Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag...
Transcript of Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag...
![Page 1: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/1.jpg)
Vectors for Recombinant DNA Technology
PlasmidsAutonomous ReplicatonIntegration into genomeShuttle Plasmids
E.Coli Target host
PhagesBacteriophage Lambda
VirusesBaculovirus – Insect CellsRetroviruses – Mammalian Cells
Cosmids, BacmidsPlasmid – Bacteriophage Hybrids
Artificial ChromosomesYAC,
![Page 2: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/2.jpg)
Integration into genome
Autonomous Replication
Site specific -- Ectopic
Plasmids Viruses ARS
![Page 3: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/3.jpg)
Gene Replacement
Double Cross-over atregions showingsufficient homologyLinearized DNA
Site specific Insertion
Single Cross-over atregions showing sufficient homology
Ectopic Integration
Recombination at regions of no (low ?)Homology
![Page 4: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/4.jpg)
Plasmid vector
![Page 5: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/5.jpg)
![Page 6: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/6.jpg)
Bakteriophage Lambda Vectors
![Page 7: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/7.jpg)
![Page 8: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/8.jpg)
Cloning in Lambda Vectors
![Page 9: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/9.jpg)
In vitro packaging into phage vesicles
![Page 10: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/10.jpg)
Cosmid vectors
Principle: PlasmidDNA Transfer viaPhage infection
Resulting recombinant cloneContains self-replicating plasmid
![Page 11: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/11.jpg)
E.coli – Saccharomyces cerevisiae Shuttle Vector
Selection markerfor Yeast
Selection markerfor E.coli
Replication originfor E.coli
Replicationin Yeast Host
Expression
![Page 12: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/12.jpg)
Promoter Structural gene
Terminator
Pre-/Signal Sequences
Selection marker
Replication genes
Expression Cassette
Vector
Fusion Domains / Tags
Regulator Region
Integration
Selection marker
E.coli
Replication genes
![Page 13: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/13.jpg)
Transcription
Translation
DNA
mRNA
Protein
P RR Gene A Gene B Gene C
Protein A Protein CProtein B
start startstartstop stop stop
initiation termination
Gene Expression in Prokaryotes
RibosomeBinding Site(Shine Dalgarno)
P Promoter
R Regulatory Region (e.g. Operator)
Post-translational processing
![Page 14: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/14.jpg)
9.10.14
![Page 15: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/15.jpg)
Gene Expression – Points to consider
Transkription Initiation Promoters Transkription Termination
Regulatory Systems positive/negative regulatory systems
Translation Initiation
RNA StructureCodon usagemRNA Stability
Post-translational modificationsModification of AA-side chains: Glycosylation, Phosphorylation, etcProteolytic Processing
Protein FoldingDisulfide bond formation
Assembly of subunits
Toxicity of gene producs
Protein Degradation
LocalizationIntracellularPeriplasmicExtracellularMembrane associatedOrganelle specificSurface display
Transkript Processing
Location in Genome Autonomous replication, Integration
![Page 16: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/16.jpg)
Heterologous expression in prokaryotes – E.coli
Transcription
constitutive promotersregulated promoters
lambda pL, pRlac, trp, tac. trcT7
terminationrrnB (T1,T2), trptLambda N gene (premature termination)
m-RNA stabilityTranslation
Initiation – SD sequence ...AGGAG....elongation – codon usage
ProteolysisLon, Clp, htpR (heat shock regulatory protein)
Plasmid copy number and segregation
![Page 17: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/17.jpg)
Regulated Promoters Constitutive Promoters
Both systems are used
Preferred Combination: strong Promoters – tightly regulated
Constitutive promoters: weak to medium activity
induction
constitutive
![Page 18: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/18.jpg)
Regulated Expression in Prokaryotes
Gene Repression
negative Control
![Page 19: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/19.jpg)
Regulated Expression in Prokaryotes
Gene Activation
Positive Control
![Page 20: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/20.jpg)
Regulated Expression in Eukaryotes
Complex Initiation System
Enhancer
Activators
Repressing Systems
![Page 21: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/21.jpg)
RNA Processing Complex Mechanisms
Capping
3‘-Processing
SplicingNucleus
Cytoplasm
Export
![Page 22: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/22.jpg)
Alternative Splicing
