature. Kidney

samples were then dehydrated, embedded in paraffin, and cut in 5-lm-thick

sections. A hematoxylin–eosin–saffron (HES) staining of paraffined slides was

then performed.

The histological analysis was performed in a single-blind manner by

a histopathologist (Dr Dudoignon). Glomerular lesions were semiquantitatively

scored as none (0þ), mild (1þ), moderate (2þ), or severe (3þ). Tubulo-interstitial

lesions were scored on the basis of tubular atrophy, dilation, hyaline casts and

interstitial fibrosis as follows: 0 ¼ no lesion; 1 ¼ very minor dilation; 2 ¼ larger

presence of dilated tubules; 3 ¼ marked tubular dilation and interstitial fibrosis.

The proliferative cells in the renal section were estimated following the

immunohistochemical staining of Ki67, antigen present on a 36-kDa nuclear

protein (dilution ¼ 1/100, Dako, Trappes, France).

Cell apoptosis in the kidney was analyzed using immunohistochemical

staining (in situ cell death detection kit with the TUNEL [terminal deoxynucleo-

tidyl transferase–mediated deoxyuridine triphosphate nick end labeling]

technique, Roche Diagnostics, Meylan, France) following the manufacturer’s

instructions. The number of apoptotic cells was estimated in the whole section.

Iron deposition was detected using Prussian blue staining according to the

manufacturer’s recommendations (Accustain, Sigma). Iron deposition was

classified as follows: small deposits (point staining), intermediate iron deposits

(splash staining), and clustered iron deposits (aggregate staining) (see Fig. 4).

The extension of each class of iron deposition was estimated semiquantitatively

using the following scales: 0 ¼ none, 1 ¼ mild; 2 ¼ moderate; 3 ¼ marked.

Statistical analysis. The results are expressed as mean ± SEM for seven

animals unless otherwise indicated. Comparisons between groups were performed

using Student’s t-test for nonpaired data or the nonparametric Mann–Whitney test

(SigmaStat3.0, Systat software). The text of this report comments on signifi-

cant differences (p � 0.05) or strong trends (p � 0.10) when appropriated

within control and DU-contaminated groups, with relevant p values quoted.

Results

Changes in General Hematological Parameters

The blood cell count and global iron status (serum iron

content and iron binding capacity) were measured in both

control and DU-contaminated rats (Table 2). The RBC amount

was decreased by about 20% in DU-contaminated animals as

compared with control rats (p < 0.05). This reduction was

associated with a similar 20% diminution of hematocrit (p ¼0.051) and hemoglobin levels (p ¼ 0.056). Other hematolog-

ical parameters (leucocytes, mean corpuscular volume and

platelets) were similar between the two groups (data not

shown). Iron concentration and iron total and unsaturated

binding capacities were not modified statistically by DU

contamination.

DU Effects on Hematopoiesis

The origin of RBC changes was first investigated within the

hematopoietic system: a decrease in erythropoiesis may lead to

a reduced RBC count. Hematopoietic activity was compared

between control and DU groups using CFC assays in both

spleen and bone marrow as well as blood cytokine measure-

ments. The chronic ingestion of DU increased the frequency of

CFU-GM and BFU-E from spleen whereas it did not affect

bone marrow progenitors (Fig. 1a). BFU-GM progenitors were

increased by 2.7-fold and BFU-E by 1.5-fold in spleen after

TABLE 2

DU Effects on Hematological Parameters

Control (n ¼ 7) DU (n ¼ 8) p

Complete blood count

RBC (1012/l) 10.2 ± 0.5 8.3 ± 0.7 0.048*

Hemoglobin (g/l) 15.8 ± 1.8 12.8 ± 2.5 0.056

Hematocrit (%) 55.9 ± 3.1 45.5 ± 3.7 0.051

Leucocytes (109/l) 5.1 ± 0.9 5.2 ± 1.0 ns

Iron and binding capacity

Iron concentration (lmol/l) 48.9 ± 7.4 39.5 ± 5.6 ns

UIBC (lmol/l) 90.2 ± 19.1 81.8 ± 8.6 ns

TIBC (lmol/l) 139 ± 15 121 ± 13 ns

Note. Statistical analyses were performed using Student t-test. *p < 0.05

significantly different from control group. A significant decrease was observed

in RBC number. Hemoglobin and hematocrit also tended to diminish after

chronic DU ingestion. ns, not significant.

TABLE 1

Primers Sequences Used for Quantitative Real-Time PCR

Primer name Accession number Forward sequence Reverse sequence

Iron flux DMT1a gi:2327066 5#GATTCCAGACGATGGTGCTT3# 5#GTGAAGGCCCAGAGTTTACG3#Ireg1 gi:18846873 5#GTGGATAAGAATGCCAGACT3# 5#CGCAGAGAATGACTGATACA3#

Heme degradation HO1 gi:60551392 5#ACACCAGCCACACAGCACTA3# 5#GAAGGCGGTCTTAGCCTCTT3#HO2 gi:38304017 5#GGGAAGGGACCCAGTTCTAC3# 5#TCCCAGGGTACCTTTGTCTG3#

Adhesion receptor CD36 gi:48675378 5#TCGTATGGTGTGCTGGACAT3# 5#CGATGGTCCCAGTCTCATTT3#Superoxide scavenger CP gi:499668 5#ATGTGATGGCTATGGGCAATG3# 5#TTCCCCTGTGCTTGTATTGGA3#Erythropoiesis EPO gi:8393315 5#AATTGATGTCGCCTCCAGAC3# 5#GTGACACAGTGACGGTGAGC3#

EPOR gi:59709454 5#TGAGTGTGTCCTGAGCAACC3# 5#CCAGCACAGTCAGCAACAGT3#

aDMT1 primers can amplify both iron responsive element and non-iron responsive element forms of DMT1 cDNA.

