Practical Synthetic Biology

Practical Synthetic Biology

1. Plasmids - Hosting and transmitting

2. Restriction Enzymes - Cutting

3. Ligation - Joining

4. PCR - Fine resolution changes

5. Electrophoresis – Separating

Plasmids

Plasmids are natural small circular pieces of DNA that live autonomously inside cells (often in bacteria). They are useful because they can be easily isolated and manipulated.

They can vary in size from 1 to over 400 kilobase pairs and may exist in many copies in a single cell.

http://universe-review.ca/I10-71-plasmid.jpg

Plasmids often containgenes that confer aselective advantage,such as the abilityto be antibiotic resistant.

Plasmids are also easilytransferred to other bacteria.

Why Plasmids are Useful

In recombinant DNA, plasmid are called vectors and are used to transfergenes from one organism to another.

Typically plasmids are constructed to contain a genetic marker that allowsthem to be identified and selected for, many different kinds can be purchased.


Getting Plasmids into Cells

Chilling cells in the presence of divalent cations such as Ca2+ (in CaCl2) prepares the cell walls to become permeable to plasmid DNA. Cells are incubated with the DNA and then briefly heat shocked (42C for 30-120 seconds), which causes the DNA to enter the cell.

Electroporation is another way to make holes in cells, by briefly shocking them with an electric field of 100-200V/cm


Restriction Sites (Cutting)

http://www-math.mit.edu/~lippert/18.417/lectures/02_PartialDigest/

Restriction endonuclease are enzymes that will recognize, bind to and hydrolyze specific nucleic acid sequences in double-stranded DNA. Such sequences are often palindromic.

Restriction Sites (Cutting)Restriction endonuclease are enzymes that will recognize, bind to and hydrolyze specific nucleic acid sequences in double-stranded DNA. Such sequences are often palindromic.

GAGGATACCACCAGGGTTACAGGATAGGAGTCAGAATTCAGAGGACCTAGGATACCTC CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCTTAAGTCTCCTGGATCCTATGGAG

GAGGATACCACCAGGGTTACAGGATAGGAGTCAG AATTCAGAGGACCTAGGATACCTC CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCTTAA GTCTCCTGGATCCTATGGAG

Sticky Ends

Restriction enzymes evolved asa defense against viral infection.

EcoR1

DNA Ligation

Ligation (DNA ligase) – ‘sealing’ two sticky ends together

http://openwetware.org/

Plasmids - pBR322

Selectable Markers: Ampicillin Resistance (β-lactamase gene) and Tetracycline Resistance (tet gene).

pBR322 has many restriction sites making it a versatile plasmid.

If we add EcoR1 and HindII to a solution of pBR322 it will disrupt thetet gene.

Plasmids

http://www.mrothery.co.uk/genetech/genetechnotes.htm

PCR

PCR is a method toamplify DNA fragments.

By denaturing DNA and adding primers, new copiescan be made. In addition,by designing primersthat extend beyond the endit is possible to add newsequences to the DNA.

See Wikipedia for Detailed article.

Gel Electrophoresis

http://www.biologyreference.com/Dn-Ep/Electrophoresis.html

Gel electrophoresis is a method that separates (based on size, electrical charge and other physical properties) macromolecules such as nucleic acids or proteins.

In synthetic biology it can be used toseparate restriction fragmentswhich can then be sequenced toconfirm that the cloning wasSuccessful.

lac promoter

NdeI restricition site (CATATG)

Sal I restriction site (GTCGAC)

pBR322 plasmid with lac promoter

Double digest withNde I and Sal I

lac promoter

NdeI overhangSal I overhang

Nde I digestion

-CATATG--GTATAC-

-CA TATG--GTAT AC-

Sal I digestion

- GTCGAC -- GTCGAC -

- G TCGAC -- GTCGA C -

GFP gene

NdeI restricition site (CATATG)

Sal I restriction site (GTCGAC)

6 bp extension

6 bp extension

PCR Amplification

GFP gene with new restriction sites

Double digest withNde I and Sal I

lac promoter GFP

Ligation reaction

repeat process for lac I

Standard Assembly

http://parts.mit.edu/registry/index.php/Assembly:Standard_assembly

BioBricks have been designed to be assembled using normal cloning techniques. Two BioBrick parts, for example, one blue and one green, can be assembled into a blue-green system by a process called BioBrick Standard Assembly

Standard Assembly

http://biobricks.ai.mit.edu/Assembly/BB_Assembly.htm

Network Readout

Aequorea victoriaGreen fluorescent protein

Advantages:

1. Doesn’t require any other molecules to fluoresce.2. Relatively small, 238 amino acids (27 kDa)

Network Readout

Green fluorescent protein(GFP)

Red fluorescent protein

Cyan and Yellow

Network Readout

http://en.wikipedia.org/wiki/Image:FPbeachTsien.jpg

http://upload.wikimedia.org/wikipedia/en/7/7b/FPbeachTsien.jpg

Network Readout

http://www.jacobsschool.ucsd.edu/news/news_releases/release.sfe?id=518

Network Readout

Stochastic Dynamics

http://www.jacobsschool.ucsd.edu/news/news_releases/release.sfe?id=518

Stochastic Dynamics

Stochastic Dynamics

Experimental design for live-cell observations of gene expression. Tsr-Venus is expressed under the control of lac repressor, which binds tightly to the lac operator on DNA. Transcription of one mRNA by an RNA polymerase results from an infrequent and transient dissociation event of repressor from DNA. Multiple copies of protein molecules are translated from the mRNA by ribosomes. Upon being assembled into E. coli's inner membrane, Tsr-Venus protein molecules can be detected individually by a fluorescence microscope.

