PRODUCT INFORMATION Thermo Scientific EpiJET 5-hmC...
19
PRODUCT INFORMATION Thermo Scientific EpiJET 5-hmC Enrichment Kit #K1491BID Lot 00000000 Expiry Date __ g
Transcript of PRODUCT INFORMATION Thermo Scientific EpiJET 5-hmC...
PRODUCT INFORMATION
Thermo Scientific EpiJET 5-hmC Enrichment Kit #K1491BID Lot 00000000 Expiry Date __
g
CERTIFICATE OF ANALYSIS
The kit is functionally tested by analyzing a mix of 5-hmC Control DNA and Control DNA
(unmodified). Performance of the kit is assayed by qPCR with the provided primers for both
control DNA molecules. The kit passes quality control requirements for yield and fold enrichment
of 5-hmC Control DNA over the Control DNA (unmodified).
Quality authorized by: Jurgita Zilinskiene
Rev.3 f
1
Contents page
KIT COMPONENTS .................................................................................................................. 2
STORAGE ................................................................................................................................. 2
DESCRIPTION .......................................................................................................................... 3
ADDITIONAL MATERIALS AND EQUIPMENT REQUIRED...................................................... 5
IMPORTANT NOTES ................................................................................................................ 5
PROTOCOL .............................................................................................................................. 6
A. Enzymatic DNA Modification ............................................................................................. 6
B. DNA Purification 1 ............................................................................................................ 6
C. Biotin Conjugation ............................................................................................................ 7
D. DNA Purification 2 ............................................................................................................ 7
E. 5-hmC DNA Separation .................................................................................................... 8
SUPPLEMENTARY PROTOCOLS ........................................................................................... 9
DNA fragmentation ................................................................................................................ 9
Using Control DNA for the assessment of kit performance ................................................... 9
qPCR and data analysis of enriched genomic DNA sample ................................................ 12
APPENDIX .............................................................................................................................. 15
Control DNA and primer DNA sequences ........................................................................... 15
TROUBLESHOOTING ............................................................................................................ 16
SAFETY INFORMATION ........................................................................................................ 17
2
KIT COMPONENTS
Component #K1491BID for 25 rxns
Box 1/2
5-hmC Modifying Enzyme 250 µL
4X Enzyme Reaction Buffer 350 µL
10x Biotin Conjugation Buffer 250 µL
Biotin Reagent 1.25 mL
Primer Mix for Control DNA (unmodified), 5 µM* 100 µL
Primer Mix for 5-hmC Control DNA, 5 µM* 100 µL
5-hmC Control DNA, 10 ng/µL** 10 µL
Control DNA (unmodified), 0.5 µg/µL** 20 µL
Box 2/2
Streptavidin Magnetic Beads 500 µL
Streptavidin Binding Buffer 1 mL
Streptavidin Wash Buffer 1 10 mL
Streptavidin Wash Buffer 2 10 mL
Water, nuclease-free 15 mL
Column Binding Buffer 5.5 mL
Column Wash Buffer (concentrated) 2 7 mL
Elution Buffer 2 1.5 mL
DNA Purification Micro Columns and Collection Tubes 50
* view primer sequences on page 15.
** the 5-hmC Control DNA consists of a 640 bp PCR fragment containing a single hemi-5-hydroxymethylated cytosine. Control DNA (unmodified) consists of 500 bp PCR fragment without 5-hydroxymethylcytosine modification. View control DNA sequences on page 15.
STORAGE
All components of Box 1/2 should be stored at -20 °C. Upon kit arrival remove Streptavidin
Magnetic Beads and DNA Purification Micro Columns and Collection Tubes from Box 2/2 and
store at 4 °C. Other components of Box 2/2 can be stored at room temperature (15-25 °C).
3
DESCRIPTION
The Thermo Scientific™ EpiJET™ 5-hmC Enrichment Kit is an efficient system for enrichment
of 5-hydroxymethylcytosine (5-hmC) containing DNA over unmodified and 5-methylcytosine
(5-mC) containing DNA. The 5-hmC DNA enrichment procedure takes 3-3.5 hours. Control
system provided in the kit gives more than 50-fold enrichment of the 5-hmC modified over
unmodified and 5-mC DNA and at least 20% of the input 5-hmC DNA is recovered after the
enrichment procedure.
The kit takes advantage of the 5-hmC Modifying Enzyme, which is formulated for highly
specific and efficient modification of 5-hmC present in CpG dinucleotides of DNA, and it does
not have any activity over unmodified or methylated cytosines.
