IGEM Synthetic Biology
-
Upload
amalia-heryani -
Category
Documents
-
view
240 -
download
1
description
Transcript of IGEM Synthetic Biology
Synthetic Biology
Sergio Peisajovich
Lim Lab June 2007
Synthetic BiologyWhat is Synthetic Biology?
It is an emerging field of biology that aims at designing and building novel biological systems.
The final goal is to be able to design biological systems in the same way engineers design electronic or mechanical systems.
Synthetic BiologyWhy do we need it?
“What I cannot create, I do not understand.”
- Richard Feynman
Synthetic BiologyWhy do we need it?
Cells are the ultimate Chemical Factory.
Synthetic Biology
1- Biology is hierarchical
Is it achievable?
Synthetic Biology
2- Biology is Modular
Is it achievable?
Synthetic Biology
Hierarchy and Modular (recurrent) organization allows biology to be understandable and synthetic biology to be possible.
Is it achievable?
Synthetic BiologyA possible hierarchy for synthetic biology
Synthetic BiologyBiological Components: 1-Parts
Synthetic BiologyBiological Components: 2-Devices
Synthetic BiologyBiological Components: 3-Systems or Modules
Synthetic BiologyBiological Components: 3-Systems or Modules
Basu et al (2005) Nature, 434: 1130-4)
Synthetic BiologyBiological Components: 3-Systems or Modules
Synthetic BiologyBiological Components: 3-Systems or Modules
Synthetic Biology
For synthetic biology to become a form of engineering it will be necessary to achieve precision and reliability.
Factors preventing this:
1- Incomplete knowledge of biology.
2- Inherent functional overlap (parts with many -some unknown- functions, some of which are detrimental to the goal in mind.
3- Incompatibility between parts.
4- Parts functionality depends on context.
Synthetic Biology as Engineering
2- CI represses expression of unrelated host genes
3- LuxR interacts with CI and blocks its function
4- GFP is non-fluorescent in host
Synthetic BiologySynthetic Biology as Engineering Standard Parts
Parts should not have multiple functions
(One subunit of T7 phage DNA polymerase is actually E. coli thioredoxin)
Parts should not encode multiple functions
Synthetic BiologySynthetic Biology as Engineering Standard Parts
Different parts should be compatible
Parts should work in different contexts
Synthetic BiologySynthetic Biology as Engineering Standard Parts
Standardized parts could be easily exchanged between different devices (as well as between different laboratories)
Synthetic BiologySynthetic Biology as Engineering Abstraction
DNA TGCATGCTGATATACGGCTCGAT
Parts
Devices
Systems
Synthetic Biology