RENAL INJURY INDUCED BY DU DAILY INGESTION 399

Dow



DU exposure. Hematopoietic activity was also assessed by

measuring two markers, Flt3 ligand and EPO (Fig. 1b).

Chronic exposure to DU did not induce changes in blood

concentrations of the studied cytokines. Reduced erythropoi-

esis may also be reflected by changes in EPO which mRNA

levels are informative of EPO synthesis. After 9-month DU

exposure, EPO mRNA relative levels remained unchanged

(Fig. 1c). These results indicated that DU contamination did

not induce significant changes in general hematopoiesis and

erythropoiesis.

Alterations in Spleen Iron Recycling

RBC reduction could also be a consequence of an increased

rate of erythrocyte degradation that increases iron recycling

from heme degradation. The modifications in iron recycling

from RBC degradation were thus estimated in the spleen by

measuring the expression levels of proteins involved in iron

flux (DMT1, Ireg1), heme degradation (HO1 and HO2) and

RBC adhesion (CD36) (Fig. 2). Chronic exposure to DU

enhanced the expression of iron transport. DMT1 mRNA levels

were increased by threefold (p ¼ 0.05), meanwhile the twofold

augmentation in the Ireg1 gene expression was not significant

(Fig. 2a). DU exposure affected also heme degradation through

an increase in mRNA levels of HO2 (threefold, p ¼ 0.034)

whereas HO1 gene expression was not affected. Expression of

the RBC adhesion receptor CD36 remained unchanged with

chronic DU ingestion. The relative protein levels of DMT1,

FIG. 1. DU effects on rat hematopoiesis. (a) Effect of DU contamination

on BFU-E and CFU-GM from rat spleen and bone marrow cells. Results are

expressed as mean ± SEM of progenitor frequency per 105 mononuclear cell

(n ¼ 5 animals per group, *p < 0.05, ***p < 0.001). (b) Blood concentrations

of hematopoiesis markers, that is, Flt3 ligand (Flt3l) and EPO. Data are

expressed as mean ± SEM (n ¼ 7 for each group). C ¼ control group. (c)

Kidney mRNA encoding for EPO analyzed by real-time RT-PCR. The kidney

target mRNA levels were normalized to the housekeeping HPRT mRNA and

are shown as a ratio to control animals. Results are expressed as mean ± SEM

(n ¼ 7 for each group, *p < 0.05).

FIG. 2. Changes in expression of splenic iron recycling markers. (a)

Spleen relative mRNA levels of genes involved in iron recycling from red cell

degradation. Relative mRNA levels of iron recycling associated molecules, that

is, iron flux (DMT1, Ireg1), heme degradation (HO1, HO2), and red cell

adhesion (CD36) were analyzed by real-time RT-PCR. Levels of mRNA were

normalized to the housekeeping HPRT gene and are shown as a ratio to control

animals. These results are expressed as means ± SEM (n ¼ 7 for each group,

*p < 0.05). (b) Spleen proteins associated with iron recycling analyzed by

Western blot. Above: detection of DMT1, HO1, HO2, and CD36 proteins by

immunoblotting in spleen homogenates. GAPDH was used as a loading

control. Below: protein relative levels of DMT1, HO1, HO2, and CD36. The

results are expressed as means ± SEM of the target protein band intensity as

compared with GAPDH band intensity (n ¼ 4 for each group, *p < 0.05).

There was no significant difference in DMT1, HO1, HO2, and CD36 relative

protein levels between control and DU-contaminated rats.

400 BERRADI ET AL.

Dow



HO1, HO2, and CD36 are indicated in the Figure 2b. These

protein levels were not modified statistically by DU exposure.

These data suggested that an increase in RBC degradation

for iron recycling may probably not be at the origin of RBC

diminution observed after 9 months of chronic exposure to DU.

It is broadly accepted that renal deterioration may lead to the

progression of chronic kidney disease responsible for anemia.

Renal deterioration was thus the last tested hypothesis to

explain reduction in RBC.

Modifications in the Expression of Renoprotective Genes

Renal dysfunction would be reflected—among others—by

changes in renoprotective genes mRNA levels. The renopro-

tective genes measured here were EPOR because of its

antiapoptotic role in kidney (Westenfelder, 2002), HO1 and 2

which have been shown to play a key role in cellular defenses

(Maines and Panahian, 2001), and CP the so-called ‘‘Super-

oxide scavenger’’ that oxidizes toxic ferrous iron to non toxic

ferric iron (Goldstein et al., 1982). The mRNA levels of EPO

and renoprotective genes were quantified relatively to the

HPRT reference gene (Fig. 3). The EPOR expression was

reduced by about 90% after chronic ingestion of DU. The

relative mRNA levels of heme degradation enzymes HO1 and

HO2 were not modified by exposure to DU. CP mRNA relative

levels of DU-contaminated rat kidneys were 12-fold higher

than those of control animals.

DU and Iron Accumulation in Kidney

The tissue iron content in kidney was evaluated in control

and DU-contaminated rats. There was no significant difference

in the renal iron concentration between control (8.86 ± 5.93

lg/g tissue; n ¼ 7) and DU-contaminated animals (7.96 ± 1.74;

n ¼ 8).

Iron deposits in tissue were observed using Prussian blue

staining (Fig. 4). As shown in Figure 4a, iron deposits were

classified in small, intermediate and clustered iron deposits.

