Protelomerase Uses a Topoisomerase IB/ Y-Recombinase Type ...

Protelomerase Uses a Topoisomerase IB/Y-Recombinase Type Mechanism to GenerateDNA Hairpin Ends

Wai Mun Huang1*, Lisa Joss2, TingTing Hsieh1 andSherwood Casjens1

1Department of PathologyUniversity of Utah HealthSciences Center, Salt Lake CityUT 84132-2501, USA

2Department of BiochemistryUniversity of Utah HealthSciences Center, Salt Lake CityUT 84132-2501, USA

Protelomerases are enzymes responsible for the generation of closed hair-pin ends in linear DNA. It is proposed that they use a breaking-and-rejointype mechanism to affect DNA rearrangement on specific DNAsequences. In doing so, one strand turns around and becomes the comp-lementary strand. Using the purified enzyme from the Escherichia coliphage N15 and the Klebsiella phage fKO2 and synthetic oligonucleotidesubstrates, we directly demonstrate the location where the cutting/re-lig-ation occurs. We identified a pair of transient staggered cleavages sixbase-pairs apart centered around the axis of dyad symmetry of the targetsite. Two molecules of the protelomerase form a pair of protein-linkedDNA intermediates at each 30 end of the cleaved openings leaving a 50-OH. Then, in a process not yet clearly defined, the partners of the twoinitial openings are exchanged, and the transient breaks are resealed togenerate hairpin ends. The formation of 30-covalent DNA–protein inter-mediates is a hallmark of the topoisomerase IB type reaction, and wehave thus shown experimentally that protelomerase is a member of thetyrosine-recombinase superfamily. In addition, by introducing singlenicks in the substrates as perturbation, we found that the integrity of thenucleotide chain 4 bp away from the cutting site as well as this nucleoti-de’s complementary location on the stem if the strands were to fold intoa cruciform structure are required for activity, suggesting that theselocations may be important substrate–protein contacts. We determinedthat N15 and fKO2 protelomerases are monomers in solution and twomolecules are needed to interact with the substrate to form two closedhairpin products. The target sites of protelomerases invariably consist ofinverted repeats. Comparative studies using the related target sites ofdifferent protelomerases suggest that these proteins may require bothsequence-specific and structure (possibly cruciform)-specific recognitionfor activity.

q 2004 Elsevier Ltd. All rights reserved.

Keywords: DNA hairpin ends; oligonucleotide substrates; protein-linkedDNA intermediates; Y-recombinase; topoisomerase*Corresponding author

Introduction

Bacterial chromosomes and plasmids are usuallycircular. However, in some unusual cases, they arelinear with covalently closed hairpin ends. Notableexamples of such linear molecules are the chromo-some of Borrelia burgdorferi, the Lyme disease

agent, and one of the two chromosomes of Agrobac-terium tumefaciens.1 – 3 In addition to its largechromosome, B. burgdorferi also harbors numerouscircular and linear plasmids. These linear plasmidsalso have hairpin ends.4 – 7 Escherichia coli phageN15, a lambdoid-temperate phage, and PY54, atemperate phage isolated from Yersinia enterocoli-tica, do not integrate their DNAs into the hostchromosome upon establishing lysogeny. Instead,these prophages exist as linear plasmids with

0022-2836/$ - see front matter q 2004 Elsevier Ltd. All rights reserved.

E-mail address of the corresponding author:[email protected]

doi:10.1016/j.jmb.2004.01.012 J. Mol. Biol. (2004) 337, 77–92

hairpin ends.8 – 10 These linear replicons are duplexDNAs in which one strand turns around andbecomes the complementary strand at both ends;thus there are no exposed free DNA ends. Themechanisms by which these hairpin ends are gen-erated are beginning to be investigated. In Borrelia,it has been shown that a circular plasmid gene,BBB03, encodes a protein that is sufficient for thegeneration of the hairpin ends of a linear plasmid.11

In the N15 and PY54 phage systems, proteins havebeen identified that are responsible for both invivo and in vitro hairpin end generation.10,12 –15

These hairpin end-generating proteins werenamed “protelomerases” because they are prokar-yotic enzymes that create hairpin telomeres.9

Recently, another linear plasmid, called pKO2was identified in Klebsiella oxytoca.16 This plasmidwas also shown to have hairpin ends and to bethe prophage of a non-integrated temperate phagefKO2.17 The genome of fKO2 has been completelysequenced,17 and it is 51.6 kb in length with 10 bpcohesive ends. It has an overall gene arrangementsimilar to that of phage N15.12,17 Near the center ofthe phage fKO2 genome is an inverted repeatsequence of 50 bp, and an N15 protelomerase-likeprotein is encoded immediately downstream fromit; hence it seemed likely that this inverted repeatis the target site of the fKO2 protelomerase. Weshow here that the protelomerases from N15 andfKO2 can work on each other’s target sequence,telRL.9 Based on the limited amino acid sequencesimilarity between protelomerases and Y-recombi-nases (especially near the catalytic region wherethe active site tyrosine is located), it has been pro-posed that protelomerase may be a member of theY-recombinase/integrase family of proteins,12 andhence it may also use a characteristic cutting–rejoining type mechanism for its action. In orderto gain further insight into the detailed mechanismby which hairpin ends are generated by protelo-merase and more importantly to determine thelocation of the cutting–rejoining site, we use oligo-nucleotide substrates including nicked suicide sub-strates for the analysis. We report here that thepurified protelomerases from N15 and fKO2

employ a topoisomerase-IB/Y-recombinase typemechanism to generate hairpin ends. These pro-teins transiently cut the target site at two positions6 bp apart on opposite strands at dyad symmetri-cal locations. A pair of protein–DNA linked inter-mediates is created at the cleavage sites, eachforming a 30-phosphoryl linkage to the proteinand a free 50-OH. After a DNA rearrangementevent to exchange the partners at the dyad sym-metrical openings, the transient breaks are re-sealed, resulting in the covalent joining of onestrand to its complementary strand to form hairpinends.

Results

Protelomerase from fKO2 generates hairpinends at its target site in vitro

The overall gene order between the genome ofE. coli phage N15 and Klebsiella phage fKO2 issimilar.12,17 At a location opposite to that of thecohesive end, one prominent inverted repeat of50 bp, instead of three sets as in phage N15, wasidentified. In N15, the central inverted repeat of56 bp, consisting of two shorter inverted repeats of14 bp and 22 bp separated by three non-invertedrepeat base-pairs, is the telomere-forming site,telRL, which becomes the hairpin-ended telomeresof the linear plasmid.9 The equivalent fKO2sequence, like the central inverted repeat of N15,also consists of two smaller inverted repeats (7 bpand 14 bp) separated by 4 bp of non-invertedrepeat sequence. This 50 bp site shares a highdegree of sequence homology with the core 56 bpinverted repeat of N15 telRL site (Figure 1). Corre-spondingly, downstream from the inverted repeatin fKO2 is a protelomerase-like gene (encodingthe 640 residue TelK protein) whose product shares77% sequence identity with the N15 protelomerase(631 residues; also called gp29). The fKO2 genewas cloned into an expression vector and theencoded protein was expressed in E. coli. A rapid

Figure 1. Schematic alignment ofthe protelomerase regions of thegenomes of E. coli phage N15 andKlebsiella phage fKO2. The protelo-merase target site telRL and the pro-telomerase genes are representedby rectangles (not drawn to scale).Pairs of opposing arrows indicateinverted repeating sequences. Inthe expanded sequence below,lower case characters representimperfect pairing within theinverted repeat; asterisks (**)denote the center of dyad sym-metry where the hairpin ends areformed. Nucleotide numbers aremarked above the sequences.

