Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.
-
Upload
lydia-morgan -
Category
Documents
-
view
216 -
download
0
Transcript of Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.
![Page 1: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/1.jpg)
Principles of PathogenesisBacterial Infection
Professor Mark PallenUniversity of Birmingham
![Page 2: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/2.jpg)
Microbes and humans
Very few microbes arealways pathogenic
Many microbes arepotentially pathogenic
Most microbes arenever pathogenic
![Page 3: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/3.jpg)
Microbes and humans
Disease can come about in several overlapping ways1. Some bacteria are entirely adapted to the pathogenic way
of life in humans. They are never part of the normal flora but may cause subclinical infection, e.g. M . tuberculosis
2. Some bacteria which are part of the normal flora acquire extra virulence factors making them pathogenic, e.g. E. coli
3. Some bacteria from the normal flora can cause disease if they gain access to deep tissues by trauma, surgery, lines, especially if associated with a foreign body, e.g. S. epidermidis
4. In immunocompromised patients many free-living bacteria and components of the normal flora can cause disease, especially if introduced into deep tissues, e.g. Acinetobacter
![Page 4: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/4.jpg)
How do we know that a given pathogen causes a specific
disease?• Koch's postulates
– the pathogen must be present in every case of the disease
– the pathogen must be isolated from the diseased host & grown in pure culture
– the specific disease must be reproduced when a pure culture of the pathogen is inoculated into a healthy susceptible host
– the pathogen must be recoverable from the experimentally infected host
![Page 5: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/5.jpg)
Spectrum of virulence
poliomyelitis in a child0.1-1% of infections are clinically apparent
rubella50% of infections are clinically apparent
rabies100% of infections are clinically apparent
The iceberg concept of infectious disease
asymptomatic infection
classical clinical disease
less severe disease
![Page 6: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/6.jpg)
potential pathogen isolated from or
detected in clinical samples
Recognised syndromes
patient's clinical condition
e.g. septicaemia, endocarditis,osteomyelitis meningitis,UTI, pneumoniapharyngitis
How do we know that a given pathogen causes a specific disease?
Diagnosis and effective treatment of infection depends not just on isolating an organism, but in establishing a plausible
link between the laboratory findings, recognised syndromes and the patient's
clinical condition
![Page 7: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/7.jpg)
Microbes and humans
• Evidence for a potential pathogen being clinical significant (particularly for bacteria)– Isolated in abundance– Isolated in pure culture– Isolated on more than one occasion– Isolated from deep tissues – Evidence of local inflammation– Evidence of immune response to pathogen– Fits with clinical picture
![Page 8: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/8.jpg)
Normal flora• All body surfaces possess a rich normal bacterial flora,
especially the mouth, nose, gingival crevice, large bowel, skin– This can be a nuisance in that
• it can contaminate specimens• it can cause disease
– This is beneficial in that• it can protect against infection by preventing pathogens
colonising epithelial surfaces (colonisation resistance)• removal of the normal flora with antibiotics can cause
superinfection, usually with resistant microbes
• Endogenous viruses reside in the human genome– worries about similar pig viruses in xenografts
![Page 9: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/9.jpg)
Bacterial Virulence A simplistic view
• Some bacterial proteins (“exotoxins”) can elicit the features of a bacterial infection when injected as pure proteins, e.g. – tetanus toxin, botulinum toxin– diphtheria toxin, anthrax toxin
• Vaccination with inactivated toxins (“toxoids”) led to a spectacular decline in the incidence of many bacterial infections.
• Leading to the simplistic idea that all bacteria need to cause disease is a single toxin…
![Page 10: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/10.jpg)
Bacterial Virulence A more sophisticated view
• There are many different ways to define a “virulence factor”…
• needed to colonise and/or damage tissues– “Molecular Koch’s postulates”
• Delete gene, show loss of virulence in model system, add gene back (e.g. on plasmid), show restoration of virulence
– Biochemical evidence of damaging potential
• distinguishes pathogen from commensal• Comparative genomics
• expressed or essential in vivo……but not in the lab?
![Page 11: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/11.jpg)
Bacterial Virulence A more sophisticated view
• Virulence as a process is– MULTIFACTORIAL
• A bacterial army, like a human army, needs more than just its firearms to enter and secure enemy territory…
“An army marches on its stomach” Napoleon
– MULTIDIMENSIONAL• A programme of events organised in time and space
![Page 12: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/12.jpg)
Steps in successful infection
• Sex comes before disease– acquire virulence genes
• Sense environment
– and Switch virulence genes on and off
• Swim to site of infection
• Stick to site of infection
• Scavenge nutrients– especially iron
• Survive stress
• Stealth– avoid immune system
• Strike-back – damage host tissues
• Subvert– host cell cytoskeletal and
signalling pathways
• Spread – through cells and organs
• Scatter
![Page 13: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/13.jpg)
Bacterial Sex acquiring virulence genes
• Bacteria have three ways of exchanging DNA– Transformation
• cells take up naked DNA
– Transduction • phages carry DNA
– Conjugation• cells mate through
specialised appendages
![Page 14: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/14.jpg)
Bacterial Sex Mobile genetic elements
• Transposons– ST enterotoxin genes
• Virulence Plasmids– e.g. TTSSs in Shigella,
Yersinia; toxins in Salmonella, E. coli, anthrax
• Phage-encoded virulence– e.g. botulinum toxins,
diphtheria toxin, shiga-like toxin (linked to lysis), staphylococcal toxins, TTSS substrates in Salmonella.