![Page 23: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/23.jpg)
![Page 24: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/24.jpg)
Expression Systems for E.coli
Inducible Promoters based on lacI/lacO repressor/operator
-35 -10 SD
![Page 25: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/25.jpg)
pMS470d85366 bp
bla
tac Promoter
d8lacI
AvaI (18)
BamHI (23)
EcoRI (2)
HindIII (1454)
Sma I (20)
XmaI (18)
BglI (2648)
XbaI (29)
Sac I (12)
Sph I (1452)
NdeI (69)
ApaLI (2094)ApaLI (3340)
ApaLI (4656)
ApaLI (5134)
Platzhalterfragment
E.coli Expressionsvektor
Regulatorprotein
Selektionsmarke
![Page 26: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/26.jpg)
P lac T7 Polymerase Gene
lac I Repressor
mRNA
T7 PolymeraseProtein
mRNA
Lac RepressorProtein
pET
T7 Promoterlac O Gene X
mRNA
Protein X
not induced
lac OP T7
E.coli DNA Polymerase
T7 DNA Polymerase
pET-Expression system
![Page 27: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/27.jpg)
P lac T7 Polymerase Gene
lac I Repressor
mRNA
T7 Polymerase
mRNA
Lac RepressorProtein
pET
T7 Promoterlac O Gene X
mRNA
Protein X
induced
IPTG oderLaktose
lac OP T7
E.coli DNA Polymerase
T7 DNA Polymerase
pET-Expression system
![Page 28: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/28.jpg)
pETDuet™-1 is designed for the coexpression of two target genes. The vector containstwo multiple cloning sites (MCS), each of which is preceded by a T7 promoter/lacoperator and a ribosome binding site (rbs). The vector also carries the pBR322-derivedColE1 replicon, lacI gene and ampicillin resistance gene.
![Page 29: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/29.jpg)
PL based Expression VectorBacteriophage Lambda PromotersPL and PR
CI 857
Lambda Repressor CIthermosensitive mutant
CI 857
30 °C, intact repressor
42 °C, disrupted repressor
PL
PL
OL
CI 857
OL
![Page 30: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/30.jpg)
The pBAD/His vector offers the following key features:
The PBAD promoter and the araC gene product for regulated expression of the gene of interestN-terminal polyhistidine tag for rapid purification of fusion proteins using ProBond™ resinAnti-Xpress™ epitope for detection of fusion proteins with the Anti-Xpress™ AntibodyEnterokinase cleavage site to facilitate removal of the fusion partnerMultiple cloning site in three reading frames to simplify subcloning in frame with the N-terminal polyhistidine tagAmpicillin resistance gene and ColE1 origin for selection and maintenance in E. coli
The pBAD Expression System is based on the araBAD operon which controls the arabinose metabolic pathway in E.coli. It allows you to precisely modulate heterologous expression to levels that are optimal for recovering high yields of your protein of interest.
Arabinose Operon based Expression system
![Page 31: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/31.jpg)
16.10.14
![Page 32: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/32.jpg)
Heterologous expression in prokaryotes – E.coli
Transcriptionregulated promoters
lambda pL, pRlac, trp, tac. trc, araBADT7
terminationrrnB (T1,T2), trptLambda N gene (premature termination)
m-RNA stabilityTranslation
Initiation – SD sequence ...AGGAG....elongation – codon usage
Protein FoldingProteolysis
Lon, Clp, htpR (heat shock regulatory protein)Posttranslational ProcessingPlasmid copy number and segregation
![Page 33: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/33.jpg)
m-RNA Stability
RNA has programmed half lifeno good information available on factors determining decay
Secondary structures Target for RNases
Sequence structure determines secondary structure and accessibility to RNases
![Page 34: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/34.jpg)
Heterologous expression in prokaryotes – E.coli
Transcriptionregulated promoters
lambda pL, pRlac, trp, tac. trc, araBADT7
terminationrrnB (T1,T2), trptLambda N gene (premature termination)
m-RNA stabilityTranslation
Initiation – SD sequence ...AGGAG....elongation – codon usage
Protein FoldingProteolysis
Lon, Clp, htpR (heat shock regulatory protein)Posttranslational ProcessingPlasmid copy number and segregation
![Page 35: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/35.jpg)
Translation Initiation
- SD sequence ...AGGAG....
- Secondary structures
Translation elongation
- Codon usage
- Secondary structures
- Codon structure – translational frameshifting
AAAAAAAAAUCALys Lys Lys Ser
AAAAAAAAAUCALys
Lys Lys Ile
![Page 36: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/36.jpg)
Translation - Prokaryotes
Translational coupling
AUG AUGUAAUAGUGA
Shine-Dalgarno (SD) SequencerRNA 5‘-GAUACCAUCCUCCUUA-3‘mRNA ....GGAGG..(5-7bp)...AUG
Influences:
Secondary structure!! SD and AUG in unstructured region
Surrounding of SD and AUG!!!