The enzyme adds a short linker molecule to 5-hmC, to which biotin is conjugated in the
following chemical modification step. The resulting modified DNA is separated from unmodified
DNA on Streptavidin Magnetic Beads. Biotin Reagent includes S-S linker for an optional
removal of biotin moiety from the purified DNA. The enriched DNA needs no further clean up
as it is eluted in water. The DNA can be used for qPCR analysis of desired loci, microarray
analysis or next generation sequencing. Figure 1 describes the EpiJET 5-hmC Enrichment Kit
workflow and the time required for each of the steps in the process.
To evaluate the kit performance two control DNAs are included: 5-hmC Control DNA and
unmodified Control DNA. Additionally, DNA Micro Columns and buffers are supplied with the
kit for DNA purification after DNA modification reactions.
4
Fragmented genomic DNA
m hm ǀ ǀ
5ʹ.....CG.....3ʹ 5ʹ.....CG.....3ʹ 5ʹ.....CG.....3ʹ
3ʹ.....GC.....5ʹ 3ʹ.....GC.....5ʹ 3ʹ.....GC.....5ʹ ǀ ǀ
m m
+ 5-hmC Modifying Enzyme + linker
En
zym
atic
DN
A
mo
dif
icat
ion
60 m
in
m linker ǀ ǀ
5ʹ.....CG.....3ʹ 5ʹ.....CG.....3ʹ 5ʹ.....CG.....3ʹ
3ʹ.....GC.....5ʹ 3ʹ.....GC.....5ʹ 3ʹ.....GC.....5ʹ ǀ ǀ
m m
DNA purification (10 min.)
Bio
tin
co
nju
gat
ion
10 m
in
+ Biotin Reagent
m linker-Biotin ǀ ǀ
5ʹ.....CG.....3ʹ 5ʹ.....CG.....3ʹ 5ʹ.....CG.....3ʹ
3ʹ.....GC.....5ʹ 3ʹ.....GC.....5ʹ 3ʹ.....GC.....5ʹ ǀ ǀ
m m
DNA purification (10 min.)
5-h
mC
DN
A s
epar
atio
n
60 m
in
5-hmC DNA separation
linker-Biotin ǀ
5ʹ.....CG..........3ʹ
3ʹ.....GC..........5ʹ ǀ
m
Enriched DNA is ready for downstream applications
Figure 1. 5-hmC containing DNA enrichment workflow. Only the 5-hmC is modified by
5-hmC Modifying Enzyme by adding the linker and subsequently chemically modified by biotin
moiety using Biotin Reagent. After each DNA modification step the samples are purified using
DNA purification columns. 5-hmC containing DNA separation from unmodified and 5-mC DNA
is performed using streptavidin-coated magnetic beads. The enriched DNA is ready for
analysis by qPCR or other techniques.
5
ADDITIONAL MATERIALS AND EQUIPMENT REQUIRED
96-100% ethanol, molecular biology grade
Magnetic rack
Rotating microtube platform
Pipettes and pipette tips
Sterile 1.5 mL microcentrifuge tubes
Disposable gloves
Heat block or water bath capable of heating from 30 °C to 70 °C
qPCR reagents and real-time thermal cycler
TE pH 7.6 buffer or water for DNA dilutions
IMPORTANT NOTES
Add 35 mL of 96-100% ethanol to Column Wash Buffer (concentrated) before using for
the first time.
Process up to 6 samples at a time to minimize experimental variability.
Wear disposable gloves during DNA enrichment procedure.
If the precipitate is seen in Column Binding Buffer upon kit arrival, redissolve it by incubating
the buffer briefly at 37 °C, then cool to room temperature.
Genomic DNA purity is an important factor for successful 5-hmC enrichment. We
recommend use of spin column based kits such as the Thermo Scientific™ GeneJET™
Genomic DNA Purification Kit (cat. #K0721/2) for genomic DNA purification.
To achieve maximal enrichment level, genomic DNA should be fragmented to 200-600 bp
long fragments. See Supplementary Protocols for recommendations on DNA fragmentation
by sonication. Do not fragment the included control DNA.
The enriched, modified DNA results in a single strand form. For downstream applications
which require the whole sample amplification step (e.g,. next generation sequencing), the
adapter sequences must be added before the enrichment.
For qPCR-based evaluation, keep an aliquot of fragmented DNA (before enrichment) for a
standard curve preparation (see page 13).