78 Protelomerase Mechanism

purification scheme was developed using Ni-NTA(Qiagen) metal affinity chromatography followedby gel filtration chromatography (Figure 2A). Aparallel N15 construct was also prepared and itsencoded protein, TelN, was purified for compari-son. The 50 bp telRL from fKO2, when cloned intoplasmid vector, serves as substrate for the in vitroend resolution reaction. Figure 2B shows thatupon incubation with the purified TelK protein,supercoiled pSK-K plasmid DNA carrying the tar-get site is converted to a linear sized DNA, and alinearized DNA substrate is converted to two frag-ments of 2.1 kb and 0.8 kb. These are the sizes pre-dicted for cleavage at the telRL site. In the absenceof the telRL site, the supercoiled or linearized pSKvector DNA is unaltered by TelK (data notshown). When these reaction products were ana-lyzed under alkaline (denaturing) conditions, theproducts were twice as long as those observedunder neutral conditions. The latter results showthat the ends generated by the TelK protein have aclosed hairpin structure, where the two strands ofthe duplex are joined together to give a denaturedlength that is twice of that of the native duplex.Thus, fKO2 TelK is orthologous to the protelomer-ase TelN from N15.13 In fact, TelK and TelN are ableto use each other’s target site with comparable effi-ciency (see below).

Hairpin end-generating activity under standardassay conditions is rapid but the enzyme appearsto have slow turnover. Two different linear sub-strates added sequentially, each of which carriesthe telRL site at a different distance from the endof the substrate were used for this analysis suchthat all substrates and products are distinguishableby agarose gel electrophoresis. Using substrate I(same substrate used in Figure 2) and limitingamounts of protelomerase, the 2.9 kb fragment–substrate was converted to two fragments of2.1 kb and 0.8 kb in five minutes at 30 8C withsome excess substrate. Further incubation for fiveminutes more did not convert more substrate toproducts (Figure 3, lanes 1, 2 and 3). The residual

substrate I could be converted to the two productsif more enzyme was added (Figure 3, lane 4),suggesting that no inhibitor was present. After theinitial incubation with substrate I, if a second sub-strate II was added to the reaction and incubationcontinued, substrate II was found to remain intactbecause the 1.6 kb telRL-containing fragment wasnot converted to the 0.97 kb and 0.63 kb fragmentsif active TelK was present (Figure 3, lanes 7 and6). A 1.4 kb fragment which lacks a telRL site wasalso present as control, and it remained intactunder these conditions. Furthermore, when TelKwas initially incubated with a DNA lacking thetelRL site in the first step, such as the linearizedvector pSK DNA, it remained active in the secondincubation (data not shown). This suggests thatthe enzyme is stable under the reaction conditions,and the inactivation of TelK after the first incu-bation was indeed due to its activity on the telRLsite. These results suggest that TelK may act stoi-chiometrically and becomes inactive at the end ofone round of reaction with slow or no turnover.Furthermore, this loss of subsequent activity wasapparently not due to a tight binding of the proteinand the hairpin products, since purified hairpinmolecules are not competitors of the reaction (datanot shown). This non-catalytic property of the pro-telomerase may have interesting implications forits regulation during phage development. The pro-tein is expected to function only during lysogenywhen the phage DNA is in the linear plasmidform, and not to be active during lytic phage devel-opment where telRL site remains intact. If protelo-merase became inactivated after each round ofactivity, it would provide one measure to ensurethat no excess activity is present when it is nolonger needed. It remains possible that other fac-tor(s) may be involved in the intracellular actionof TelK where it may act catalytically. Similarly, bythe same criteria TelN also appears to act stoichio-metrically on substrates carrying telRL site fromeither N15 or fKO2 under similar conditions(data not shown).

Figure 2. Purification and activityof protelomerase. A, Fractions fromthe purification steps were ana-lyzed by 10% polyacrylamide-SDSgel electrophoresis and Coomassiebrilliant blue staining. See Materialsand Methods for details of the puri-fication. 1, Uninduced crudeextract. 2, Crude extract of a cultureinduced by 0.7 mM IPTG. 3, Super-natant of induced lysed cultureafter treatment with RNase, DNaseand 2 M NaCl. 4, Pooled fractionsfrom Ni/NTA affinity chromatog-raphy. 5, Pooled fractions fromSuperdex-200 sizing chromatog-raphy. B, Identical products of pro-

telomerase analyzed on 1% agarose gel running under native and alkaline conditions. 1 and 2, Supercoiled substratepSK-K (50 bp telRL/fKO2 site cloned into pSK) without or with protelomerase TelK (50 pmol); 3 and 4, linearized(AlwNI cut) pSK-K substrate without or with enzyme. M is the marker whose sizes are labeled on the side of the gels.

Protelomerase Mechanism 79

TelK and TelN are monomers in solution

The method of equilibrium ultracentrifugationwas used to investigate the subunit structure ofprotelomerase in solution, since this method isindependent of the molecular shape.18 In the pre-sence of 150–250 mM NaCl and at three differentprotein concentrations, TelK fits best as a monomerwith a molecular mass of 78(^8) kDa with ran-domly distributed residuals (Figure 4A). Similarly,TelN also fits best as a monomer with a molecularmass of 77(^6) kDa (Figure 4B). These values arein very good agreement with the calculated mono-meric molecular masses of 73,369 and 72,267 forTelK and TelN, respectively, based on their codingsequences. Since protelomerase is expected to pro-cess a target site consisting of dyad symmetricalDNA (telRL site; see Figure 1) to give two ends, it

is very likely that at least two molecules are neededto interact with the symmetrical DNA target site togive a functional unit for the reaction (and twocovalent protein complexes are formed at eachtelRL site; see below). On gel filtration analysis(part of the purification scheme), TelK and TelNeluted at a volume comparable to that of catalase(molecular mass 240 kDa), indicating that the pro-telomerase monomers have a shape that is differ-ent from spherical.

Duplex oligonucleotides are substratesfor protelomerase

In addition to long DNA substrates (such as the2.9 kb substrate used above) in either supercoiledor linear form, duplex oligonucleotides derivedfrom the telRL (56 bp from N15, or the 50 bp fromfKO2) site can also be used as substrates for thehairpin end generation. Oligonucleotide substrates(bottom of Figure 5) that contain a five nucleotidesingle-stranded extension on the left and a 5 bpdouble-stranded extension on the right added tothe 56 bp N15 telRL were used. Both TelK andTelN are able to convert this oligonucleotide sub-strate into two products that are separable bynative 12% (w/v) PAGE (Figure 5). Synthetic oligo-nucleotides as substrates clearly offer versatilityand convenience for mechanistic studies by pro-viding easily altered target sites. For example, anick introduced at position 35T abolishes the hair-pin end-generating activity of both TelK and TelN,whereas the activity is not affected if nicks areintroduced further away from the center of dyadsymmetry, at positions 36T or 37T and beyond(Figure 5). The systematic evaluation of differentpositions in the telRL site are described below.

Protelomerase cleaves the telRL site atstaggered positions 6 bp apart

By sequence comparison, protelomerase shareslimited and short stretches of amino acid hom-ology with the C-terminal catalytic domains of Y-recombinases and type IB topoisomerases wheretheir active site tyrosine resides.9 Thus, it is reason-able to assume as a working hypothesis that thehairpin-ended product may be the result of a tran-sient breakage and rejoining event that occurswithin the telRL site by a Y-recombinase typemechanism. In order to further increase the separ-ation of the two products generated by protelomer-ase, we prepared another set of N15 telRL-containing oligonucleotide substrates with a 10 bpextension on the right and no extension on the leftside (Figure 6A). This set of substrates yields wellseparated hairpin-ended products of two differentsizes: a 28 bp product originating from the leftside of the telRL and a 38 bp product from theright side where the 10 bp extension was added(Figure 6B). We reasoned that if such a set of syn-thetic substrates were prepared in which a single32P group is incorporated at different phosphate

Figure 3. Demonstration of stoichiometric TelK activityusing two substrates added sequentially. Substrate I isgenerated by linearization of pSK-K DNA with therestriction enzyme AlwNI (as in Figure 2). Substrate IIhas two fragments (1.4 kb and 1.6 kb), where only the1.6 kb fragment carries the telRL site; it was generatedby digesting a pUC18 derivative carrying the fKO2telRL site with AlwNI and Ssp I. Incubation was at 30 8C.1, Substrate I and no enzyme control incubated for fiveminutes. 2, TelK (0.7 pmol) was incubated with substrateI for five minutes. 3, Similar to 2, only substrate I andTelK were incubated for five additional minutes. 4, Simi-lar to 2, only after the initial incubation a second aliquotof TelK (0.7 pmol) was added and incubation continuedfor five minutes. 5, At the end of the initial incubationas in 2, substrate II was added before the second fiveminute incubation. 6, Activity of substrate II for five min-utes incubation with TelK. 7, Substrate II and no enzymecontrol. M is the marker whose molecular sizes arelabeled on the side.