The observed kidney sections were divided in three distinct

parts for analysis: cortex, outer medulla and inner medulla for

which the different levels of iron deposition were estimated

semiquantitatively (Fig. 4b). Concerning small iron deposits,

statistical analysis showed that there was no significant

difference between control and DU rats regardless of kidney

section part. Intermediate size iron deposits were increased

after chronic exposure to DU in the whole kidney section: they

were augmented by ~1.5-fold in the cortex, (non significant);

approximately fourfold in the outer medulla (p ¼ 0.02) and

approximately ninefold in the inner medulla (p ¼ 0.02). Iron

aggregates—referred as clustered iron deposits—were ob-

served more frequently in DU rats than in control rats: approxi-

mately twofold in the renal cortex (p ¼ 0.02); approximately

threefold in the outer medulla (p ¼ 0.02) and approximately

twofold in the inner medulla (nonsignificant).

These data indicate that DU exposure modified the distri-

bution of iron in kidney, but not the total content in this tissue.

Kidney Iron Transport is Altered by DU Contamination

The expression of DMT1, apical iron transporter, was

quantified at both mRNA and protein levels. Relative DMT1

gene expression was increased by approximately threefold in

kidney (Fig. 5a). On the contrary, renal DMT1 protein levels

were decreased by 80% in DU-contaminated rats as compared

with control rats (Fig. 5b).

Histological Changes of Kidney Tissue with followingContamination

Creatinine and urea blood concentrations were evaluated in

control and DU-contaminated rats. The values of blood

creatinine were 55.56 ± 2.56 lmol/l and 52.91 ± 2.33 for

control (n ¼ 6) and DU-exposed (n ¼ 6) rats respectively,

FIG. 3. Effects of 9-month chronic ingestion of DU on renoprotective

genes. Kidney mRNA encoding for EPOR, HO1, HO2, and CP analyzed by

real-time RT-PCR. The kidney target mRNA levels were normalized to the

housekeeping HPRT mRNA and are shown as a ratio to control animals.

Results are expressed as mean ± SEM (n ¼ 7 for each group, *p < 0.05).


Dow



indicating no functional alterations of renal function after

DU exposure. This was confirmed by the lack of signifi-

cant difference of blood urea levels between control rats

(6.45 ± 0.50; n ¼ 6) and DU-contaminated animals (6.02 ±0.36; n ¼ 6).

Representative histological slides of kidney sections are

presented in Figure 6. This figure indicated clearly tubular

dilation and presence of hyaline casts in kidney of DU-

contaminated animals. The degree of lesion observed in renal

glomerular and tubulo-interstitial tissues was scored in control

and DU rats. In the control group, glomerular lesion scores

were equally dispersed between grades 0 and 1, whereas in the

DU group, glomerular lesions were mostly found to be grade 1.

However, no clear distinction was observed between the two

experimental groups. Tubulo-interstitial lesion scores of control

rats were distributed homogenously between 0 and 3, whereas

a major part of the DU-contaminated group had higher grades

of tubulo-interstitial lesions: 70% of animals had a lesion

degree � 2. These results suggest that chronic DU exposure

induced especially tubulo-interstitial lesions.

DU Affects Kidney Apoptosis

The influence of DU exposure on kidney apoptosis and

proliferation was evaluated by immunohistochemistry. On light

microscopy, apoptotic (TUNEL) and proliferative (Ki67) cells

were observed in control and DU-contaminated rat kidneys.

Representative sections are shown in Figure 7a. Quantification

of TUNEL-positive cell count indicated that the number of

apoptotic cells was enhanced by a factor of 2 in the

corticomedullary junction after DU chronic ingestion (p ¼0.026) whereas in the inner medulla, number of apoptotic cells

was not influenced by DU contamination (Fig. 7b). Concerning

proliferation, there was no significant difference in the number

of Ki67 positive proliferative cells in the corticomedullary

junction (-36%) and in the inner medulla (-51%) of DU-

contaminated rats when compared with control rats.

FIG. 4. DU daily ingestion increased iron deposition in kidney. (a) Representative sections of iron deposition in the renal cortex obtained by Prussian blue

staining in control (C) and DU-contaminated rat (objective, 340). Photographs represent small, intermediate, and clustered iron deposits. (b) Semiquantitative

estimation of iron deposition in kidney of control and DU-contaminated rats. C ¼ control rat. Data are expressed as mean ± SEM (n ¼ 4 for each group, *p < 0.05)

of the estimated iron deposition degree (0 ¼ none; 1 ¼ mild; 2 ¼ moderate; 3 ¼ high).

402 BERRADI ET AL.

Dow



Discussion

The present report shows for the first time that chronic

exposure to DU at dose similar to this found in the environment

induces renal deterioration responsible for a decrease in RBC

numbers. Renal anemia is known to be an early symptom in the

progression of chronic kidney disease. The present results thus

suggest that chronic DU ingestion may lead to renal anemia

consecutive to the progression of a DU-induced chronic kidney

disease. Previous records of hematological parameters after

chronic exposure to DU concerned the epidemiological survey

of human populations and proved to be contradictory (Pinney

et al., 2003; Shawky et al., 2002; Squibb and McDiarmid,

2006). For instance, hematocrit, hemoglobin and RBC content

from uranium processing site workers remained within the

normal ranges (Shawky et al., 2002) whereas surveyed

residents living around nuclear plant area revealed increases

in these hematological parameters (Pinney et al., 2003).