Prepare all reactions at room temperature.
If desired, the biotin moiety can be removed by incubating the DNA with 100 mM DTT
for 15 min at room temperature. After DTT treatment DNA should be re-purified, using, e.g.,
GeneJET™ Gel Extraction and DNA Cleanup Micro Kit (cat. #K0831/2).
Depending on the magnet strength, time required for magnetic beads to settle may vary. It
is important to make sure that all the beads are well separated from the buffer in all steps.
Avoid drying out magnetic beads. After removing one buffer, resuspend in the next one
immediately.
For evaluation of the enrichment procedure, see section “Using Control DNA for the
assessment of kit performance” on page 9.
6
PROTOCOL
Before starting:
Remove the Biotin Reagent from -20 °C and place it at room temperature to thaw.
Thaw, gently vortex and briefly centrifuge the 4x Enzyme Reaction Buffer and DNA
sample solutions.
A. Enzymatic DNA Modification
1. Assemble the following components in sterile tubes at room temperature:
Component Sample No enzyme control***
Sample DNA (fragmented)* 0.1-1 µg 0.1-1 µg
4X Enzyme Reaction Buffer 12.5 µL 12.5 µL
5-hmC Modifying Enzyme** 10 µL ---
Water, nuclease-free to 50 µL to 50 µL
Total volume 50 µL 50 µL
* see Supplementary Protocols for recommendations on DNA fragmentation by ultrasound (see page 9).
** the 5-hmC Modifying Enzyme should always be the last component added to the reaction mixture.
*** no enzyme control should be prepared if DNA enrichment fold needs to be evaluated (see page 14). Use
the same amount of template for the enzyme-containing and no enzyme control samples.
Note: see page 9 for protocol for use of control DNA.
2. Gently mix (do not vortex) the components and spin tubes briefly.
3. Incubate the reactions at 30 °C for 1 hour (water bath is recommended for maximum
performance).
B. DNA Purification 1
Note: all centrifugations should be performed in table-top microcentrifuge at 14,000 × g.
1. Add 150 µL of nuclease-free water into the reaction tube (Enzymatic DNA modification
section, step A3).
2. Add 100 µL of Column Binding Buffer.
3. Add 300 µL of ethanol (96-100%).
4. Vortex and spin briefly to collect drops. Transfer the solution into the DNA Purification
Micro Column preassembled with a collection tube.
5. Centrifuge for 60 s. Discard the flow-through.
6. Add 700 µL of Column Wash Buffer (supplemented with ethanol) into the DNA
Purification Micro Column.
7. Centrifuge for 30 s. Discard the flow-through.
8. Repeat steps 6 and 7.
9. Centrifuge the column for additional 60 s to remove the residual buffer.
10. Transfer the DNA Purification Micro Column to a clean 1.5 ml microcentrifuge tube (not
included). Apply 20 µL of nuclease-free water to the center of the column and leave for
2 min at room temperature.
11. Centrifuge for 60 s to elute DNA.
7
12. Apply additional 20 µL of nuclease-free water to the center of the column and elute DNA to
the same tube as in step 10 by centrifugation for 60 s. Two elution steps should result in
40 µL of the purified DNA sample. If the volume is smaller, adjust to 40 µL with nuclease-
free water.
C. Biotin Conjugation
1. Add 10 µL of 10X Biotin Conjugation Buffer into the purified DNA (DNA Purification 1,
step B12) and incubate at room temperature for 5 min.
2. Add 50 µL of Biotin Reagent.
3. Vortex and spin briefly to collect drops.
4. Incubate the reactions at 50 °C for 5 min (water bath is recommended for maximum
performance).
Note: It is critical not to extend biotin conjugation reaction for more than 5 min. Proceed to the
next step of the protocol and add the Elution Buffer (DNA Purification 2, step D1) as soon as
possible after removing samples from 50 °C.
D. DNA Purification 2
Note: all centrifugations should be performed in table-top microcentrifuge at 14,000 × g.
1. Add 100 µL of Elution Buffer to stop the biotinylation reaction (Biotin Conjugation, step
C4).
2. Add 100 µL of Column Binding Buffer.
3. Add 300 µL of ethanol (96-100%).
4. Vortex and spin briefly to collect drops. Transfer the solution into the DNA Purification
Micro Column preassembled with a collection tube.
5. Centrifuge for 60 s. Discard the flow-through.
6. Add 700 µL of Column Wash Buffer (supplemented with ethanol) to the DNA purification
column.
