[Micro] pathogenesis
-
Upload
muhammad-ahmad -
Category
Documents
-
view
11 -
download
0
Transcript of [Micro] pathogenesis
![Page 1: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/1.jpg)
Principles of PathogenesisBacterial Infection
![Page 2: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/2.jpg)
Microbes and humans
Very few microbes arealways pathogenic
Many microbes arepotentially pathogenic
Most microbes arenever pathogenic
![Page 3: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/3.jpg)
Microbes and humans
Disease can come about in several overlapping ways1. PATHOGENS: Not normal flora subclinical infection (M
tuberculosis)2. Normal flora acquire extra virulence factors
to be pathogenic, e.g. E. coli3. Normal flora: Disease if they gain access to
deep tissues by trauma, surgery, lines, especially if a foreign body, e.g. S. epidermidis
4. In immunocompromised patients free-living bacteria & normal flora can cause disease, especially if introduced into deep tissues, e.g. Acinetobacter
![Page 4: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/4.jpg)
How do we know that a given pathogen causes a specific
disease?• Koch's postulates
– the pathogen must be present in every case of the disease
– the pathogen must be isolated from the diseased host & grown in pure culture
– the specific disease must be reproduced when a pure culture of the pathogen is inoculated into a healthy susceptible host
– the pathogen must be recoverable from the experimentally infected host
![Page 5: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/5.jpg)
Spectrum of virulence
poliomyelitis in a child0.1-1% of infections are clinically apparent
rubella50% of infections are clinically apparent
rabies100% of infections are clinically apparent
The iceberg concept of infectious disease
asymptomatic infection
classical clinical disease
less severe disease
![Page 6: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/6.jpg)
potential pathogen isolated from or
detected in clinical samples
Recognised syndromes
patient's clinical condition
e.g. septicaemia, endocarditis,osteomyelitis meningitis,UTI, pneumoniapharyngitis
How do we know that a given pathogen causes a specific
disease?Diagnosis and effective treatment of
infection depends not just on isolating an organism, but in establishing a plausible
link between the laboratory findings, recognised syndromes and the patient's
clinical condition
![Page 7: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/7.jpg)
Microbes and humans
• Evidence for a potential pathogen being clinical significant (particularly for bacteria)– Isolated in abundance– Isolated in pure culture– Isolated on more than one occasion– Isolated from deep tissues – Evidence of local inflammation– Evidence of immune response to pathogen– Fits with clinical picture
![Page 8: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/8.jpg)
Normal flora• All body surfaces possess a rich normal bacterial
flora, especially the mouth, nose, gingival crevice, large bowel, skin– This can be a nuisance in that
• it can contaminate specimens• it can cause disease
– This is beneficial in that• it can protect against infection by preventing pathogens colonising epithelial surfaces (colonisation resistance)
• removal of the normal flora with antibiotics can cause superinfection, usually with resistant microbes
• Endogenous viruses reside in the human genome– worries about similar pig viruses in xenografts
![Page 9: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/9.jpg)
Bacterial Virulence A simplistic view
• Some bacterial proteins (“exotoxins”) can elicit the features of a bacterial infection when injected as pure proteins, e.g. – tetanus toxin, botulinum toxin– diphtheria toxin, anthrax toxin
• Vaccination with inactivated toxins (“toxoids”) led to a spectacular decline in the incidence of many bacterial infections.
• Leading to the simplistic idea that all bacteria need to cause disease is a single toxin…
![Page 10: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/10.jpg)
Bacterial Virulence A more sophisticated view
• There are many different ways to define a “virulence factor”…
• needed to colonise and/or damage tissues– “Molecular Koch’s postulates”
• Delete gene, show loss of virulence in model system, add gene back (e.g. on plasmid), show restoration of virulence
– Biochemical evidence of damaging potential
• distinguishes pathogen from commensal• Comparative genomics
• expressed or essential in vivo……but not in the lab?
![Page 11: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/11.jpg)
Bacterial Virulence A more sophisticated view
• Virulence as a process is– MULTIFACTORIAL
•A bacterial army, like a human army, needs more than just its firearms to enter and secure enemy territory…“An army marches on its stomach” Napoleon
– MULTIDIMENSIONAL•A programme of events organised in time and space
![Page 12: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/12.jpg)
Steps in successful infection
• Sex comes before disease– acquire virulence genes
• Sense environment– and Switch virulence
genes on and off
• Swim to site of infection
• Stick to site of infection
• Scavenge nutrients– especially iron
• Survive stress
• Stealth– avoid immune system
• Strike-back – damage host tissues
• Subvert– host cell cytoskeletal
and signalling pathways
• Spread – through cells and
organs
• Scatter
![Page 13: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/13.jpg)
Bacterial Sex acquiring virulence genes
• Bacteria have three ways of exchanging DNA– Transformation
•cells take up naked DNA
– Transduction •phages carry DNA
– Conjugation•cells mate through specialised appendages
![Page 14: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/14.jpg)
Bacterial Mobile genetic elements
• Transposons– ST enterotoxin genes
• Virulence Plasmids– e.g. TTSSs in Shigella, Yersinia; toxins in Salmonella, E. coli, anthrax
• Phage-encoded virulence- botulinum toxin-diphtheria toxin,- shiga-like toxin(lysis),
-staphylococcal toxins, TTSS substrates in Salmonella.