Similarly to the present work, a clinical study of Gulf War

veterans showed that soldiers exposed to uranium had

a reduction in hemoglobin and hematocrit levels (Squibb and

McDiarmid, 2006). This discrepancy between these studies

may be due to a difference in the exposure pathway (inhalation

for workers, ingestion for populations living on contaminated

territories and injury for soldiers), in the physical–chemical

form of uranium (particulate for workers and soluble for

civilian populations), in the received doses, in the duration of

exposure and the time postexposure, as well as in the

occurrence of exposure in these different cases of uranium

exposure. It can be noticed that Gulf War veterans presented

a similar decrease in hemoglobin and hematocrit levels than

rats chronically exposed to DU by ingestion, probably because

of the continuous liberation of uranium from embedded DU

fragments.

The mechanisms leading to the reduction in RBC amounts

obtained following chronic exposure to DU were then

explored. Three hypotheses could explain RBC decrease:

reduced erythropoiesis, increased erythrocyte degradation for

iron recycling or renal dysfunction.

Concerning erythropoiesis, spleen erythroid progenitors were

increased with the chronic ingestion of DU. This is contradictory

with the transient depression in erythropoiesis observed after the

intravenous injection of 1 mg uranium/kg (Giglio et al., 1989).

This previous report showed a reduction in plasmatic EPO

concentrations, whereas in the current work no change was

observed either in EPO plasmatic concentrations or EPO kidney

mRNA levels. Furthermore, the results obtained in the present

study indicate that the RBC productions in spleen and bone

marrow were not reduced by chronic exposure to uranium.

Consequently, a diminution in the erythropoiesis could not

explain the RBC decrease observed after chronic exposure to DU.

The second possible explanation of RBC diminution in DU-

contaminated rats was the increase in RBC degradation, which

implies an increase in spleen iron recycling. Chosen indicators

to study iron recycling were those implied in RBC attachment

(CD36), heme catabolism (HO1 and HO2) and iron flux

(DMT1, Ireg1) (Beaumont and Canonne-Hergaux, 2005). The

increase in DMT1 gene expression induced by DU exposure

could indicate an increase in iron transport. The increase in

mRNA level of molecules of DMT1 could indicate an increase

in iron flux, but this was not associated to increased protein

level. HO2 mRNA relative levels were also enhanced. However

these mRNA variations were not reflected at protein level. These

data indicate thus that iron recycling rate changes could not

explain the reduction in RBC after 9-month exposure to DU.

Renal dysfunction was thus the third hypothesis tested to

explain the reduction in RBC content after 9-month chronic

exposure to DU. Uranium-induced renal injury was first

described in the early 20th century following acute exposure

to high doses of uranium (Dickson, 1909). In 1915, Oliver,

observed a tubular dilation and hyaline casts in histological

kidney sections of guinea pigs and rats acutely contaminated

with 5 mg uranium (Oliver, 1915). More recently, extensive

tubular damage was induced following the intravenous

injection of 5 mg uranium/kg in rats (Fujigaki et al., 2003).

In this previous report, the tubules recovered 7 days after the

uranium injection, probably due to the increase in cell

proliferation. Chronic exposure to uranium was also demon-

strated to induce renal injury. A 4-week experimental chronic

exposure to uranium with doses ranging from 0.96 to 600 mg/l

FIG. 5. Renal expression of iron transporter DMT1 in DU-contaminated

and control rats. (a) Kidney DMT1 mRNA relative levels analyzed by real-time

RT-PCR. Levels of mRNA were normalized to the housekeeping HPRT gene

and are shown as a ratio to control animals. Results are expressed as means ±

SEM (n ¼ 7 for each group, *p < 0.05). (b) Renal DMT1 protein levels

analyzed by Western blot. Above: detection of DMT1 by immunoblotting in

kidney homogenates. GAPDH was used as a loading control. Below: protein

relative levels of DMT1. The results are expressed as means ± SEM of the

target protein band intensity as compared with GAPDH band intensity (n ¼ 4

for each group, **p < 0.01).


Dow



in drinking water evidenced that uranium-treated rat kidneys

were more likely to suffer from tubular dilation than those of

control rats (Gilman et al., 1998). These different data are

consistent with the tubular lesions seen in the current report

after chronic exposure to 40 mg uranium/l. It is well known

that functional renal deterioration correlates more closely with

the extent of tubulo-interstitial injury than glomerular pathol-

ogy both in humans and in animal models of kidney disorders

(Alfrey and Hammond, 1990; Risdon et al., 1968). This tubular

localization of renal deterioration is thus in accordance with the

tubulo-interstitial lesions observed after chronic exposure to

DU. A decade ago, Savill suggested that defects in apoptosis

might be involved in the pathogenesis of several renal diseases

(Savill, 1994). It appeared that kidneys of DU-treated rats had

more apoptotic cells than those of controls. This was not really

surprising because several in vitro and in vivo experiments

showed an association between kidney damages and apoptosis

following acute uranium exposure (Prat et al., 2005; Thiebault

et al., 2007). In addition, it has been shown recently that uranium

exposure induces the activity of the apoptotic agent caspase-9 in

renal cells (Thiebault et al., 2007). As tubulo-interstitial lesions

are more frequent in DU-contaminated rats and proliferation is

not augmented to regenerate damaged tubules, one can thus

suppose that DU-induced tubular injury may lead to early

progressive renal defect. However, the effects of 9-month DU

exposure on kidney are very subtle as no change was observed in

blood renal marker creatinin and urea. This is consistent with

a recent clinical finding that showed no significant change in

these blood markers in adults drinking water from uranium

contaminated well (Magdo et al., 2007). Nevertheless, an

elevated creatinin level was noted for a child thus highlighting

the potential hazard of uranium contamination on kidney.