7. Centrifuge for 30 s. Discard the flow-through.
8. Repeat steps 6 and 7.
9. Centrifuge the column for additional 60 s to remove the residual buffer.
10. Transfer the DNA Purification Micro Column to a clean 1.5 mL microcentrifuge tube
(not included). Apply 20 µL of nuclease-free water to the center of the column and leave
for 2 min at room temperature.
11. Centrifuge for 60 s to elute DNA.
12. Apply 20 µL of nuclease-free water to the center of the column and elute DNA to the same
tube as in step 10 by centrifugation for 60 s. The two elution steps should result in 40 µL
of the purified sample. If the volume is smaller, adjust to 40 µL with nuclease-free water.
13. Proceed to the next step of the protocol or store the eluted DNA at -20 °C.
8
E. 5-hmC DNA Separation
Notes: It is critically important to change pipette tips after each step.
After removing buffer solution from the magnetic beads, resuspend with the next buffer as
soon as possible to avoid drying out.
1. Prepare Streptavidin Magnetic Beads:
a. Suspend Streptavidin Magnetic Beads with a pipette until no beads are left on the
bottom of the tube.
b. Transfer 20 µL of suspended Streptavidin Magnetic Beads to bottom of a clean
1.5 mL microcentrifuge tube and place the tube in a magnetic rack. Allow beads to
settle until completely separated from the solution.
c. Carefully remove the solution by a micropipette and discard.
d. Add 40 µL of Streptavidin Binding Buffer. Suspend beads by pipetting up and down
until beads are completely resuspended.
2. Mix the prepared Streptavidin Magnetic Bead solution with 40 µL of purified DNA (DNA
Purification 2, step D12).
3. Place the tube with beads into a rotating microtube platform. Rotate for 15 min
at moderate speed at room temperature. Alternatively, incubate the beads with DNA
for 15 min gently mixing the solution every 5 min to avoid the sedimentation of beads.
4. Place the tube in a magnetic rack. Allow beads to settle.
5. Carefully remove the supernatant by a micropipette and discard.
6. Add 200 µL of Streptavidin Wash Buffer 1. Suspend beads by pipetting up and down
until beads are completely resuspended.
7. Place the tube in a magnetic rack. Allow beads to settle and carefully remove the
supernatant by a micropipette and discard.
8. Repeat steps 6-7.
9. Add 200 µL of Streptavidin Wash Buffer 2. Suspend beads by vortexing and spin briefly
to collect drops.
10. Place the tube in a magnetic rack. Allow beads to settle and carefully remove supernatant
by a micropipette and discard.
11. Repeat steps 9-10.
12. Resuspend beads in 50 µL of nuclease-free water. Incubate at 70 °C for 5 min (water bath
is recommended for maximum performance).
13. Spin the tube briefly to collect drops and place the tube in a magnetic rack. Allow beads to
settle and collect solution of the enriched DNA.
14. Use the enriched 5-hmC DNA for downstream analysis.
9
SUPPLEMENTARY PROTOCOLS
DNA fragmentation
To get the best results of the 5-hmC DNA enrichment genomic DNA should be fragmented to
the 200-600 bp size fragments before the enrichment procedure. A number of different
methods could be used to fragment the sample DNA. Mechanical DNA fragmentation by
ultrasound is a fast and efficient method that generates random DNA fragments for further
analysis. Below are some recommendations for ultrasound fragmentation of genomic DNA.
Recommendations for DNA sonication:
a. Dilute genomic DNA to 100-250 ng/µL in TE buffer (refer to your sonication device manual
for optimal concentration and volume).
b. Place the DNA in the ice bath and proceed with the sonication step.
c. Follow recommendations provided by the sonication device. The optimal cycling conditions
and amplitude depends on the instrument and must be determined experimentally.
Sonicated DNA is ready for the enrichment procedure without need for additional purification. It
is recommended to run a small sample (50-100 ng) of the fragmented DNA on a 1-2% agarose
gel. The mean size of DNA fragments should be 200-600 bp long if the enriched DNA will be
used for qPCR analysis. If needed, the adapter sequences for sequencing should be added
after DNA fragmentation before proceeding with the 5-hmC DNA enrichment protocol.
Using Control DNA for the assessment of kit performance
To assess performance of the kit, the control DNA yield and enrichment level are determined
as described below. The unmodified control DNA is used as a measure of background
(unspecific DNA) to calculate the enrichment levels of the 5-hmC control DNA in the same
sample (thus, no enzyme control sample is not required).