![Page 15: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/15.jpg)
Bacterial Sex Pathogenicity Islands
• Concept from study of uropathogenic Ecoli strains
• Defining Features – Carriage of (many) virulence genes– Presence in pathogenic versus non-pathogenic strains
– Different G+C content from host chromosome– Occupy large chromosomal regions (10-100 Kb)– Compact distinct genetic units, often flanked by DRs, tRNAs, ISs
– Presence of (cryptic) mobility genes– Unstable, prone to deletion
![Page 16: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/16.jpg)
Bacterial Sex Pathogenicity Islands
• often encode secretion systems– LEE region in EPEC– Spi1, Spi2 in Salmonella– Cag in H. pylori
• can also encode adhesins, siderophores, toxins – Uropathogenic E. coli (Pai I, II, IV, V)
– Yersinia spp. (HPI)– V. cholerae (VPI or TCP-ACF element)
![Page 17: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/17.jpg)
Sense environment
• Bacteria can sense changes in environment – e.g. in temperature, nutrient availability, osmolarity, cell density (“quorum sensing”).
• In simplest cases, change in intracellular concentration of ion linked directly to gene expression– e.g. fall in intra-cellular iron levels triggers de-repression of diphtheria toxin gene
• In more complex cases, sophisticated signal transduction cascades allow bacteria to regulate gene expression in response to environmental cues– the pathogen as an information processor
![Page 18: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/18.jpg)
Switch virulence factors on and off
A multi-layered hierarchy• Changes in DNA sequence
– Gene amplification– Genetic rearrangements
• e.g. Hin flip-flop control of flagellar phase variation
• Transcriptional Regulation– Activators and Repressors(helix-turn-helix motif)
– mRNA folding and stability
• Translational Regulation
• Post-translational Regulation– Stability of protein, controlled cleavage
– Covalent modifications• e.g. phosphorylation in two-component sensor-regulator systems
![Page 19: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/19.jpg)
Swim
• MOTILE bacterial pathogens– Enterics, Campylobacter, Helicobacter, spirochaetes
• Motility crucial for virulence in some cases
• Usual organelle of motility=flagellum
• VariantTwitching motility– Swarming
![Page 20: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/20.jpg)
Stick
• To avoid physical and immunological removal, bacteria must adhere to– cell surfaces and extracellular matrixe.g. in respiratory, gastrointestinal and genitourinary tracts
– solid surfacese.g. teeth, heart valves, prosthetic material
– other bacteria
• Direct interaction• Molecular bridging via e.g. fibronectin
• Adherence often combined with manipulation of host cell signalling and cytoskeleton– Invasion– Intimate adherence
![Page 21: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/21.jpg)
Stick
• COMMON ADHERENCE MECHANISMS: - CAPSULES/SLIME
– BIOFILM FORMATION• GRAM POSITIVE ADHESINS
– MSCRAMMs (microbial surface components recognizing adhesive matrix molecules), e.g. PROTEIN A
– FIMBRIAE• GRAM NEGATIVE ADHESINS (CHO and protein receptors)
– Fimbriae, Afimbrial adhesins (FHA, Pertactin etc.)
– Outer Membrane Proteins – Types III-IV secretion
![Page 22: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/22.jpg)
Stick
![Page 23: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/23.jpg)
Scavenge nutrientse.g. iron
• FREE IRON LEVELS: very low in body fluids– Acute phase response causes further drop – Iron overload increases susceptibility to infect
• SCAVANGING IRON:– Siderophores chelate available iron & transport it into bacteria
– Iron can be scavenged direct from host iron-binding proteins, e.g by lactoferrin-binding prot
– Often co-ordinately regulated fur locus in Ecol cutting out need for iron, e.g. T pallidum
• Iron used to regulate aggressive virulence factors– Diphtheria toxin (DtxR repressor)– Shiga-like toxin– Pseudomonas aeruginosa exotoxin A
![Page 24: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/24.jpg)
Survive Stress
• nutrient-limitation stress, other stresses– Acid stress within stomach– Heat shock during fever– Oxidative stress within phagocytes
• Stress response proteins, such as chaperonins feature as immunodominant antigens
• Detoxification proteins play a role in virulence, e.g. periplasmic Cu,Zn-superoxide dismutases
• Infectious dose for enteric pathogens much lower in achlorhydria (no need to overcome acid stress)
![Page 25: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/25.jpg)
Stealthavoid immune system
• IgA proteases– metalloproteases active against IgA
• Immunoglobulin-binding proteins– e.g. protein A of S. aureus
• Resist complement, opsonisation – Capsule (usually polysaccharide)– Lipopolysaccharide– Surface proteins and OMPs
• Antigenic mimicry– e.g. sialic acid capsule of group B meningococcus
![Page 26: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/26.jpg)
Stealthavoid immune system
.Antigenic or phase varia– Involves surface structures as LPS proteins, capsules
– Variety of mechani .