Concerning the molecular effects of chronic exposure to DU,

the present study demonstrated that iron transporters, notably

DMT1, were protein targets for uranium in kidney. However,

a discrepancy was noted between mRNA level (33) and

protein level (reduced by 80%) of this transporter after DU

ingestion. These results were not in accordance with a previous

study that demonstrated increase in both mRNA and protein

levels of DMT1 after acute short-term contamination with

manganese (Wang et al., 2006). The discrepancy between

mRNA levels and protein levels suggests that chronic DU

contamination had an impact on DMT1 regulation, not only at

transcriptional level but also at translational level. However,

the protein processing stage—translational or post-translational

level—at which this inhibitory effect of chronic exposure to

DU occurred, remains to be determined.

Recently characterized in the kidney, EPOR was proved to

be antiapoptotic. Indeed EPOR expressing cells had reduced

apoptosis under EPO treatment (Westenfelder, 2002). The

main role of the EPO signaling pathway in kidney is to protect

this tissue from ischemic injury by preventing excess apoptosis

(Sharples and Yaqoob, 2006). Further developments made it

possible to understand EPO antiapoptotic signaling pathway:

EPO binding to EPOR leads to a cascade of phosphorylations

that inactivates proapoptotic factors such as caspase-9 (Rossert

FIG. 6. Histological alterations of kidney after DU contamination. (a) Representative histological sections of control (C) and DU-contaminated rat kidneys

(DU). Five micrometers sections were stained using HES (objective, 320). Note that tubulo-interstitial lesions were very marked in kidney of DU-contaminated

rat. Arrow: hyaline casts; arrowhead: dilated tubule. (b) Data are the number of Control or DU rats with observed lesion degree in whole kidney section.

Glomerular and tubulo-interstitial lesion degrees were scored from 0 to 3: 0 ¼ none; 1 ¼ slight; 2 ¼ moderate; 3 ¼ marked. DU-contaminated rats were more

frequently subjected to moderate and marked tubulo-interstitial lesions.

404 BERRADI ET AL.

Dow



and Eckardt, 2005). In the present investigation, the dramatic

reduction in EPOR mRNA of 90% observed in DU-

contaminated rats may thus explain the increased apoptosis in

these animals probably due to impairment of the inactivation of

apoptotic factors.

To date, no report describes EPOR downregulation in

kidney. The rare studies dealing with EPOR mRNA reduction

were made in cultured cells (Pontikoglou et al., 2006; Yoon

et al., 2006). These previous reports indicated that EPOR

mRNA reduction may be due to hypoxia or inflammation,

suggesting a certain complexity in the mechanisms regulating

EPOR expression. Within the context of the current in-

vestigation, this raises the question of EPOR regulation in

kidney after chronic exposure to DU.

The relative expression of mRNA or protein levels of heme

oxygenases was not markedly modified by chronic DU

FIG. 7. Chronic ingestion of DU and renal apoptosis and proliferation. (a) Representative immunohistological appearance of apoptotic (TUNEL) and

proliferative cells (Ki67) of control and DU rat kidneys. Above: apoptotic kidney cells detected by TUNEL staining (objective, 340). Arrowhead: apoptotic cell.

Below: proliferating cells in renal tissue obtained by immunohistochemical findings of Ki67 antigen with diaminobenzidine chromogen and hematoxylin

counterstain (objective, 340). Arrowhead: proliferative cell. (b) Evaluation of apoptotic and proliferative cell content in kidney by counting. Apoptotic cells or

proliferative cell were detected respectively by TUNEL staining (n ¼ 4 for each group) and by Ki67 immunohistochemistry (n ¼ 7 for each group) in whole kidney

section. C ¼ control. Data are expressed as mean ± SEM (*p < 0.05). DU-contaminated rats had twice more TUNEL-positive cells in corticomedullar area than

control rats.


Dow



exposure neither in spleen nor in kidney. Such lack of changes

after chronic exposure to DU was not quite surprising, because

previous study demonstrated a transient induction of HO1

between 24 and 48 h after ischemia (Villanueva et al., 2007).

Paradoxally, the mRNA level of the constitutively expressed

isoform HO2 was increased in spleen after DU contamination.

This augmentation was not associated with similar increase in

protein level of HO2, suggesting an additional post-transcriptional

change. Contrary to EPOR, CP mRNA levels were dramat-

ically augmented after 9-month DU contamination. The CP

antioxidant role is known to mimic super oxide dismutase

activity (Goldstein et al., 1982). Owing to CP higher

expression in developing kidney than in mature kidney, it

was proposed that CP protected kidney from growth-induced

oxidative damages (Gupta et al., 1999). Hence, it can be

assumed that CP is enhanced in the present study to protect

kidney from DU-induced permanent oxidative stress. The

primordial role of CP in case of uranium contamination was

confirmed by recent in vitro blood experiments that

demonstrated the capacity of CP to bind 2 mol of uranium

per mole of protein (Vidaud et al., 2005). It can be thus

hypothesized that CP plays a protector role with regard to DU

nephrotoxicity via uranium sequestration. The presence of

DU-triggered oxidative stress in kidney is demonstrated in

previous reports showing an induction of oxidative stress

markers in rat kidney after chronic uranium treatment (Linares

et al., 2006; Taulan et al., 2004). For instance, 3-month

chronic exposure to 10, 20, or 40 mg uranium/kg/day

increased levels of oxidative stress markers such as

thiobarbituric acid–reactive substances content, super oxide

dismutase and oxidized glutathione activities in rat kidney

(Linares et al., 2006). These various lines of evidence show

thus the induction of several oxidative stress markers

following uranium exposure.