backbone locations along the length of the telRLtarget on the top strand, then after the protelomer-ase reaction, those substrates whose 32P group ison the left of the cleavage site would retainthe label on the 28 bp product, and similarly, if thelabel is on the right side of the cleavage site, the38 bp product would be labeled. Thus, the positionwhere the label switches from the 28 bp product tothe 38 bp product would unequivocally register thecleavage and the subsequent re-ligation site on thetop strand. The differentially labeled (in the topstand) substrates were prepared by using a set ofsingly nicked oligonucleotide substrates whosetop right oligonucleotides were 50-labeled with 32Pusing T4 polynucleotide kinase at various positionsalong the length of the target telRL. After annealingwith the appropriate unlabeled top left and bottomstrand oligonucleotides to form nicked duplexes,the nicks were sealed with T4 ligase to generateintact full-length substrates. When this set of full-length top-strand-labeled substrates was treatedwith TelN or TelK, the labeled phosphates up to25 remained with the 28 bp product, whereas phos-phate at position 26 and beyond stayed with the38 bp product (Figure 6C). Hence, cleavage must

occur between position 25 and 26 of the top strand,i.e. three nucleotides left of the dyad symmetrycenter. Similarly, bottom-strand-labeled substratecleavage occurs between position 31 and 32, threenucleotides right of the dyad symmetry center(data not shown). (The numbering of the bottomstrand is also from left to right as drawn in Figure6A.) Thus, protelomerase makes, as intermediatesduring hairpin end generation, a pair of transientdyad-symmetric staggered cuts 6 bp apart thatleave 50 protruding ends.

Protein-linked intermediate accumulates withsuicide substrates nicked at the center ofthe symmetry

Under normal reaction conditions with an intacttelRL site, the protelomerase reaction proceedsrapidly to generate hairpin-ended products, andfew or no intermediates are detected. Whenspecific nicked suicide oligonucleotide substrateswere used, their hairpin generating ability wasabolished and they are called suicide substrates.In the latter case, the re-ligation step was appar-ently more adversely affected than cleavage, since

Figure 4. Sedimentation equilibrium analysis of purified protelomerase TelK (A) and TelN (B). The lower panelsshow experimental data points for three different loading concentrations of each protein with the corresponding calcu-lated curve fit (continuous line). TelK fits a monomer model with the molecular mass Mr ¼ 78ð^8Þ kDa. TelN fits amonomer model with Mr ¼ 77ð^6Þ kDa. The upper panels show the residuals for these fits. They are small and ran-dom, indicating a good fit.


protein-linked intermediates accumulated. Theseintermediates could be visualized by ethidium bro-mide staining as large complexes migrating nearthe top of a 7% polyacrylamide gel containingSDS. When a nick was placed at the center of thedyad symmetry between nucleotides 28 and 29 onthe top strand of the substrate described in Figure6A, TelK and TelN caused the accumulation of apair of DNA–protein complexes near the top ofthe gel (Figure 7A, left three lanes). (A minorspecies of even larger aggregate was occasionallyalso seen above the pair of complexes, as shownin Figure 7A, dependent on the purity of thesuicide substrate.) These were protein–oligonu-cleotide complexes, because they were sensitive toprotease treatment and a small oligonucleotide

appeared near the bottom of the gel when the pro-tein portion of the complex was digested (Figure7A, fourth lane from the left). These complexesdid not form when either Y425F or R350G mutantof TelN was used in the reaction (Figure 7A). Resi-due Y425 of TelN is the putative active site tyrosinebased on amino acid sequence alignment withother Y-recombinase family of proteins.9 The con-struction and properties of these mutant proteinswill be described elsewhere; both purified TelN/Y425F and TelN/R350G bind full-length substrateDNA but yield no hairpin-ended products (datanot shown). With the wild-type TelN and TelK pro-teins, the use of this suicide substrate caused morethan 60% of the initial oligonucleotide substrate toaccumulate as large protein–oligonucleotide com-plexes. To identify the pair of protein–DNA com-plexes seen in Figure 7A, we 32P-labeled the topleft end or the bottom right end of the suicide sub-strate (nicked between position 28 and 29 on thetop strand) using T4 polynucleotide kinase, andtreated these labeled substrates with protelomer-ase. The resulting autoradiogram (Figure 7A, rightpanel) shows that the faster migrating member ofthe pair of protein–oligonucleotide complexeswas derived from the left end of the substrate,since it is seen when the 50 end of the top strandwas labeled (Figure 7A, lanes 1–3). Similarly, theslower migrating complex was derived from theright side of the substrate, since it was labeled ifthe substrate was selectively labeled at the bottom50 end with 32P (Figure 7A, lanes 4–6). This resultis consistent with the fact that the protein–oligonu-cleotide complex generated from the left side of thesuicide substrate is smaller than that of the rightside by 10 bp due to the extension added to theright side of the telRL target site. The existence ofthe (50-32P)-labeled oligonucleotide–protein com-plexes further shows that the protein-attachmentwas at the 30 end of the cleaved intermediate.Since two protein-linked complexes are formed inthis reaction, it shows that at least two moleculesof the protelomerase form a functional unit tointeract with the symmetrical substrate of the reac-tion even though the protein itself is a monomer insolution based on equilibrium ultracentrifugationanalysis (Figure 4). Each half of the dyad sym-metrical target site thus provides a binding andreaction site for each molecule of the protelomeraseprotein.

Next, we investigated whether half reactions(cleavage at only one of the symmetrical halves oftelRL) can occur as judged by the accumulation ofonly one of the two protein-linked intermediates.This was done by introducing a single nick at oneof the two cleavage sites, either between nucleo-tides 25T and 26T on the top strand or betweennucleotides 31B and 32B on the bottom strand(hereinafter we use T to denote top strand nucleo-tides and B to denote bottom strand). Syntheticoligonucleotides, with 30-OH and 50-OH ends,were used to generate these nicked substrates.Thus, in these molecules one of the two expected

Figure 5. Activity of TelK and TelN using oligonucleo-tides as substrates. The duplex oligonucleotide substratecarrying the 56 bp telRL site of N15 (the numberedsequence is described in Figure 1) and the extensionsadded at either the 50 or 30 ends is given at the lowerpart of the Figure where asterisks (**) indicate the turn-around point of the hairpin and the center of dyad sym-metry. The substrate yields two separate productslabeled P1 and P2 due the presence of different exten-sions at both ends. A minus sign (2) indicates that noprotein is added, N indicates that TelN was used, and Kindicates that TelK was used. Oligonucleotide substrateswith a single nick (marked by a V if present) were alsoused as substrates. 35T denotes that a nick is introducedto the right of nucleotide 35 on the top strand, countingfrom the left end of the oligonucleotide sequence. Like-wise, 36T and 37T are substrates having nicks at the 30

side of nucleotides 36 and 37 on the top strand,respectively.


cleavage locations is already present as a nick inthe substrate. We found that cleavage of the intactsite still occurred, no protein-linked intermediateaccumulated and only one of the two closed hair-pin products was formed. Specifically, with thesubstrate carrying the nick between 25T and 26T,cleavage at the intact strand between 31B and 32Bstill occurred, no protein-linked intermediatesaccumulated, and only the right-side 38 bp productwas formed (see Figure 8A; and this point will beexamined in more detail in the next section). Like-wise with the symmetrically related substrate con-taining a nick between 31B and 32B, cleavage stilloccurred between 25T and 26T and resulted in theformation of only the 28 bp hairpin-ended product(data not shown). We conclude that re-ligation ofthe bottom strand protein-linked intermediate canutilize a pre-existing 50-OH at the top strand clea-

vage site (and vice versa); this is perhaps not sur-prising, since this 50-OH would normally becreated by cleavage by the second protelomerasemolecule. In addition, since the 50-OH group is uti-lized in the re-ligation part of the reaction, it fol-lows that the protein is linked to the 30-phosphoryl of nucleotides 25T and 32B.