![Page 15: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/15.jpg)
Bacterial Sex Pathogenicity Islands
• Concept originated from study of uropathogenic E. coli strains
• Defining Features – Carriage of (many) virulence genes– Presence in pathogenic versus non-pathogenic
strains– Different G+C content from host chromosome– Occupy large chromosomal regions (10-100 Kb)– Compact distinct genetic units, often flanked by DRs,
tRNAs, ISs– Presence of (cryptic) mobility genes– Unstable, prone to deletion
![Page 16: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/16.jpg)
Bacterial Sex Pathogenicity Islands
• often encode secretion systems– LEE region in EPEC– Spi1, Spi2 in Salmonella– Cag in H. pylori
• can also encode adhesins, siderophores, toxins – Uropathogenic E. coli (Pai I, II, IV, V)– Yersinia spp. (HPI)– V. cholerae (VPI or TCP-ACF element)
![Page 17: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/17.jpg)
Sense environment
• Bacteria can sense changes in environment – e.g. in temperature, nutrient availability, osmolarity, cell
density (“quorum sensing”).• In simplest cases, change in intracellular concentration
of ion linked directly to gene expression– e.g. fall in intra-cellular iron levels triggers de-repression of
diphtheria toxin gene • In more complex cases, sophisticated signal
transduction cascades allow bacteria to regulate gene expression in response to environmental cues– the pathogen as an information processor
![Page 18: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/18.jpg)
Switch virulence factors on and offA multi-layered hierarchy
• Changes in DNA sequence– Gene amplification– Genetic rearrangements
• e.g. Hin flip-flop control of flagellar phase variation
• Transcriptional Regulation– Activators and
Repressors(helix-turn-helix motif)
– mRNA folding and stability
• Translational Regulation• Post-translational
Regulation– Stability of protein,
controlled cleavage– Covalent modifications
• e.g. phosphorylation in two-component sensor-regulator systems
![Page 19: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/19.jpg)
Swim
• Many bacterial pathogens are motile– Enterics, Campylobacter,
Helicobacter, spirochaetes
• Motility crucial for virulence in some cases
• Usual organelle of motility=flagellum
• Variants– Twitching motility– Swarming
![Page 20: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/20.jpg)
Stick
• To avoid physical and immunological removal, bacteria must adhere to– cell surfaces and
extracellular matrixe.g. in respiratory, gastrointestinal and genitourinary tracts
– solid surfacese.g. teeth, heart valves, prosthetic material
– other bacteria
• Direct interaction• Molecular bridging via
e.g. fibronectin• Adherence often
combined with manipulation of host cell signalling and cytoskeleton– Invasion– Intimate adherence
![Page 21: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/21.jpg)
Stick
• Common adherence mechanisms– Capsules and slime– Biofilm formation
• Gram-positive adhesins– MSCRAMMs (microbial surface components recognizing
adhesive matrix molecules), e.g. protein A– Fimbriae
• Gram-negative adhesins (CHO and protein receptors)– Fimbriae, Afimbrial adhesins (FHA, Pertactin etc.)– Outer Membrane Proteins – Types III-IV secretion
![Page 22: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/22.jpg)
Stick
![Page 23: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/23.jpg)
Scavenge nutrientse.g. iron
• Free iron levels very low in body fluids– Acute phase response causes further drop – Iron overload increases susceptibility to infection
• Many different bacterial systems for scavenging iron– Siderophores chelate available iron & transport it into bacteria– Iron can be scavenged direct from host iron-binding proteins, e.g
by lactoferrin-binding proteins– Often co-ordinately regulated e.g. by fur locus in E. coli– Some pathogens avoid the problem by cutting out need for iron,
e.g. Treponema pallidum• Iron used to regulate aggressive virulence factors
– Diphtheria toxin (DtxR repressor)– Shiga-like toxin– Pseudomonas aeruginosa exotoxin A
![Page 24: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/24.jpg)
Survive Stress
• In addition to nutrient-limitation stress, pathogens face many other stresses– Acid stress within stomach– Heat shock during fever– Oxidative stress within phagocytes
• Stress response proteins, such as chaperonins feature as immunodominant antigens
• Detoxification proteins play a role in virulence, e.g. periplasmic Cu,Zn-superoxide dismutases
• Infectious dose for enteric pathogens much lower in achlorhydria (no need to overcome acid stress)
![Page 25: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/25.jpg)
Stealthavoid immune system
• IgA proteases– metalloproteases active against IgA
• Immunoglobulin-binding proteins– e.g. protein A of S. aureus
• Resist complement, opsonisation – Capsule (usually polysaccharide)– Lipopolysaccharide– Surface proteins and OMPs
• Antigenic mimicry– e.g. sialic acid capsule of group B meningococcus
![Page 26: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/26.jpg)
Stealthavoid immune system
• Antigenic or phase variation– Involves surface
structures such as proteins, LPS, capsules
– Variety of mechanisms• slip-strand mispairing• flip-flop• cassettes
• Adopt cryptic niche– inside phagocytes– in biofilm
67700 67710 67720GAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAATGAAGTGCATTTAACTTGGGGGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT****GGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAAT
Homopolymeric tract in Campylobacter jejuni
![Page 27: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/27.jpg)
Strike-back Damage host tissues
• Endotoxin• Exotoxins
– Toxins acting on cell membranes– Toxins active inside cells– Superantigens
![Page 28: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/28.jpg)
Endotoxin of Gram-negatives
cytopl. mem.