It is well known that iron catalyzes the Fenton reaction,

which generates highly reactive cytotoxic hydroxyl radicals. In

rat kidney, it has been proved that iron accumulation obtained

by experimental chronic hemosiderosis leads to oxidative stress

generation whereas iron-depleted rats showed normal levels of

oxidative stress markers (Zhou et al., 2000). Iron deposition in

DU-contaminated rats presented more ‘‘hemosiderosis-like’’

figures of iron deposition that is, they had extended and

numerous iron deposits. Iron deposition was already recorded

in a similar experiment with DU (Donnadieu-Claraz et al.,2007). Iron induced oxidative stress is a pathway incriminated

in chronic renal disease (Nath et al., 1994). Furthermore, recent

advances showed that excess iron inhibited cell proliferation

and increased apoptosis (Carlini et al., 2006). In addition, the

tissue iron accumulation has been shown in vivo and in vitro to

lead to tubular damages (Agarwal et al., 2004; Sponsel et al.,1996). These data suggests that iron accumulation plays a direct

key role in renal apoptosis and injury. Furthermore, these data

indicate that disturbances of iron metabolism may be reflected

by changes in iron accumulation rather than by tissue iron

content. These underlying iron mechanisms may explain the

effects of chronic exposure to DU on rat kidney.

As reviewed by Nurko (2006), anemia in kidney disease

include: RBC loss, decreased RBC life span, EPO deficiency,

altered iron transport, iron deficiency and inflammation. In the

present study, a reduction in RBC content, a deficiency in EPO

pathway and kidney iron disorders were observed after chronic

exposure to DU. Thus we propose the following scheme to

interpret the effects of 9-month DU ingestion (Fig. 7): in rat

kidney, DU leads to perturbation of iron transport, inducing

iron accumulation, which itself generates an oxidative stress.

This may trigger excess apoptosis responsible for renal injury.

This renal dysfunction may be the reason for the RBC loss

observed in DU-treated rats. The repeated DU insult to kidney

may at least lead to chronic kidney disease which would lead to

early renal anemia. Iron transport and accumulation seem thus

to be the first link that results in renal injury. This would mean

that iron metabolism is a critical target of DU exposure.

However, it is difficult to estimate if the perturbations of iron

metabolism were responsible for kidney deterioration or, in the

contrary, if the uranium nephrotoxicity led to the alteration of

FIG. 8. Proposed pathway for DU mediated progressive kidney injury.

Summarized diagram out of DU effects in kidney. Presence of DU induced the

alteration of iron transport and deposition in renal tissue. This may thus lead to

oxidative stress confirmed by the increased CP mRNA levels. This oxidative

stress, as well as the reduction of EPOR expression, antiapoptosis factor in the

kidney, may be the causes of the increase observed in apoptosis level after DU

contamination. This conducts to kidney injury which would explain the

reduction in blood red cell content.

406 BERRADI ET AL.

Dow



tissue iron homeostasis. To answer this question, it would be

necessary to develop further experiments with time-course of

DU exposure in rats. In conclusion, the findings of the present

work indicate that chronic exposure to DU may induce subtle

effects on kidney with hematological consequences. The

effects observed in spleen (increased erythroid progenitors

and increased iron transport) suggest the setting up of

a compensatory process in this tissue. Thus, the results of this

investigation contribute to understanding the consequences and

the mechanisms underlying the biological effects of DU on the

kidney function.

FUNDING

ENVIRHOM research program supported by the Institut de

Radioprotection et de Surete Nucleaire (IRSN, Institute for

Radioprotection and Nuclear Safety, FRA).

ACKNOWLEDGMENTS

We are thankful to T. Loiseau and F. Voyer for providing the

animal care.

REFERENCES

Abu-Qare, A. W., and Abou-Donia, M. B. (2002). Depleted uranium—The

growing concern. J. Appl. Toxicol. 22, 149–152.

Agarwal, R., Vasavada, N., Sachs, N. G., and Chase, S. (2004). Oxidative

stress and renal injury with intravenous iron in patients with chronic kidney

disease. Kidney Int. 65, 2279–2289.

Alfrey, A. C., and Hammond, W. S. (1990). Renal iron handling in the

nephrotic syndrome. Kidney Int. 37, 1409–1413.

Beaumont, C., and Canonne-Hergaux, F. (2005). Erythrophagocytosis and

recycling of heme iron in normal and pathological conditions; regulation by

hepcidin. Transfus. Clin. Biol. 12, 123–130.

Bencosme, S. A., Stone, R. S., Latta, H., and Madden, S. C. (1960). Acute

tubular and glomerular lesions in rat kidneys after uranium injury. Arch.

Pathol. 69, 470–476.

Brzoska, M. M., Kaminski, M., Supernak-Bobko, D., Zwierz, K., and

Moniuszko-Jakoniuk, J. (2003). Changes in the structure and function of

the kidney of rats chronically exposed to cadmium. I. Biochemical and

histopathological studies. Arch. Toxicol. 77, 344–352.

Carlini, R. G., Alonzo, E., Bellorin-Font, E., and Weisinger, J. R. (2006).

Apoptotic stress pathway activation mediated by iron on endothelial cells in

vitro. Nephrol. Dial. Transplant 21, 3055–3061.

Collins, J. F., Franck, C. A., Kowdley, K. V., and Ghishan, F. K. (2005).