On the other hand, if a phosphate group is addedto the 50 side of the 25T nick by T4 polynucleotidekinase on the upper right oligonucleotide beforeannealing to form the nicked substrate, it preventsthe cleaved intermediate (bottom strand cleavagebetween 31B and 32B) from re-ligating, and onlyone of the two protein-linked intermediates accumu-lates. The substrate with a 50-phosphoryl-blockednick at position 25T yielded only the larger of thetwo protein-linked intermediates, whereas withthe bottom strand 31B 50-phosphoryl blocked

Figure 6. Determination of the locations of the cutting sites. A, The 66 bp double-stranded oligonucleotide substrateof the reaction consists of the 56 bp telRL site of N15 (see Figure 1) with a 10 bp (nucleotides 57–66) extension added onthe right side. Asterisks (**) denote the turn-around point of the hairpin product. The red and blue colors mark the twodifferent inverted repeats center around the dyad symmetry. The position of the cleavage site on the top strand of theoligonucleotide is marked by a filled triangle. B, Ethidium bromide stained agarose gel showing the activity of theTelN (N) and TelK (K) on the full length 66 bp oligonucleotide substrate yielding two well separated products of38 bp and 28 bp. A minus sign (2) indicates that no protein is added. C, Autoradiogram of an agarose gel showingthe activity of TelN (N) and TelK (K) on the same 66 bp oligonucleotide substrate differentially labeled at variouslocations on the top strand. The position of the internal 32P label is given above the gel (e.g. “23” indicates that thephosphate between nucleotide 23 and 24 is 32P-labeled. See the text for details. B indicates that the 50 end of the bottomstrand is labeled.


nicked substrate, only the smaller of the two inter-mediates accumulated (Figure 7B). This resultagain shows that re-ligation requires 50-OH, furtherinferring that cleavage generates a free 50-OH and a30-phosphoryl which is covalently linked to theprotelomerase.

In the central region between the 6 bp-staggeredcuts, i.e. between positions 25 and 31, any pertur-bation in the form of a nick (with or without a 50-phosphate group) is sufficient to cause theaccumulation of both protein-linked intermediates.A typical accumulation of two such intermediatesis shown in Figure 7B where suicide substrateshave a nick to the right of nucleotide 26T in the

top strand or a nick to the right of nucleotide 30Bin the bottom strand. These results suggest thatbreaks within this central 6 bp region do not inter-fere with cleavage but block re-ligation of bothstrands, allowing the accumulation of protein-linked intermediates. Thus, by judiciously posi-tioning the nick on suicide substrates, the structureof the protein-linked intermediates could be deci-phered unequivocally.

Protelomerase requires the integrity of a site4 bp away from the cleavage site for activity

The series of experiments described above

Figure 7. Formation of protein-linked DNA intermediates. A, A suicide substrate with a nick, bounded by 50-OH and30-OH ends between positions 28 and 29 (diagrammed below), was incubated with TelN (N), TelK (K) or no enzyme(2). The nick interferes with the re-ligation step of the reaction (see the text), so the protein-linked oligonucleotideintermediate accumulates. The product was analyzed by 7% PAGE containing 0.1% SDS, where the protein–DNAcomplex can enter the gel. The ethidium bromide stained gel is shown on the left. PrtK indicates that reaction was trea-ted with proteinase K, such that the protelomerase protein was digested and the bound oligonucleotide was releasedto migrate below the substrate (marked by the arrow at the lower left). Y425F and R350G indicate reactions in whichTelK mutant proteins with the indicated amino acid substitution were used (see the text). In the right panel, reactionsusing the same substrates labeled with 32P at the leftmost and rightmost 50 ends of the nicked substrate (top and bottomstrand label, respectively) were separated in a similar gel to the left panel, and subjected to autoradiography. B, Suicidesubstrates similar to those in A, but with a 50-phosphate on one side of the nick, were incubated with TelN (N), TelK(K) or no enzyme (2). Such a substrate with a nick between nucleotides 25 and 26 of the top strand is diagrammedbelow. The products were similarly separated by 7% PAGE containing 0.1% SDS and stained with ethidium bromide.Analysis of four different substrates, with nicks immediately to the right of positions 31B, 30B, 25T and 26T areshown. B or T after the numbers indicates that the nick is on the bottom strand or the top strand, respectively. Notethat the positions 25T and 31B, 26T and 30B are dyad symmetrical (see the text for details).


establishes that both TelK and TelN protelomerasestransiently cleave the telRL site between 25T and26T on the top strand and between 31B and 32B atthe dyad symmetrical bottom strand position,resulting in a 6 bp staggered cut with two 50-OHand 30-phosphoryl-linked protein–DNA intermedi-ates. Here, we further evaluate the importance ofnucleotide strand integrity and the flexibility ofthe nucleotide backbone of the telRL target sitethrough the use of substrates that have a nick atvarious positions on the top strand of the telRLDNA. The set of substrates used here is of thesame general design as in the previous section,where two well separated products of 28 bp and38 bp (left and right products, respectively; Figure6A) provide a qualitative readout of both the clea-vage and the subsequent re-ligation of the com-plete protelomerase reaction. We interpret that the28 bp product was generated from the re-ligationof the protein-linked intermediate at position 25T,and the 38 bp product is derived from the protein-linked intermediate at 31B. Three types of nick pla-cement on the suicide substrates were consideredwhen introducing a single nick systematicallyalong the length of the target sequence. (i) Nickswere introduced on the left side of the top cleavagesite up to 25T to assess the contribution of the scis-sile strand. (ii) Nicks were placed between the stag-gered cleavage sites between 25T and 31T to assessthe loop-forming region between the cleavage sites.(iii) Nicks were placed in the top strand at 31T andbeyond to assess the contribution at the non-scis-sile part of the substrate across from a cleavagelocation.

Starting from the top left side of the telRL targetsite, nicks (30- and 50-OH) introduced up to andincluding position 20 have minimal effect on theprotelomerase activity, they behaved like fulllength telRL-containing substrates without inter-ruptions yielding two products and no accumu-lation of protein-linked DNA intermediates(Figure 8A). Surprisingly, a nick placed betweenposition 21T and 22T (on the top strand), comple-tely abolishes the protelomerase activity (Figure8A; lanes under 21T). This suggests that the phos-phodiester linkage between nucleotide 21 and 22is functionally critical for protein–substrate inter-actions; possibly it is required for making import-ant contact with the enzyme to initiate thecleavage action, although the actual cleavage siteoccurs 4 bp to the right at position 25T. When anick was introduced at locations between 22T andthe actual cleavage site 25T, proficient cleavageand re-ligation of the 38 bp product was againseen with little or no 28 bp product (Figure 8A).Since a protelomerase cleavage occurs at position25T, the presence of a nick to the right of nucleotide22T, 23T or 24T would generate a short protein-linked oligonucleotide product of three, two orone nucleotide in length, respectively. These shortoligonucleotide-linked intermediates are appar-ently not stable enough to remain with the leftside of the substrate molecule, since only minimal

Figure 8. Hairpin end-generation using nicked oligo-nucleotide suicide substrates. A, Oligonucleotide sub-strates carrying the 56 bp N15 telRL site and 10 bpextension on the right (similar to the design used inFigure 6) with or without a nick in the top strand wereincubated with TelK in a standard reaction for one hourat 30 8C. The products were analyzed by 12% PAGE.The location of the nicks on the top strand countingfrom the left end is given on the top of the gel (e.g. 21Tindicates that a nick is present at the 30 side of nucleotide21 on the top strand). B, Schematic presentation of thesubstrate depicted in a duplex and a cruciform structuresummarizing the results of the activity of protelomeraseusing nicked suicide substrates. Representative nickedoligonucleotide suicide substrates used in these studiesare indicated by the nucleotide number where the nickis located (numbers are from left to right). Filled blackcharacters indicate that the normal two products of38 bp and 28 bp were formed using the nicked substrate.Shadowed black characters indicate that no product wasmade. Blue characters indicate that only the 38 bp pro-duct was made and red characters indicate that only28 bp product was made. Green characters indicate thata large amount of the protein-linked intermediates accu-mulated and few products were formed. Substrateswith a nick at 25T or 31B, the expected cleavage site,also generated some aberrant products. Red arrowsmark the positions where cleavage occurs.


amounts of the 28 bp product were formed. Yet the38 bp product was generated normally; in fact itsaccumulation was more pronounced than when sub-strates without nicks were used. In the substrate hav-ing a nick between nucleotides 25Tand 26T (at one ofthe cleavage sites), protein-linked intermediateswere not formed, as the substrate is already brokenat this location and no 28 bp product was formed.Yet the processing at the dyad symmetrical bottomstrand cleavage at position 31B proceeds normallyto generate the 38 bp product (Figure 8A). This resultfurther suggests that, although the two cleavageevents that generate the 6 bp staggered cuts are likelyto be coordinated in some fashion, they need notoccur simultaneously. The absence of cutting at 25Tstill allows cutting at 31B to proceed, and as long asthe needed 50-OH group at 25T is available the reac-tion proceeds to re-ligate with the opening at the25T to generate the 38 bp product.