1. Prepare the control DNA sample:
Component Volume
4X Enzyme Reaction Buffer 12.5 µL
5-hmC Control DNA 1 µL
Control DNA (unmodified) 2 µL
5-hmC Modifying Enzyme 10 µL
Water, nuclease-free 24.5 µL
Total volume 50 µL
2. Enrich the control sample for 5-hmC containing DNA as described in the main protocol
(pages 6-8).
3. Dilute the enriched control DNA sample 100 fold and use 2 µL for qPCR
(see below, step 6).
4. Prepare a master mix solution for a standard curve:
Component Volume
5-hmC Control DNA 1 µL
Control DNA (unmodified) 2 µL
TE pH 7.6 or water 47 µL
10
5. Dilute the master mix solution for a standard curve with TE pH 7.6 buffer or water according to the table:
Dilution step 1 2 3 4 5 6
DNA
concentrati
on
5-hmC
Control DNA 10 pg/µL 1 pg/µL 0.1 pg/µL 0.01 g/µL 1 fg/µL 0.1 fg/µL
Control DNA
(unmodified)
1000
pg/µL
100
pg/µL 10 pg/µL 1 pg/µL 0.1 pg/µL 0.01 g/µL
Master mix diluted, fold 20 200 2000 20,000 200,000 2,000,000
Notes:
Since the Cq values depend on the sensitivity of the qPCR reagents and instrument used,
for a standard curve preparation use the dilutions that generate Cq values starting form ~ 10
for the first dilution point used.
For standard curve preparation for 5-hmC Control DNA use dilutions 1-5.
For standard curve preparation for Control DNA (unmodified) use dilutions 2-6.
6. Prepare two qPCR master mixes for each control DNA (Control DNA (unmodified) and
5-hmC Control DNA). Below is a suggestion of qPCR setup using Thermo Scientific™
Maxima™ SYBR Green/ROX qPCR Master Mix.
Maxima SYBR Green/ROX qPCR Master Mix (2X) (cat. #K0221/2/3) 12.5 µL
Primer Mix* 1.5 µL
Diluted DNA** 2 µL
Water, nuclease-free 9 µL
Total volume 25 µL *use Primer Mix for 5-hmC Control DNA and Primer Mix for Control DNA (unmodified) for specific (containing
5-hmC) and non-specific DNA enrichment quantification, respectively.
** 2 µL of each standard curve dilution or 2 µL of the enriched control sample dilution (100-fold dilution,
enriched control DNA from step 3).
Note: prepare no template control qPCR reaction by substituting water for DNA template to assess contamination of qPCR reaction.
7. Run the qPCR using following cycling conditions:
Step Temperature, C Time Number of Cycles
Initial denaturation 95 10 min 1
Denaturation 95 15 s 40
Annealing/ Extension 60 60 s
8. Plot Cq values versus log DNA amount (pg) for the standard dilution series and use the
standard curve to determine the amount of control DNA after enrichment. Fit the Cq vs log
DNA amount points to a y = mx + b regression and substitute the Cq values of the control
molecules for y to solve for x. Take the inverse log of x to find the amount (pg) of the
enriched control samples in the qPCR reaction. Alternatively, use the real-time thermal
cycler software to calculate the amount of the enriched DNA automatically.
9. Find the yield and fold enrichment using the following equations.
The Yield (% of starting amount) of 5-hmC Control DNA:
11
Where:
Henriched is the amount (pg) of the enriched 5-hmC Control DNA determined by the qPCR
standard curve in step 8;
d is the qPCR dilution factor of the template (d = 2500 when 2 µL of 100-fold diluted template
are used for qPCR);
Hinput is the total amount of 5-hmC Control DNA used for 5-hmC DNA enrichment (10 ng).
For example, if the estimated quantity of the 5-hmC DNA after enrichment procedure is 0.8 pg
(in 2 µL used for qPCR) then:
Note: Yield of the 5-hmC Control DNA should be at least 20% (2 ng out of 10 ng).
Yield of unmodified control DNA can be calculated using the same equation, substituting
1,000,000 pg for Hinput. The yield of unmodified control DNA should not exceed 0.3% (3 ng out
of 1000 ng).