Identification of differentially expressed genes in response to dietary iron

deprivation in rat duodenum. Am. J. Physiol. Gastrointest. Liver Physiol.

288, G964–G971.

Dickson, E. C. (1909). A report on the experimental production of chronic

nephritis in animals by use of uranium nitrate. Arch. Int. Med. 30, 375–341.

Donnadieu-Claraz, M., Bonnehorgne, M., Dhieux, B., Maubert, C.,

Cheynet, M., Paquet, F., and Gourmelon, P. (2007). Chronic exposure to

uranium leads to iron accumulation in rat kidney cells. Radiat. Res. 167,

454–464.

Dublineau, I., Grandcolas, L., Grison, S., Baudelin, C., Paquet, F., Voisin, P.,

Aigueperse, J., and Gourmelon, P. (2007). Modifications of inflammatory

pathways in rat intestine following chronic ingestion of depleted uranium.

Toxicol. Sci. 98, 458–468.

Fujigaki, Y., Sun, D. F., Goto, T., and Hishida, A. (2003). Temporary changes

in macrophages and MHC class-II molecule-expressing cells in the

tubulointerstitium in response to uranyl acetate-induced acute renal failure

in rats. Virchows Arch. 443, 206–216.

Giglio, M. J., Brandan, N., Leal, T. L., and Bozzini, C. E. (1989). The mechanism

of the transient depression of the erythropoietic rate induced in the rat by

a single injection of uranyl nitrate. Toxicol. Appl. Pharmacol. 99, 260–265.

Gilman, A. P., Villeneuve, D. C., Secours, V. E., Yagminas, A. P., Tracy, B. L.,

Quinn, J. M., Valli, V. E., Willes, R. J., and Moss, M. A. (1998). Uranyl

nitrate: 28-day and 91-day toxicity studies in the Sprague-Dawley rat.

Toxicol. Sci. 41, 117–128.

Goldman, M., Yaari, A., Doshnitzki, Z., Cohen-Luria, R., and Moran, A.

(2006). Nephrotoxicity of uranyl acetate: Effect on rat kidney brush border

membrane vesicles. Arch. Toxicol. 80, 387–393.

Goldstein, I. M., Kaplan, H. B., Edelson, H. S., and Weissmann, G. (1982).

Ceruloplasmin: An acute phase reactant that scavenges oxygen-derived free

radicals. Ann. N. Y. Acad. Sci. 389, 368–379.

Gupta, A., Gupta, A., Nigam, D., Shukla, G. S., and Agarwal, A. K. (1999).

Profile of reactive oxygen species generation and antioxidative mechanisms

in the maturing rat kidney. J. Appl. Toxicol. 19, 55–59.

Juntunen, R. (1991). Uranium and radon in wells drilled into bedrock in

Southern Finland. Report of investigation 98, In Geological Survey of Finland.

Lestaevel, P., Bussy, C., Paquet, F., Dhieux, B., Clarencon, D., Houpert, P.,

and Gourmelon, P. (2005). Changes in sleep-wake cycle after chronic

exposure to uranium in rats. Neurotoxicol. Teratol. 27, 835–840.

Linares, V., Belles, M., Albina, M. L., Sirvent, J. J., Sanchez, D. J., and

Domingo, J. L. (2006). Assessment of the pro-oxidant activity of uranium in

kidney and testis of rats. Toxicol. Lett. 167, 152–161.

Magdo, H. S., Forman, J., Graber, N., Newman, B., Klein, K., Satlin, L.,

Amler, R. W., Winston, J. A., and Landrigan, P. J. (2007). Grand rounds:

Nephrotoxicity in a young child exposed to uranium from contaminated well

water. Environ. Health Perspect. 115, 1237–1241.

Maines, M. D., and Panahian, N. (2001). The heme oxygenase system and

cellular defense mechanisms. Do HO-1 and HO-2 have different functions?

Adv. Exp. Med. Biol. 502, 249–272.

Mok, H., Mendoza, M., Prchal, J. T., Balogh, P., and Schumacher, A. (2004).

Dysregulation of ferroportin 1 interferes with spleen organogenesis in

polycythaemia mice. Development 131, 4871–4881.

Nath, K. A., Fischereder, M., and Hostetter, T. H. (1994). The role of oxidants

in progressive renal injury. Kidney Int. Suppl. 45, S111–S115.

Nurko, S. (2006). Anemia in chronic kidney disease: Causes, diagnosis,

treatment. Cleve Clin. J. Med. 73, 289–297.

Oliver, J. (1915). The histogenesis of chronic uranium nephritis with especial

reference to epithelial regeneration. J. Exp. Med. xxi, 4.

Patrick, L. (2006). Lead toxicity part II: The role of free radical damage and the

use of antioxidants in the pathology and treatment of lead toxicity. Altern.

Med. Rev. 11, 114–127.

Pellmar, T. C., Fuciarelli, A. F., Ejnik, J. W., Hamilton, M., Hogan, J.,

Strocko, S., Emond, C., Mottaz, H. M., and Landauer, M. R. (1999a).

Distribution of uranium in rats implanted with depleted uranium pellets.

Toxicol. Sci. 49, 29–39.

Pellmar, T. C., Keyser, D. O., Emery, C., and Hogan, J. B. (1999b).

Electrophysiological changes in hippocampal slices isolated from rats

embedded with depleted uranium fragments. Neurotoxicology 20, 785–792.

Pinney, S. M., Freyberg, R. W., Levine, G. E., Brannen, D. E., Mark, L. S.,

Nasuta, J. M., Tebbe, C. D., Buckholz, J. M., and Wones, R. (2003). Health


Dow



effects in community residents near a uranium plant at Fernald, Ohio, USA.