Start
AUG 91%GUG 8UUG 1
AUG
![Page 37: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/37.jpg)
T
Translational Coupling
![Page 38: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/38.jpg)
Translation - Eukaryotes
Start Codon
mRNA 5‘-CAP......AUGCAP structure essential for efficient translation initiation
Influences on Translation efficiency:
Surrounding of AUG!!!
Kozak Consensus
.........CCA/GCCAUGG...... mammalian
....... A/TAA/CAA/CAAUGTCT/C........ yeast
![Page 39: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/39.jpg)
Translation Initiation
- SD sequence ...AGGAG....
- Secondary structures
Translation elongation
- Codon usage
- Secondary structures
- Codon structure – translational frameshifting
AAAAAAAAAUCALysLysLysSer
AAAAAAAAAUCALysLysLysSer
LysLysIle
![Page 40: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/40.jpg)
![Page 41: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/41.jpg)
![Page 42: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/42.jpg)
![Page 43: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/43.jpg)
Heterologous expression in prokaryotes – E.coli
Transcriptionregulated promoters
lambda pL, pRlac, trp, tac. trc, araBADT7
terminationrrnB (T1,T2), trptLambda N gene (premature termination)
m-RNA stabilityTranslation
Initiation – SD sequence ...AGGAG....elongation – codon usage
Protein FoldingProteolysis
Lon, Clp, htpR (heat shock regulatory protein)Posttranslational ProcessingPlasmid copy number and segregation
![Page 44: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/44.jpg)
![Page 45: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/45.jpg)
Protein Folding
Translation Conditions
Elongation velocityCodon Structure – PausingDomain folding
Disulide Bond FormationRedox Conditions
E.coli Cytosol bad conditions - reductiveE.coli Periplasm optimal conditions - oxidative
Chaperones
![Page 46: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/46.jpg)
Inclusion Body Formation
Expression velocity Translation
Protein Folding
The Department of Surface Biotechnology withthe Center for Surface Biotechnology, Box 577, BMC, 751 23 Uppsala
www.boku.ac.at/IAM/dn/EM424_23.jpg
![Page 47: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/47.jpg)
Heterologous expression in prokaryotes – E.coli
Transcriptionregulated promoters
lambda pL, pRlac, trp, tac. trc, araBADT7
terminationrrnB (T1,T2), trptLambda N gene (premature termination)
m-RNA stabilityTranslation
Initiation – SD sequence ...AGGAG....elongation – codon usage
Protein FoldingProteolysis
Lon, Clp, htpR (heat shock regulatory protein)Posttranslational ProcessingPlasmid copy number and segregation
![Page 48: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/48.jpg)
N-terminal processing – the problem of Met
f-Met deformylase
methionine aminopeptidase (MAP) of E.coli
peptidase M (S. typhimurium)
aminopeptidase M: Exopeptidase ...... X-Pro
aminopeptidase P: NH2-X-/Pro
dipeptidylaminopeptidase I (DAP-I, Cathepsin C) not at NH2 Pro/Arg/Lys
protein fusion strategies
sequence specific proteases
tags
Posttranslational Processing in prokaryotes – E.coli
Post-translational modificationsSide Chain Modifications
Glycosylation, Phosphorylation, Sulfatation, etc.Proteolytic Processing
ss CleavagePro-protein processingN/C-terminal Processing
![Page 49: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/49.jpg)
![Page 50: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/50.jpg)
![Page 51: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/51.jpg)
Metabolic load
![Page 52: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/52.jpg)
Gene Fusion StrategiesATG
Protein of InterestP
mRNA
Protein of InterestP
S S
Protein of InterestP
Protein X
Protein of InterestP
Tag
Protein of InterestP
Protein XS S Tag 1 Tag 2Protein Y
Secretory expressionin vivo processing
Intracellular expression
Fusion proteinsin vitro processing
Signal peptidase
Sequence specific peptidase
Sequence specific peptidase
Sequence specific peptidaseSignal peptidase
![Page 53: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/53.jpg)
![Page 54: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/54.jpg)
![Page 55: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/55.jpg)
Cleavage of Tags:
Enterokinase
D-D-D-D-K-X1
TEV protease
E-X-X-Y-X-Q-S
-thrombin
X4-X3-P-R[K]-X1'-X2L - V-P-R- G - S
![Page 56: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/56.jpg)
Proteolytic cleavage of Tag
Removal of Tag
Tag binds
Tag purification strategies