– slip-strand mispair•flip-flop•cassettes
.Adopt cryptic niche in phagocytes
in biofilm
67700 67710 67720GAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAATGAAGTGCATTTAACTTGGGGGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT****GGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAAT
Homopolymeric tract in Campylobacter jejuni
![Page 27: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/27.jpg)
Strike-back Damage host tissues
• Endotoxin• Exotoxins
– Toxins acting on cell membranes– Toxins active inside cells– Superantigens
![Page 28: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/28.jpg)
Endotoxin of Gram-negatives
cytopl. mem.
peptidoglycan
outer mem.
Gram-negative
cell
Lipid A Core polysaccharide
O sidechain
The toxic partHelps solubilise Lipid A Somatic antigen
Lipopolysaccharide(LPS)
![Page 29: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/29.jpg)
Strike-back Endotoxin
• ENDOTOXIN EFFECTS: – PYROGENICITY– LEUCOPENIA,THEN LEUCOCYTOSIS– HYPOTENSION
• “Gram-negative Shock”• Life-threatening complication of septicaemia• e.g. in meningococcal infection, in ITU or oncology pts
• Endotoxic shock seen with dirty intravenous equipmen
Most effects of endotoxin mediated by tumour necrosis factor– THERAPY ATTEMPTS: ANTI-ENDOTOXIN– or ANTI TNF ANTIBODIES
![Page 30: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/30.jpg)
Strike-back Membrane-Damaging Exotoxins
TOXINS: 1.FORM PORES in
eukaryotic cell membranes, producing oligomeric rings,
-streptolysin O of S pyogenes
-listeriolysin of L monocytogenes
-alpha-toxin of S aureus2. DEGRADE CM as
phospholipases– e.g. Clostridium perfringens alpha toxin
LYSIS!LYSIS!
![Page 31: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/31.jpg)
Strike-back Toxins active inside cells
• Toxins consist of:• 1 translocation and binding B subunit that delivers the active A subunit into the host cell cytoplasm
• Example of AB toxin: diphtheria toxinan ADP-ribosyltransferase
![Page 32: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/32.jpg)
AB5 Toxins
![Page 33: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/33.jpg)
Subvert
• Inject proteins into host cells to subvert the cytoskeleton and signal-transduction pathways
-manipulating e.g. Rho GTPases and the cytoskeleton to induce membrane ruffling and bacterial invasion
-preventing uptake by Phagocytes e.g. Yersinia & Pseudomonas
-remaining within a vacuole by manipulating host cell vesicular transport & endocytosis
![Page 34: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/34.jpg)
Spread
…through CELLS & organs:
• In Macrophages, e.g. in typhoid
• Via BLOOD (need to be complement-resistant)
• within cells– actin-based motility of L monocyogenes, depends on ActA protein.
![Page 35: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/35.jpg)
ScatterTransmission, virulence and
evolution• Established dogmas– balanced pathogenicity
– being too virulent is no good
– high virulence is a sign of recent emergence of a pathogen
– pathogens evolve towards symbiosis
• Counter-argumentsWhere pathogens rely on spread
through biting arthopods, high bacteraemias advantageous
Where pathogens rely on shedding into water, highest possible shedding rates good for pathogen
Where pathogens cause incidenta disease (e.g. Legionella) no selective pressure towards low virulence– Virulence as a local
adaptation (why meningitis?)
– Bad vaccines and effect on virulence
![Page 36: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/36.jpg)
Summary
• Spectrum of virulence– Commensals– Potential pathogens
– Obligate pathogens• Difficulties in
linking pathogen to disease– Koch’s postulates
• Multi-dimensional view of virulence
• Sex • Sense • Switch• Swim• Stick• Scavenge • Survive
stress• Stealth• Strike-back • Subvert• Spread • Scatter
![Page 37: [Micro] pathogenesis](https://reader033.fdocuments.in/reader033/viewer/2022052603/55d6fc34bb61eb0d2b8b47a6/html5/thumbnails/37.jpg)
Further Reading
Bacterial Pathogenesis: A Molecular approach, Salyers and Whitt
(2nd Ed if possible)
Cellular MicrobiologyCossart, Boquet, Normark, Rappuoli