The Fold Enrichment (the ratio of unmodified DNA to 5-hmC modified DNA before and after
5-hmC DNA enrichment) of a sample can be calculated using the following equation:
Where:
Uinput is the total amount of Control DNA (unmodified) used for 5-hmC enrichment (1000 ng);
Hinput is the total amount of 5-hmC Control DNA used for 5-hmC DNA enrichment
(10 ng);
Uenriched is the amount of Control DNA (unmodified) after 5-hmC DNA enrichment determined
by the qPCR standard curve;
Henriched is the amount of 5-hmC Control DNA after 5-hmC DNA enrichment determined by the
qPCR standard curve.
For example, if estimated quantities after 5-hmC DNA enrichment procedure for 5-hmC
Control DNA is 0.8 pg (in 2 µL used for qPCR) and for Control DNA (unmodified) is
0.5 pg (in 2 µL used for qPCR) then:
fold
Note: The enrichment level of the 5-hmC modified DNA over the unmodified DNA control is
expected to be more than 50 fold.
12
qPCR and data analysis of enriched genomic DNA sample
Guidelines for primer design:
For effective detection of 5-hmC containing DNA by qPCR, locus-specific primers must be used.
Primers should flank the CpG region of interest and the amplicon size for qPCR should be
70-150 bp.
To design appropriate primers, use primer design software or follow the general
recommendations outlined below:
Primer GC content: 30-60%.
Primer length: 18-30 nucleotides.
Optimal primer melting temperature (Tm): 60 °C. Differences in Tm of the two primers
should not exceed 2 °C. Primers designed with Tm 60 °C can be run together with control
DNA reactions.
Avoid more than two G or C nucleotides in last five nucleotides at 3'-end of the primer to
lower the risk of nonspecific priming.
Avoid designing primers around secondary structures in the amplicon.
Avoid primer self-complementarities and direct repeats in a primer to prevent hairpin
formation and primer dimerization.
When designing a new assay, it is recommended to verify the PCR product specificity by
gel electrophoresis, as melting temperatures of a specific product and primer-dimers may
overlap depending on the sequence composition.
It is advised to determine the efficiency of the PCR primers by performing a standard curve.
For best performance, use primers that have 90% - 110% efficiency and R2 value ≥ 0.995.
Guidelines for qPCR analysis:
Use 2-5 µL of the enriched genomic DNA and follow the manufacturer’s recommendations
for qPCR reaction setup.
Use 2-5 µL of the enriched no enzyme control DNA sample (see page 6) for qPCR reaction
setup.
During qPCR setup, it is important to avoid DNA cross-contamination. We recommend
using a dedicated set of pipettes for qPCR to minimize the risk of contamination.
The accuracy of qPCR is highly dependent on accurate pipetting and thorough mixing of
individual reaction components. Take extra care to avoid pipetting errors during qPCR setup
and when preparing templates for qPCR. Use of 3 technical replicates is highly recommended.
Standard curve should be prepared using sample DNA before enrichment (input DNA). For
the best results dilute the DNA in TE pH 7.6 buffer or water. Use at least 5 standard curve
points, each diluted 5 or 10 times, starting from ~ 10 ng (if 1 µg was used for input DNA).
See pages 9-10 for an example of preparation of a master mix solution and dilutions for the
standard curve. A standard curve needs to be prepared for each primer set.
Enriched DNA samples can be diluted 5-100 fold to avoid qPCR inhibition due to genomic
DNA impurities or for analysis of multiple loci in the same sample. If small amounts of DNA
are expected after 5-hmC DNA enrichment, use a non-diluted sample for qPCR.
13
1. The parameters below are recommended for qPCR using Thermo Scientific Maxima SYBR
Green/ROX qPCR Master Mix (2X) (cat #K0221/2/3). To minimize the possibility of pipetting
errors, prepare a reaction master mix by adding the following components (excluding
template DNA) for all 25 µL reactions to a single tube at room temperature:
Maxima SYBR Green/ROX qPCR Master Mix (2X) 12.5 µL
Primer Forward 0.3 µM
Primer Reverse 0.3 µM
Template DNA* 2-5 µL
Water, nuclease-free to 25 µL
Total volume 25 µL
*Add 2 µL of sample DNA before enrichment (at least 5 dilution steps in TE pH 7.6 buffer or water) for a
standard curve preparation or 2-5 µL of the enriched sample or enriched no enzyme control sample DNA.
2. Mix the reaction master mix thoroughly and dispense the desired volume into PCR tubes or
plates and add the sample as the last component.