Nicks placed between the staggered cleavagelocations blocked all product formation (data notshown), yet significant amounts of protein-linkedintermediate accumulated, as analyzed above andshown in Figure 7. We interpret this result tomean that a nucleotide backbone discontinuity inpositions between the cleavage sites does not affectthe cleavage part of the reaction as much as re-lig-ation, since the protein-linked intermediateaccumulates under these conditions but no re-ligated products were formed (Figure 7B).

When nicks were introduced on the top strand tothe right of the bottom strand cleavage position, at31T, 32Tor 33T, only a small amount of the 28 bp pro-duct was seen, and no 38 bp product was detected.Substrates with nicks at these locations would gener-ate oligonucleotides of six to eight nucleotides inlength between the protelomerase cleavage at 25Tand the nick in the substrates. Since no 38 bp productwas found, and the 38 bp product is the ligated pro-duct between the 50-OH group generated from the25T cleavage and the 31B-protein-linked opening, itsuggested that the short oligonucleotide of six toeight nucleotides in length was unable to remainwith the structure to effect re-ligation. This resultwould also be consistent with the notion that these6–8-mer oligonucleotides are part of a loop struc-ture, rendering them less proficient to be pairedwith the remaining structure. Nicks introduced at34T and 35T yielded no products (Figures 5 and 8A).Nicks to the right of nucleotides 36T, 37T or 39T didnot affect the protelomerase reaction and producednormal amounts of two hairpin-ended products.Selected suicide substrates with a nick in the bottomstrand were also constructed, and the results withthese substrates were as predicted by the symmetryof the target (data not shown, but summarized inFigure 8B).

Protelomerase recognizes specific nucleotidesequence outside of the central cleavageregion on the telRL for activity

The analysis using suicide substrates suggested

that the complex of protelomerase and its targetsite telRL may assume a cruciform structure withtwo protruding stem-loops, and that the cleavageand re-ligation sites are at the base of the loops.Furthermore, it showed that the residues 4 bpfrom the cutting site on the stem of the proposedcruciform appear to be important for function(Figure 5, 35T and Figure 8A 21T and 34T lanes) asnicks introduced at these locations completelyabolish the protelomerase hairpin end-generatingactivity. The target sites for N15 and fKO2 protelo-merases, though different in size, are identical inthe region proposed to form the protruding stem-loop, and the two proteins and their target sitesare interchangeable. Recently, another linear plas-mid PY54 with closed hairpin ends from Y. entero-colitica has been reported.10 Based on analogy withthe TelN and TelK systems described here andelsewhere,9 its target site was identified as a 42 bpperfect inverted repeat sequence as shown inFigure 9A. The alignment of the three target sitesshows numerous differences between the PY54telRL and the N15 and fKO2 target sites includingthe critical positions 21T, 34T and 35T of N15. Toinvestigate if PY54 telRL can serve as a substratefor the TelN or TelK protein, we cloned the 42 bptarget site into a high copy plasmid pSK (Strata-gene) to form pSK-Y. Figure 9 shows that linear-ized pSK-Y is not a substrate for TelK (nor is it asubstrate for TelN; data not shown). However, ifnucleotide substitutions of A15T and C16A in thetop strand of the PY54 site, and the compensatorychanges T28A and G27T in the bottom strand tomaintain inverted repeating sequence are incorpor-ated into the PY54 telRL site (called PY54-TA inFigure 9A), the resultant plasmid, pSK-Y-TA, cannow serve as substrate for TelK activity (Figure9B), albeit with lower efficiency. The numerousremaining sequence differences among the modi-fied PY54-TA and the N15 and KO2 target siteswere apparently less critical so long as the centralregion is the same. These results further suggestthat TelK and TelN apparently recognize both astructure (a cruciform formed by the invertedrepeat) as well as specific DNA sequences 3–5 bpaway from the staggered cleavage site.

Discussion

Protelomerases comprise a new class of uniqueproteins that function to generate covalently closedhairpin ends in DNA. These linear DNA ends arearranged such that one strand turns around andbecomes the complementary strand. In this man-ner, these linear DNA molecules do not have freeor open ends, and are expected to be stable andnot vulnerable to exonuclease degradations. Inaddition, such ends are readily replicated withoutloss of information from the 50 ends of replicontermini.5 Protelomerase proteins function in asequence-specific manner to rearrange the targetsite without adding or deleting nucleotides in the


Figure 9. Demonstration of sequence requirement within the telRL site. A, Sequence alignment of three naturallyoccurring telRL sites from fKO2 (Klebsiella), N15 (E. coli) and PY54 (Yersinia). Double asterisks (**) in line with thesequence indicate the turn-around position of the hairpin. Single asterisks (*) above the sequences mark the nucleo-tides in the target sites that are different from the N15 telRL site. PY54-TA carries the nucleotide substitutions A15Tand C16A and the compensatory changes G27T and T28A (PY54 nucleotide numbering of telRL site is also from leftto right). The arrows mark the cleavage sites and the vertical lines align the nucleotides that are mutated. B, Activityof TelK on the cloned substrates carrying the telRL sites described in A. Each of the sites was cloned into pSK (Strata-gene) and the linearized DNA (by the restriction enzyme AlwNI) was used as substrate incubated with (þ ) or without(2) TelK under standard conditions. pSK-K carries the fKO2 target site, pSK-N carries the N15 site, pSK-Y carries thePY54 site and the pSK-YTA carries the mutated PY54-TA site. The products were analyzed on a 1% agarose gel andstained with ethidium bromide.


process. No cofactor such as ATP or divalent cationis required for the reaction. By extensive use of oli-gonucleotide and suicide substrates, we directlydemonstrate that both TelN and TelK use a break-age and re-ligation mechanism. They cleave thetarget site three nucleotides from the center ofdyad symmetry to generate a 6 bp staggered cutwith 50 protrusions. Two transiently broken scissilephosphates with a 50-OH and a protein linked 30-phosphoryl group form as intermediates. DNAends at the scissile phosphates are exchanged inan as yet unknown manner, so that the 50-OH and30-phosphoryl-protein ends trade partners beforere-ligation.

Since the transiently cleaved intermediate has a6 bp staggered opening to yield two hairpin-ended molecules as products, the six nucleotidesbetween the cut must loop back to allow resealingin an intra-molecular reaction. A model describingthe mechanism is proposed (Figure 10). Twoalternatives are formally possible in the behaviorof the loop processing: the loops could be “pre-formed” in a stem-loop structure as a result of

protelomerase binding to the inverted repeat inthe target sequence, after which cleavage,rearrangement and re-ligation ensues. Alterna-tively, the protelomerase could cut the DNA at thetarget site in its duplex unlooped form (Figure 10;drawn inside a bracket), and thereafter the loopsare formed to allow re-ligation with new partners.Although the model has not yet been tested byextensive mutagenesis studies on the target site,the presence of inverted repeats (perfect or imper-fect ones) in all functional target sites suggeststhat DNA cruciform formation is very likely, andwe favor the preformed loop model. This notion issupported by the observation that nicks at any pos-ition between 21T to 26T or 31T to 35T on the topstrand all have strong effect on protelomerase reac-tion. These two nucleotide clusters would occupycomplementary positions on a stem if the telRLsite were to fold into a cruciform structure (Figure8B). More experimentation is clearly needed to dis-tinguish between these two possibilities.