peptidoglycan
outer mem.
Gram-negative
cell
Lipid A Core polysaccharide
O sidechain
The toxic partHelps solubilise Lipid A Somatic antigen
Lipopolysaccharide(LPS)
![Page 29: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/29.jpg)
Strike-back Endotoxin
• Actions of Endotoxin – Pyrogenicity– Leucopenia then leucocytosis– Hypotension
• “Gram-negative Shock”• Life-threatening complication of septicaemia• e.g. in meningococcal infection, in ITU or oncology
patients• Endotoxic shock seen with dirty intravenous equipment
• Most of the effects of endotoxin are mediated by tumour necrosis factor– Attempts at therapy using anti-endotoxin or anti-TNF
antibodies
![Page 30: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/30.jpg)
Strike-back Membrane-Damaging Exotoxins
• Many bacterial toxins form pores in eukaryotic cell membranes, producing oligomeric rings, e.g. – streptolysin O of
Streptococcus pyogenes– listeriolysin of Listeria
monocytogenes– alpha-toxin of S. aureus
• Other toxins, such as phospholipases, degrade components of the membrane– e.g. Clostridium perfringens
alpha toxin
LYSIS!LYSIS!
![Page 31: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/31.jpg)
Strike-back Toxins active inside cells
• Toxins often consist of translocation and binding B subunit that delivers the active A subunit into the host cell cytoplasm
• Example of AB toxin: diphtheria toxinan ADP-ribosyltransferase
![Page 32: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/32.jpg)
AB5 Toxins
![Page 33: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/33.jpg)
Subvert
• inject proteins into host cells to subvert the cytoskeleton and signal-transduction pathways: – manipulating e.g. Rho GTPases and the cytoskeleton
to induce membrane ruffling and bacterial invasion– preventing uptake by phagocytic cells, e.g. Yersinia
spp. and Pseudomonas spp. – remaining within a vacuole by manipulating host cell
vesicular transport and endocytosis
![Page 34: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/34.jpg)
Spread
…through cells and organs:• within macrophages, e.g.
in typhoid• through blood (need to
be complement-resistant)
• within cells– actin-based motility of
Listeria monocyogenes, depends on ActA protein.
![Page 35: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/35.jpg)
ScatterTransmission, virulence and
evolution• Established dogmas
– balanced pathogenicity
– being too virulent is no good
– high virulence is a sign of recent emergence of a pathogen
– pathogens evolve towards symbiosis
• Counter-arguments– Where pathogens rely on
spread through biting arthopods, high bacteraemias advantageous
– Where pathogens rely on shedding into water, highest possible shedding rates good for pathogen
– Where pathogens cause incidental disease (e.g. Legionella) no selective pressure towards low virulence
– Virulence as a local adaptation (why meningitis?)
– Bad vaccines and effect on virulence
![Page 36: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/36.jpg)
Summary
• Spectrum of virulence– Commensals– Potential pathogens– Obligate pathogens
• Difficulties in linking pathogen to disease– Koch’s postulates
• Multi-dimensional view of virulence
• Sex • Sense • Switch• Swim• Stick• Scavenge • Survive stress• Stealth• Strike-back • Subvert• Spread • Scatter
![Page 37: Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham.](https://reader036.fdocuments.in/reader036/viewer/2022062804/56649db05503460f94a9ddbb/html5/thumbnails/37.jpg)
Further Reading
Bacterial Pathogenesis: A Molecular approach, Salyers and Whitt
(2nd Ed if possible)
Cellular MicrobiologyCossart, Boquet,
Normark, Rappuoli