Venus is the name for the yellowfluorescent protein.

Stochastic Dynamics

Living E. coli cells were monitored for YFP fluorescence,

Probing Gene Expression in Live Cells, One Protein Molecule at a Time Ji Yu, Jie Xiao, Xiaojia Ren Kaiqin Lao X. Sunney Xie Science 17 March 2006:Vol. 311. no. 5767, pp. 1600 - 1603

Stochastic Dynamics

Dennis Bray, Cambridge

Stochastic Models

1. Determine when the next reaction will occur.

2. Determine which reaction will occur.

Simulating a stochastic model is quite different from anODE model. In a stochastic model we take account of individual reactions as they convert one molecule into another. Solving a stochastic model is a two stage process.

At each time point we must answer the following two questions:

The most well know implementation of this approach isthe Gillespie method (Gillespie, 1977).

Simulating a Simple System

Consider the following simple system:


1. Set t = 0, initialize concentrations (molecule numbers)

A = 50; B = 0; k1 = 0.1; k2 = 0.2;

2. Compute reaction probabilities for all reactions and compute the totalreaction probability, rtot


3. Generate two random numbers, p1 and p2 - urnd()

4. Compute the time of next reaction:

Tau is the time the next reaction will occur (units are time per molecule).

1. Determine when the next reaction will occur.


5. Compute the relative probability rates:


6. Compute which reaction will ‘fire’:

7. Update the current time:

8. Go back to step 2

0

20

40

60

80

100

120

0 2 4 6 8 10 12 14 16

Determine which reaction will occur.

Stochastic Algorithm(old notes)

The Direct Method of Gillespie:

1. Which Reaction occurs next?

2. When does the reaction occur?


Which Reaction occurs next?

1. Calculate all the rates of reaction, ri

2. Sum the rates to yield: H = sum (ri) (Note the units of H are molecules per unit time)

3. Normalize each ri with H, rin = ri/H

4. Obtain a random number from a uniform distribution (0 to 1.0) – urnd () in Jarnac

5. Use the random number to select which reaction fires.

r1n r2n r3n r4n

0 1.0

Stochastic Algorithm

When does the reaction occur?P

roba

bilit

y of

it o

ccur

ring

(p)

Most events occur soon, a few taken a long timeto occur, the likelihood of an event exponentially

decaying.

p(t) = exp (k t)

t = -ln (p)/k


When does the reaction occur?

1. Obtain a random number from a uniform distribution (0 to 1.0) r = urnd () in Jarnac

2. Calculate delta t = - ln (r) / H (exponential distribution)(Note that the units for this are time per molecule)

3. Update molecule numbers for the chosen reaction.


A <-> B

Let A = 10; B = 2k1 = 0.1; k2 = 0.2;


A <-> B

Let A = 10; B = 2k1 = 0.1; k2 = 0.2;

r1 = 1; r2 = 0.4;

H = 1.4; rn1 = 0.625; rn2 = 0.28;


A <-> B

Let A = 10; B = 2k1 = 0.1; k2 = 0.2;

r1 = 1; r2 = 0.4;

H = 1.4; rn1 = 0.625; rn2 = 0.28;

p1 = 0.4;


A <-> B

Let A = 10; B = 2k1 = 0.1; k2 = 0.2;

r1 = 1; r2 = 0.4;

H = 1.4; rn1 = 0.625; rn2 = 0.28;

p1 = 0.4;

Therefore the first reaction will occur (A -> B)

p2 = 0.7


A <-> B

Let A = 10; B = 2k1 = 0.1; k2 = 0.2;

r1 = 1; r2 = 0.4;

H = 1.4; rn1 = 0.625; rn2 = 0.28;

p1 = 0.4;


p2 = 0.7

dt = -ln (0.7)/1.4 = 0.25 secs


A <-> B

Let A = 10; B = 2k1 = 0.1; k2 = 0.2;

r1 = 1; r2 = 0.4;

H = 1.4; rn1 = 0.625; rn2 = 0.28;

p1 = 0.4;


p2 = 0.7

dt = -ln (0.7)/1.4 = 0.25 secs per molecule

A = A – 1; B = B + 1; t = t + dt

Practical Synthetic Biology

Documents

Transcript of Practical Synthetic Biology