Int. J. Occup. Med. Environ. Health 16, 139–153.

Pontikoglou, C., Liapakis, G., Pyrovolaki, K., Papadakis, M., Bux, J.,

Eliopoulos, G. D., and Papadaki, H. A. (2006). Evidence for downregulation

of erythropoietin receptor in bone marrow erythroid cells of patients with

chronic idiopathic neutropenia. Exp. Hematol. 34, 1312–1322.

Prat, O., Berenguer, F., Malard, V., Tavan, E., Sage, N., Steinmetz, G., and

Quemeneur, E. (2005). Transcriptomic and proteomic responses of human

renal HEK293 cells to uranium toxicity. Proteomics 5, 297–306.

Risdon, R. A., Sloper, J. C., and De Wardener, H. E. (1968). Relationship between

renal function and histological changes found in renal-biopsy specimens from

patients with persistent glomerular nephritis. Lancet 2, 363–366.

Rossert, J., and Eckardt, K. U. (2005). Erythropoietin receptors: Their role

beyond erythropoiesis. Nephrol. Dial. Transplant. 20, 1025–1028.

Satarug, S., and Moore, M. R. (2004). Adverse health effects of chronic

exposure to low-level cadmium in foodstuffs and cigarette smoke. Environ.

Health Perspect. 112, 1099–1103.

Savill, J. (1994). Apoptosis and the kidney. J. Am. Soc. Nephrol. 5, 12–21.

Sharples, E. J., and Yaqoob, M. M. (2006). Erythropoietin and acute renal

failure. Semin. Nephrol. 26, 325–331.

Shawky, S., Amer, H. A., Hussein, M. I., el-Mahdy, Z., and Mustafa, M. (2002).

Uranium bioassay and radioactive dust measurements at some uranium

processing sites in Egypt—Health effects. J. Environ. Monit. 4, 588–591.

Souidi, M., Gueguen, Y., Linard, C., Dudoignon, N., Grison, S., Baudelin, C.,

Marquette, C., Gourmelon, P., Aigueperse, J., and Dublineau, I. (2005). In vivo

effects of chronic contamination with depleted uranium on CYP3A and

associated nuclear receptors PXR and CAR in the rat. Toxicology 214, 113–122.

Sponsel, H. T., Alfrey, A. C., Hammond, W. S., Durr, J. A., Ray, C., and

Anderson, R. J. (1996). Effect of iron on renal tubular epithelial cells. KidneyInt. 50, 436–444.

Squibb, K. S., and McDiarmid, M. A. (2006). Depleted uranium exposure and

health effects in Gulf War veterans. Philos. Trans. R. Soc. Lond. B Biol. Sci.

361, 639–648.

Taulan, M., Paquet, F., Maubert, C., Delissen, O., Demaille, J., and

Romey, M. C. (2004). Renal toxicogenomic response to chronic uranyl

nitrate insult in mice. Environ. Health Perspect. 112, 1628–1635.

Thiebault, C., Carriere, M., Milgram, S., Simon, A., Avoscan, L., and

Gouget, B. (2007). Uranium induces apoptosis and is genotoxic to normal rat

kidney (NRK-52E) proximal cells. Toxicol. Sci. 98, 479–487.

Tissandie, E., Gueguen, Y., Lobaccaro, J. M., Grandcolas, L., Voisin, P.,

Aigueperse, J., Gourmelon, P., and Souidi, M. (2007). In vivo effects of

chronic contamination with depleted uranium on vitamin D3 metabolism in

rat. Biochim. Biophys. Acta 1770, 266–272.

Vidaud, C., Dedieu, A., Basset, C., Plantevin, S., Dany, I., Pible, O., and

Quemeneur, E. (2005). Screening of human serum proteins for uranium

binding. Chem. Res. Toxicol. 18, 946–953.

Villanueva, S., Cespedes, C., Gonzalez, A. A., Vio, C. P., and Velarde, V.

(2007). Effect of ischemic acute renal damage on the expression of COX-2

and oxidative stress-related elements in rat kidney. Am. J. Physiol. Renal.

Physiol. 292, F1364–F1371.

Wang, X., Li, G. J., and Zheng, W. (2006). Upregulation of DMT1 expression

in choroidal epithelia of the blood-CSF barrier following manganese

exposure in vitro. Brain Res. 1097, 1–10.

Wedeen, R. P., and Qian, L. F. (1991). Chromium-induced kidney disease.

Environ. Health Perspect. 92, 71–74.

Westenfelder, C. (2002). Unexpected renal actions of erythropoietin. Exp.

Nephrol. 10, 294–298.

Yoon, D., Pastore, Y. D., Divoky, V., Liu, E., Mlodnicka, A. E., Rainey, K.,

Ponka, P., Semenza, G. L., Schumacher, A., and Prchal, J. T. (2006).

Hypoxia-inducible factor-1 deficiency results in dysregulated erythropoiesis

signaling and iron homeostasis in mouse development. J. Biol. Chem. 281,

25703–25711.

Zhou, X. J., Laszik, Z., Wang, X. Q., Silva, F. G., and Vaziri, N. D. (2000).

Association of renal injury with increased oxygen free radical activity and

altered nitric oxide metabolism in chronic experimental hemosiderosis. Lab.

Invest. 80, 1905–1914.

408 BERRADI ET AL.

Dow



Renal Anemia Induced by Chronic Ingestion of Depleted Uranium in

Documents

Transcript of Renal Anemia Induced by Chronic Ingestion of Depleted Uranium in