3. Program the thermal cycler according to the recommendations below:
Step Temperature, C Time Number of
Cycles
Initial denaturation 95 10 min 1
Denaturation 95 15 s
40 Annealing* X 30 s
Extension 72 30 s * use the optimal annealing temperature for your primer pair.
Use two-step cycling protocol, if the optimal annealing temperature for your primer pair is 60°C
Step Temperature, C Time Number of
Cycles
Initial denaturation 95 10 min 1
Denaturation 95 15 s 40
Annealing/extension 60 60 s
4. Plot Cq values versus Log DNA amount (ng) for the standard dilution series and use the
standard curve to determine the amount of DNA molecules in the sample after enrichment.
Fit the Cq vs log DNA amount points to a y = mx + b regression and substitute the Cq
values of the samples for y to solve for x. Take the inverse log of x to find the amount (ng)
of the enriched samples in the qPCR reaction. Find the yield and fold enrichment using the
following equations. Alternatively, use the real-time thermal cycler software to calculate the
amount of the enriched DNA automatically.
14
The Yield (% of starting amount) of the 5-hmC containing sample DNA can be calculated
using the following equation:
Where:
is the amount of DNA after 5-hmC DNA enrichment, determined by the qPCR
standard curve, multiplied by a dilution factor d;
is the total amount of fragmented genomic DNA used for the 5-hmC DNA enrichment.
For example, 1 µg of human brain DNA was enriched for the 5-hmC DNA. The enriched DNA
was diluted 10X and 2 µL were used for qPCR (dilution factor of 250). The amount of the
enriched 5-hmC DNA determined by the qPCR standard curve was 0.8 ng. The yield of the
locus of interest is:
Note: Yield of the enriched 5-hmC DNA will depend on sample DNA used. It may vary both for
the same locus of DNA extracted from various tissues and for different loci of the same DNA.
Yield of the no enzyme control DNA sample will be also depended on the origin of sample
DNA and can reach 0.5-1.6%.
The Fold Enrichment (the ratio of test DNA sample and no enzyme control DNA after
enrichment) of a sample can be calculated using the following equation:
Where:
is the amount of the enriched sample DNA determined by qPCR multiplied by
qPCR dilution factor d1;
is the amount of the enriched no enzyme control sample DNA determined by
qPCR and multiplied by qPCR dilution factor d2.
For example, 1 µg of human brain DNA was used for 5-hmC containing DNA enrichment.
Both positive (enzymatic DNA modification reaction with 5-hmC Modifying Enzyme) and no
enzyme control DNA enrichments were prepared using the same template amount. The
enriched DNA samples were diluted 10X and 2 µL were used for qPCR (dilution factor of 250).
The amount of the enriched 5-hmC DNA was determined as 0.8 ng while the enriched no
enzyme DNA sample resulted in 0.04 ng of DNA. The enrichment of the locus of interest is
calculated:
15
APPENDIX
Control DNA and primer DNA sequences
5-hmC Control DNA sequence:
CGACCGAGTTGCTCTTGCCC*GGCGTCAACACGGGATAATACCGCGCCACATAGCAGAA
CTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACC
GCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTT
ACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGA
ATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCAT
TTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAA
TAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTA
TCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCTC
ATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAA
CGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTC
ACCCTGGATGCTGTAGGCATAGGCTTGGTTATG C* – 5-hydroxymethylcytosine; primer complementarity sequences underlined.
Sequences of 5-hmC Control DNA primers:
Primer 1: 5'-CATAACCAAGCCTATGCCTACAG-3'
Primer 2: 5'-GCAGTCAGGCACCGTGTATG-3'
Control DNA (unmodified) sequence:
CCTGAAGTCCGGCTGGAGTGAGTGGGAAGAGAGCGCCACGGACAGTATGTCGCAGGTA
AAAAGTGCAGCCACGCAGACCTTTGATGGTATTGCACAGAATATGGCGGCGATGCTGAC
CGGCAGTGAGCAGAACTGGCGCAGCTTCACCCGTTCCGTGCTGTCCATGATGACAGAAA
TTCTGCTTAAGGGTTGTTTGACTAGTGCCTCTACTGCATGGGGGGCCAGAATGACTAGTG
GCTGTCCCATGGTTAGCTTGCCTGCATCCTTTGTCAGTACGGCAATGGCTGCTACCATCC
GTAGGCAAGGGGGCCACCCAGCTGCTACTGGGTCTAGCTTTTTGGACAGGTAGGCCACC
GGCCGACGCCAAGGTCCCAGTTTTTGCGTTAGGACACCTTTGGCGTAGCCCTGCTTCTC
GTCGACAAAGAGTTCAAAGGGCTTAGTCAAATCTGGCAACCCCAGGGCTGGGGCAGTTA
GAAGAGCTTGCTTGATTTCTTGATAGG
Sequences of Control DNA (unmodified) primers:
Primer 1: 5'-GTCTAGCTTTTTGGACAGGTAGG-3'
Primer 2: 5'-CTGGGGTTGCCAGATTTGAC-3'
16
TROUBLESHOOTING
Problem Cause and Solution
Low yield of
the 5-hmC
containing
DNA
No 5-hmC modification at the locus.