Purified protelomerase exists as a monomer insolution, and two protein-linked cleavage intermedi-ates are formed which eventually give rise to twohairpin-ended products. Thus, two molecules ofprotelomerase interact with one dyad symmetricaltarget site to generate two hairpin ends. The role ofprotein–protein interactions brought about by targetsite binding in the reaction is not yet clear. However,the two hairpin-end generation events can beuncoupled. Nicks introduced at or very near one ofthe cleavage positions (such as the nicks to the rightof 23T, 24T and 25T) in the substrate yielded onlyone of the two products at more pronounced levelthan a standard two-product reaction (Figure 8). Onthe other hand, the two molecules of protelomeraseworking on one target site might not be workingindependently of each other, since a single nick atone of the two strands between the cleavage site issufficient to inhibit the re-ligation of both productsproviding for the accumulation of two protein-linked intermediates (Figure 7A). We further ident-ified a position three to four nucleotides outside ofthe cleavage location where phosphodiester back-bone integrity is absolutely required. The importanceof this recognition site is supported by the obser-vation that a simple change of 2 bp in this criticallocation together with their complementary changesto maintain dyad symmetry on the target site in thenewly discovered Yersinia linear plasmid PY54,10 ren-ders it susceptible to the action of a heterologous pro-telomerase from fKO2 or N15 (Figure 9). Thisfurther attests to the evolutionary relatedness ofthese linear hairpin-end-generating systems.

Recently, a protein that can resolve the hairpin-ended telomeres of B. burgdorferi has also beenidentified, and the mechanics of its actiondescribed.7,11,12,19 Like TelN and TelK, the Borreliaprotein, called ResT resolvase, cleaves the substrateDNA to generate 50 protruding 6 bp staggered cuts.However, the amino acid sequence similaritybetween ResT and TelN/TelK is rather low (22%identity), and there is a large disparity between

Figure 10. A model for the mechanism of action of pro-telomerase. The duplex DNA target site telRL of protelo-merase carries an inverted repeating sequence. Twomolecules of protelomerase bind to the dyad symmetri-cal target site to form a dimeric protein complex. The tar-get site protein complex may adopt a structuresomewhat similar to a synaptic complex due to theinverted repeating sequences. A 6 bp staggered cut with50 protruding ends is introduced which has a 50-OH anda 30-phosphate-linked-protein intermediate at each ofthe openings. The covalent attachment of protein–DNAis indicated by a blue dot. Whether the protein–DNAcomplex consists of DNA in the duplex form or in thecruciform conformation at the time of the transient clea-vage remains to be determined (we favor the cruciformconformation). This is followed by a strand exchangewith the consequence that a different 50-OH group fromthat created by the initial cleavage is paired with the pro-tein-linked end (the protein-linked junction from the topblack strand is paired with the red 50-OH group fromthe bottom strand and vice versa). The transient openingis then re-ligated resulting in hairpin formation and therelease of the protein (see the text for a more detaileddescription).


their sizes. ResT’s 449 amino acid residues are closerto the typical size of Y-recombinases than the phageencoded protelomerases (640 residues for TelK). IfResT is the only closed hairpin-end-generatingenzyme in the Borrelia cell, and no other family mem-bers have been identified in its sequenced genome,4,7

then the Borrelia ResT protein appears to be morepromiscuous than the phage protelomerase proteinsin its utilization of target sites. Considerable vari-ation in sequences exists among the eight sequencedchromosomal and linear plasmid telomeres ofB. burgdorferi,5 so the single resolvase must accom-modate all these differences.

With the recent determination of the minimalBorrelia target site,20 it appears all hairpin end-gen-erating enzymes, regardless of whether they arephage or bacterial in origin, use inverted repeattarget sites in the range of 42–56 bp. We find thatprotelomerases from fKO2 and N15 are able touse as substrates target sequences both in linearduplex and in supercoiled forms (Figure 2),whereas the Borrelia ResT is reported to be unableto resolve a supercoiled substrate.11 Although bothtypes of proteins generate hairpin ends, perhapsthere are important distinctions between thephage protelomerases and ResT, both in proteindomain organization and in their interaction withsubstrates. The native telRL target site of the N15and fKO2 phage genome is an imperfect invertedrepeat, so it generates distinct left and right hairpinends to give two different ends in the linear plas-mid. Synthetic, perfectly symmetric substrate sitessuch as telLL0 or telRR0 are also utilized efficientlyby TelN and TelK (data not shown). If the intra-cellular replicative intermediates of these linearplasmids are head-to-head dimer circles assuggested by Ravin et al.,15 then symmetric telLL0

and telRR0 sites formed at the novel junctions ofdimer circles and could also be resolved by prote-lomerase. In fact, the Y. enterocolitica PY54 linearplasmid and a possible hairpin-end-generating sys-tem of phage VHML Vibrio harveyi21 carry perfectlysymmetric target sites.

The integrase/Y-recombinase family of proteinsall utilize DNA breaking and rejoining mechan-isms that have 30-linked protein intermediates toeffect DNA rearrangement or resolution of Holli-day junctions to mobilize DNA. Alignment of alarge collection of members of this family of pro-teins and correlation with four atomic structuresof representative members have provided a signa-ture motif described as the “RKHRH” catalyticpentad, which jointly coordinates and catalyzesthe attack by the active site tyrosine.22,23 A carefulalignment shows that R-275, K-300, M-393, R-396and H-416 of fKO2 protelomerase are very likelythe amino acids of its catalytic pentad. With theexception of the middle histidine in the RKHRHsignature, these conserved residues are invariantin N15 and fKO2 protelomerase, as well as in allthe other known hairpin-end-generating enzymes.Exceptions to this middle canonical histidine resi-due have also been noted even among the well-

characterized members of the Y-recombinasefamily. This histidine position is occupied by alysine, K-220, in vaccinia virus topoisomerase,24

and by an arginine, lysine, asparagine or tyrosinein some other Y-recombinases.22 This position is amethionine in the N15 and fKO2 protelomerases,but this is not conserved in other protelomerases;it is a lysine in the Yersinia PY54 protein, a histidinein the putative Vibrio VHML protein, and tyrosinein the bacterial proteins from B. burgdorferi andA. tumefaciens. The significance of this variationremains to be deciphered.

We show here that protelomerases are convincingmembers of the Y-recombinase family. Yet theyclearly perform DNA rearrangements differentlyfrom other member proteins that use a tyrosineactive site and specific target sequences. Significantdifferences are noted beyond the catalytic domainboth at the N termini and the C termini of protelo-merases when compared with the standard Y-recom-binases. Moreover, the target site of one integrase/recombinase often includes a number of relatedsites such as bacterial attachment and phage attach-ment sites. Auxiliary proteins are sometimes neededfor the two sequential exchanges needed to completethe recombination or integration/excision events.22

Whereas in the case of protelomerases, one duplextarget is involved, one intra-molecular DNAexchange event is sufficient to generate two hairpinends, and no other cofactor is required in the in vitroreaction. The target sequence requirements alsoappear to be more stringent at the current level ofanalysis. Although protelomerase cleavage gener-ates a 30-phosphoryl-protein linked intermediateand 50-OH opening, which is a hallmark of membersof this family of proteins of recombinases and type IBtopoisomerases, the subunit structure of protelomer-ase is different from the other members. Like topoi-somerase IB, it exists as monomers in solution, butupon complexing with the dyad symmetrical targetDNA, two molecules of protelomerase coordinatetwo cleavages to generate the staggered cuts,whereas in topoisomerase IB only one single-strandcleavage event occurs to provide a swivel point toeffect topological changes in the substrate DNA.Under some conditions, recombinases can havetopoisomerase activity, and topoisomerases canaffect DNA strand exchanges. It is expected thatunder some specialized conditions, protelomerasesmay also exhibit topoisomerase activity.

Materials and Methods

Cloning of protelomerases and their target sites

The T7 promoter-driven vectors, pET15b or pET16b(Invitrogen) were used to clone and expressprotelomerase proteins in E. coli. The coding sequencesof these genes from fKO2 and N15 phage were ampli-fied by PCR using the following primer pairs: 50-AGGTAGCATATGCGTAAGGTGAAAATTGGTGAGC and50-ATAGGATCCTCACTTGAAGTAGGCACTCCAGGCAGATTG for the generation of TelK from fKO2 (pET/


TelK) and 50-ATATGAACCCATATGAGCAAGGTAAAAATCGGTGA and 50-GCCGGATCCTTAGCTGTAGTACGTTTCCCATGCG for the generation of TelN fromN15 (pET/TelN). (The underlined positions correspondto the Nde I and Bam HI restriction sites used for the clon-ing.) The 56 bp telomere site of N15 and the 50 bp telo-mere site of fKO2 (Figure 1) were cloned into pSK vector(Stratagene) via HindIII and Bam HI sites using syntheticoligonucleotides with these restriction sites added as 50

extensions to form pSK-N and pSK-K, respectively.

Protein purification and assays

Protelomerases from N15 and fKO2 were purified asN-terminal 6 £ His-fusion proteins from the E. coliBL21(DE3) cells (Novagen) harboring the pET/TelN andpET/TelK expression plasmids. Cultures were grown inLB medium supplemented with 130 mg/ml ampicillin at37 8C to an A590 of about 0.8. Induction was done in0.7 mM isopropyl-1-thio-b-D-galactopyranoside (IPTG)for 12–16 hours at room temperature. Cells were col-lected by centrifugation and stored frozen at 280 8Cuntil needed. The frozen cell pellet from one liter ofinduced culture was resuspended in 20 ml of lysis buffer(25% (w/v) sucrose, 50 mM Tris–HCl (pH 8), 25 mM2-mercaptoethanol and protease inhibitors, 0.13 mMbenzamidine and 0.6 mM PMSF (phenylmethylsulfonylfluoride)). Lysozyme (Sigma) was added to a final con-centration of 0.6 mg/ml and the suspension was incu-bated at 0 8C for about 30 minutes. A brief sonication(4 £ 20 seconds with a micro-probe) followed to com-plete the lysis. The suspension was treated with RNase(150 mg/ml), DNase (5 mg/ml in 5 mM Mg2SO4) at 0 8Cfor one hour, and finally the following were added to afinal concentration of: 0.6% (v/v) Thesit (BoehringerMannheim), 2 M NaCl, 0.13 mM benzamidine and0.625 mM PMSF. The suspension was incubated withgentle stirring at 0 8C for at least two hours, followed bycentrifugation at 25,000 rpm at 4 8C in an SW40 rotor toremove cell debris. Protelomerases are soluble underthese conditions. The supernatant was applied (as twobatches) to a 12–15 ml column of Ni-NTA agarose (Qia-gen) equilibrated with buffer N (10% (v/v) glycerol,50 mM Tris–HCl (pH 7.5), 10 mM 2-mercaptoethanol,0.1 mM benzamidine). The column was washed withabout ten column volumes of buffer N containing500 mM NaCl and 20 mM imidazole. The protein elutedin about two column volumes of buffer N containing500 mM NaCl and 800 mM imidazole. Fractions contain-ing the protein were dialyzed first against buffer N con-taining 500 mM NaCl to remove imidazole and thenagainst buffer S (50% glycerol, 50 mM Tris–HCl (pH7.5), 500 mM NaCl, 15 mM 2-mercaptoethanol, 0.1 mMbenzamidine, 0.5 mM PMSF) for storage at 220 8C. Theproteins at this stage were about 98% pure and free ofnucleases. Aliquots of no more than 10 mg per run werefurther purified by gel filtration on a Superdex 200 col-umn (HiLoad 16/60; Amersham Biosciences) usingFPLC at a flow rate of 1 ml/minute in buffer N contain-ing 500 mM NaCl. The elution was monitored by absor-bance at 280 nm. Protelomerase elutes at 0.5 bed volumeof the column. Peak material was pooled and dialyzedinto storage buffer (buffer S). Alternatively, if highly con-centrated protein is desired, the pooled fractions can firstbe concentrated by Centricon-30 (Amicon) or re-appliedto a small (about 2 ml) Ni-NTA agarose column, elutedwith buffer N containing 500 mM NaCl and 800 mM imi-dazole as described in the bulk purification before put-

ting into storage buffer by dialysis. About 40 mg ofpurified protein was obtained per liter of culture.

Protelomerase was assayed in 15 ml reactions contain-ing 20 mM Tris–HCl (pH 7.5), 50 mM potassium gluta-mate, 1 mM dithiothreitol (DTT) and 0.1 mM EDTA,0.5 mg of supercoiled or linear substrate DNA and 0.2–2 pmol of enzyme. Reactions were incubated at 30 8C for30 minutes, stopped by the addition of glycerol (20%final concentration) and SDS (1% (w/v) final concen-tration) and analyzed on 1% (w/v) agarose gels at 60 Vfor one hour in Tris–acetate buffer (40 mM Tris, 5 mMsodium acetate, 2 mM EDTA (pH 8.2)), visualized byethidium bromide staining. When oligonucleotides wereused as substrates, the same reaction conditions wereused except that the oligonucleotides were present at15 pmol per reaction and the enzyme concentrationswere increased to 40–100 pmol per reaction. The oligo-nucleotide reaction products were analyzed on 12%polyacrylamide gels in 1 £ TBE buffer (89 mM Tris–borate, 2 mM EDTA (pH 8.6)) at 250 V for 90 minutesusing a vertical gel electrophoresis system (model V-16;Life Technologies).

Oligonucleotides

Synthetic oligonucleotides containing the target telRLsite from N15 were based on the following 66 basesequences: top strand 50-TATCAGCACACAATTGCCCATTATACGC**GCGTATAATGGACTATTGTGTGCTGATAGGATCCCGGG and bottom strand 50-CCCGGGATCCTATCAGCACACAATAGTCCATTATACGC**GCGTATAATGGGCAATTGTGTGCTGATA. The underlinedbases are the added extension such that when the topand the bottom are paired to form a duplex, a 10 bpextension occurs at the right side of telRL, as drawn inFigure 6A; asterisks (**) mark the location of the turn-around point where hairpin ends are expected to form.Nicked suicide substrates were constructed by splittingthe top or bottom strand into two adjacent oligonucleo-tides (at locations specified in the text) and annealingwith the corresponding bottom or top strand. Substrateoligonucleotides were formed by mixing the top and thebottom strands (with or without nicks) at 10 pmol/ml inthe presence of 50 mM Tris (pH 7.5). The mixture washeated to 90 8C for three minutes followed by slow cool-ing at 0.01 deg.C per second in a thermal cycler for con-trolled annealing. When appropriate, oligonucleotideswere labeled at the 50 end with T4 polynucleotide kinase(New England Biolabs) and [g-32P]ATP. For internallylabeled oligonucleotide substrates with a label in the topstrand, the top strand was constructed as two halves.The 50 end of the right half, at 10 pmol/ml was firstlabeled with g-32P using T4 polynucleotide kinase. After,the T4 polynucleotide kinase was inactivated by heating(62 8C, 20 minutes), the left half and the bottom strandwere added to the sample, also at 10 pmol/ml, followedby controlled annealing for duplex formation asdescribed above. T4 ligase was then added to the duplexto seal the nick efficiently. The internally labeled duplexoligonucleotide substrates, so constructed, had similarsubstrate efficiencies to the full-length duplex oligonu-cleotide substrates formed without the initial nick. Simi-larly, internally labeled oligonucleotide substrates withlabels in the bottom strand were prepared using twohalves of the bottom strand with a g-32P at the bottomleft, to anneal with the full length top strand followedby ligation to seal the bottom nick.