Use Thermo ScientificTM EpiJETTM 5-hmC Analysis Kit (cat. #K1481) to
determine 5-hmC modification levels at CCGG sequences of the desired
locus.
Poor performance of 5-hmC Modifying Enzyme and/or Biotin Reagent.
Check if 5-hmC control DNA yield is > 20%;
Make sure that DNA fragmentation was adequate (after sonication DNA
fragments should be 200-600 bp long);
Check for storage duration and conditions. Replace with fresh materials, if
needed.
Poor performance of Streptavidin Magnetic Beads.
Make sure beads are completely suspended before use;
If needed, use ultrasound bath for suspending;
Avoid losing beads during wash steps;
Avoid drying the beads during washes and elution.
Low purity of genomic DNA used.
For high quality genomic DNA purification use commercially available gDNA
purification kits, such as Thermo Scientific GeneJET Genomic DNA
Purification Kit (cat. #K0721/2).
Poor
enrichment of
5-hmC
containing
DNA
Improper reaction setup.
Check that control reaction exhibits 50-fold enrichment level;
The 5-hmC Modifying Enzyme should always be the last component added to
the reaction mixture;
It is critical not to extend biotin conjugation for more than 5 min (Biotin
Conjugation, step C4);
Check for reagent storage duration and conditions and replace with fresh
materials, if needed.
Incomplete detachment of enriched DNA from beads.
Avoid leaving beads for a prolonged time after heating with water (5-hmC
DNA Separation, step E12).
Pipetting errors.
The accuracy of qPCR is highly dependent on accurate pipetting and thorough
mixing of individual reaction components. Take extra care to avoid pipetting
errors during qPCR setup and when preparing templates for qPCR.
17
SAFETY INFORMATION
Column Binding Buffer
Warning
Hazard statements: H302 Harmful if swallowed. H315 Causes skin irritation H319 Causes serious eye irritation.
Precautionary statements: P280 Wear protective gloves/protective clothing/eye protection/face protection. P305+P351+P338 IF IN EYES: Rinse cautiously with water for several minutes. Remove contact lenses, if present and easy to do. Continue rinsing. P321 Specific treatment (see on this label). P362 Take off contaminated clothing and wash before reuse. P301+P312 IF SWALLOWED: Call a POISON CENTER or doctor/physician if you feel unwell. P501 Dispose of contents/container in accordance with local/regional/national/international regulations.
LIMITED USE LABEL LICENSE: Internal Research and Development Use Only. The purchase of this product conveys to the buyer the limited, non-exclusive, non-transferable right (without the right to resell, repackage, or further sublicense) to use this product for internal research and development purposes. No other license is granted to the buyer whether expressly, by implication, by estoppel or otherwise. In particular, the purchase of the product does not include or carry any right or license to use, develop, or otherwise exploit this product commercially and no rights are conveyed to the buyer to use the product or components of the product for purposes including but not limited to provision of services to a third party, generation of commercial databases or clinical diagnostics. This product is sold pursuant to authorization from Thermo Fisher Scientific and Thermo Fisher Scientific reserves all other rights. For information on purchasing a license for uses other than internal research and development purposes, please contact [email protected] or Out Licensing, Life Technologies Inc., 5791 Van Allen Way, Carlsbad, California 92008.
PRODUCT USE LIMITATION
This product is developed, designed and sold exclusively for research purposes and in vitro use only. The
product was not tested for use in diagnostics or for drug development, nor is it suitable for administration to
humans or animals. Please refer to www.thermoscientific.com/onebio for Material Safety Data Sheet of the
product.
© 2015 Thermo Fisher Scientific, Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific, Inc. and its subsidiaries. This information is not intended to encourage use of these products in any manner that might infringe the intellectual property rights of others.