Protelomerase cleavage reactions in vitro

Oligonucleotide substrates or suicide substrates (withor without end label) were mixed under standard reac-tion conditions with excess amounts of protelomerase(three to five times the amount used for assays wereadded to force the reaction) first at 0 8C for 30 minutes,then incubated at 30 8C for 30 minutes. For proteasetreatment, the reaction was split into two aliquots; inone portion, SDS was added to 0.2%, proteinase K wasadded to 200 mg/ml, and incubation was continued at37 8C for 15 minutes. In the second portion, stop mixturecontaining 1% SDS was added without the proteinase Ktreatment. Samples were analyzed under protein dena-turing conditions in 7% polyacrylamide gel in 1 £ TBEbuffer containing 0.1% SDS (in the gel and in the runningbuffer).

Other methods

Sedimentation equilibrium was carried out at 20 8C ina Beckman Optima XL-A analytical ultracentrifugeequipped with UV optics. An ANTi60 rotor with a six-channel, 12 mm thick, charcoal-epon centerpiece wasused. The three sample channels in each cell containedthree different loading concentrations of protein in a buf-fer consisting of 50 mM Tris–HCl (pH 7.5), 150–250 mMNaCl and 1 mM DTT, and the reference channels con-tained buffer only. Samples were centrifuged until sedi-mentation and chemical equilibrium were attained.Equilibrium was confirmed by no change in scans takenat four hourly intervals. Cells were scanned radially incontinuous mode, with data resulting from ten absor-bance readings taken at 0.001 cm intervals. Values forthe partial specific volume and the extinction coefficientfor each protein were calculated from their amino acidsequences using the method described by Laue et al.25

Curve fitting and calculation of molecular mass weredone using the software NONLIN using non-linearleast-squares techniques.18 Alkaline agarose gel analysiswas carried out in 1% (w/v) agarose using 50 mMNaOH and 1 mM EDTA as the running buffer at 40 Vfor three to five hours at 4 8C.

Acknowledgements

We thank Jennifer Ku & Brian Chesnut for tech-nical help in the early phase of this research. Thiswork was supported by NSF grant MCB-021324.

References

1. Goodner, B., Hinkle, G., Gattung, S., Miller, N., Blan-chard, M., Qurollo, B. et al. (2001). Genome sequenceof the plant pathogen and biotechnology agent Agro-bacterium tumefaciens C58. Science, 294, 2323–2328.

2. Wood, D. W., Setubal, J. C., Kaul, R., Monks, D. E.,Kitajima, J. P., Okura, V. K. et al. (2001). The genomeof the natural genetic engineer Agrobacterium tumefa-ciens C58. Science, 294, 2317–2323.

3. Casjens, S., Murphy, M., DeLange, M., Sampson, L.,van Vugt, R. & Huang, W. M. (1997). Telomeres ofthe linear chromosomes of Lyme disease spiro-chaetes: nucleotide sequence and possible exchange

with linear plasmid telomeres. Mol. Microbiol. 26,581–596.

4. Fraser, C. M., Casjens, S., Huang, W. M., Sutton, G. G.,Clayton, R., Lathigra, R. et al. (1997). Genomicsequence of a Lyme disease spirochaete, Borreliaburgdorferi. Nature, 390, 580–586.

5. Casjens, S. (1999). Evolution of the linear DNA repli-cons of the Borrelia spirochetes. Curr. Opin. Microbiol.2, 529–534.

6. Hinnebusch, J. & Barbour, A. G. (1991). Linear plas-mids of Borrelia burgdorferi have a telomeric structureand sequence similar to those of a eukaryotic virus.J. Bacteriol. 173, 7233–7239.

7. Casjens, S., Palmer, N., van Vugt, R., Huang, W. M.,Stevenson, B., Rosa, P., Lathigra, R. et al. (2000). Abacterial genome in flux: the twelve linear and ninecircular extrachromosomal DNAs in an infectiousisolate of the Lyme disease spirochete Borrelia burg-dorferi. Mol. Microbiol. 35, 490–516.

8. Malinin, A., Vostrov, A., Rybchin, V. & Sverchevsky,A. (1992). Structure of the linear plasmid N15 ends(in Russian). Mol. Genet. 5–6, 19–22.

9. Rybchin, V. N. & Svarchevsky, A. N. (1999). The plas-mid prophage N15: a linear DNA with covalentlyclosed ends. Mol. Microbiol. 33, 895–903.

10. Hertwig, S., Klein, I., Lurz, R., Lanka, E. & Appel, B.(2003). PY54, a linear plasmid prophage of Yersiniaenterocolitica with covalently closed ends. Mol. Micro-biol. 48, 989–1003.

11. Kobryn, K. & Chaconas, G. (2002). ResT, a telomereresolvase encoded by the Lyme disease spirochete.Mol. Cell, 9, 195–201.

12. Ravin, V., Ravin, N., Casjens, S., Ford, M. E., Hatfull,G. F. & Hendrix, R. W. (2000). Genomic sequenceand analysis of the atypical temperate bacteriophageN15. J. Mol. Biol. 299, 53–73.

13. Deneke, J., Ziegelin, G., Lurz, R. & Lanka, E. (2000).The protelomerase of temperate Escherichia coliphage N15 has cleaving–joining activity. Proc. NatlAcad. Sci. USA, 97, 7721–7726.

14. Deneke, J., Ziegelin, G., Lurz, R. & Lanka, E. (2002).Phage N15 telomere resolution. Target requirementsfor recognition and processing by the protelomerase.J. Biol. Chem. 277, 10410–10419.

15. Ravin, N. V., Strakhova, T. S. & Kuprianov, V. V.(2001). The protelomerase of the phage-plasmid N15is responsible for its maintenance in linear form.J. Mol. Biol. 312, 899–906.

16. Stoppel, R. D., Meyer, M. & Schlegel, H. G. (1995).The nickel resistance determinant cloned from theenterobacterium Klebsiella oxytoca: conjugationaltransfer, expression, regulation and DNA hom-ologies to various nickel-resistant bacteria. Biometals,8, 70–79.

17. Casjens, S., Gilcrease, E., Huang, W. M., Bunny, K.,Pedulla, F. M., Houtz, J. M. et al. (2004). The pKO2linear plasmid prophage of Klebsiella oxytoca.J. Bacteriol. In the press.

18. Johnson, M. L., Correia, J. J., Ypahantis, D. A. & Hal-vorson, H. R. (1981). Analysis of data from analyticalultracentrifuge by non-linear least squares tech-niques. Biophys. J. 36, 575–588.

19. Chaconas, G., Stewart, P. E., Tilly, K., Bono, J. L. &Rosa, P. (2001). Telomere resolution in the Lyme dis-ease spirochete. EMBO J. 20, 3229–3237.

20. Tourand, Y., Kobryn, K. & Chaconas, G. (2003).Sequence-specific recognition but position-depen-dent cleavage of two distinct telomeres by the


Borrelia burgdorferi telomere resolvase, ResT. Mol.Microbiol. 48, 901–911.

21. Oakey, H. J., Cullen, B. R. & Owens, L. (2002). The com-plete nucleotide sequence of the Vibrio harveyi bacterio-phage VHML. J. Appl. Microbiol. 93, 1089–1098.

22. Nunes-Duby, S. E., Kwon, H. J., Tirumalai, R. S.,Ellenberger, T. & Landy, A. (1998). Similarities anddifferences among 105 members of the Int family ofsite-specific recombinases. Nucl. Acids Res. 26,391–406.

23. Esposito, D. & Scocca, J. J. (1997). The integrase

family of tyrosine recombinases: evolution of a con-served active site domain. Nucl. Acids Res. 25,3605–3614.

24. Krogh, B. O. & Shuman, S. (2002). A poxvirus-liketype IB topoisomerase family in bacteria. Proc. NatlAcad. Sci. USA, 99, 1853–1858.

25. Laue, T. M., Shah, B. D., Ridgeway, T. M. & Pelletier,S. L. (1992). Computer aided interpretation of ana-lytical sedimentation data for proteins. In Ultracentri-fugation in Biochemistry and Polymer Science,Cambridge University Press, Cambridge.

Edited by M. Gottesman

(Received 2 September 2003; received in revised form 30 December 2003; accepted 6 January 2004)


Protelomerase Uses a Topoisomerase IB/ Y-Recombinase Type ...

Documents

Transcript of Protelomerase Uses a Topoisomerase IB/ Y-Recombinase Type ...