![Page 57: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/57.jpg)
23.10.14
![Page 58: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/58.jpg)
![Page 59: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/59.jpg)
Examples for fusion strategies
For E.coli:
Maltose binding proteinThioredoxin reductase
Generally: well soluble proteinsWell folded proteins
Fusions can hep for:
Translation initiationFoldingProtein detection: Antibodies againstFusion partner (also with small tags)
![Page 60: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/60.jpg)
Eukaryotic Expression Systems
Fungi – Yeasts
Insect Cells
Plant Cells
Mammalian CellsMouseHamsterAvianHuman
Transgenic Plants
Transgenic Animals
![Page 61: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/61.jpg)
promoter
terminator
selection in yeast
autonomous replication in yeast
autonomous replication in E.coliSelection in E.coli
E.coli replicon
![Page 62: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/62.jpg)
Vector featuresTEFp TEF1 promoter (nt 2673-3081)CYC1t S. cerevisiae CYC1 terminator (nt 2352-2610)KAN Kanamycine resistance gene (aminoglycoside phosphotransferase), allows selection in yeast using 200 mg/ml G418 (nt 190-1571)2micron Origin of replication derived from the endogenous yeast 2m circle. Allows propagation of plasmids in yeast at high copynumbers (10-50 copies/cell, nt 5291-6637)AmpR Ampicillin resistance gene (nt 4300-5158)
S.cerevisiaeExpression vectors
2µ-based multicopy vector
![Page 63: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/63.jpg)
Induction of the Gal genes in yeast. The constitutively expressed proteins GAL80 and GAL4 regulate expression of several genes required for the conversion of galactose to glucose-6-phosphate. The product of the GAL4 gene binds to the Upstream Activating Sequence (UAS-GAL). The activating effect of GAL4 is repressed by GAL80. In the presence of galactose, a metabolic product is formed which releases GAL80p from GAL4p and then activation of the GAL genes cluster occurs.
GAL4 regulatory system
![Page 64: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/64.jpg)
Protein Expression in Pichia pastoris
• Methylotrophic yeastTwo alcohol oxidase genes: AOX1, AOX2AOX1: 5 % of total mRNA, 30 % of total protein
• Well established commercial expression system• More than 300 proteins successfully expressed
(bacterial, virusal, fungal, plant, protozoan, invertebrate, vertebrate 120 human proteins)
• High cell density fermentation (>100 g/L) on simple media• No switch to anaerobic fermentation (ethanol problem)• Stable integration into host chromosome• Intracellular and secretory production capacities• Advantages of a eukaryotic host cell – but simple system
Glycosylation (N-linked, high-mannose type)Post-translational processing
![Page 65: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/65.jpg)
P.pastorisExpression system
AOX1: strong expressionAOX2: weak expression
![Page 66: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/66.jpg)
Pichia expression tools
• PromotersAOX1, GAP
• Selection markerHIS4, ARG4, ZeocinR, BlasticidinR, KanamycinR ( G418)
• Signal sequencesPHO1, alpha-Factor
• Host strainsX-33 (wt), GS115 ( his4 ), KM 71 ( aox1::arg4 his4 ),KM7IH (aox1::arg4 ),SMD1168 ( pep4 his4 ), SMD1168H ( pep4 )CBS 7435 (WZ or Δaox1 or Δ his4 knockouts)
![Page 67: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/67.jpg)
Integration in Pichia pastoris
Gene replacement at AOX1phenotype: MutS
Single cross-over integration of circular moleculesAOX1 (5‘ and 3‘ regions) HIS4GAP
Tandem repeat multicopy integration
Ectopic integration events
![Page 68: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/68.jpg)
Integration vectorfor Pichia pastoris
Gene Replacement
![Page 69: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/69.jpg)
Single-site Integration
![Page 70: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/70.jpg)
E.coliReplicon
http://tools.invitrogen.com/content/sfs/manuals/pich_man.pdf
Vector for Intracellular Expression
![Page 71: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/71.jpg)
![Page 72: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/72.jpg)
pHILD2
Promoter (app. 900 bp)
Stop-codon
mRNA
Vector for Intracellular Expression
![Page 73: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/73.jpg)
Vector for Secretory Expression
![Page 74: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/74.jpg)
Ste13
Kex2
pPIC9
Sígnal sequence
Pro- sequence
Vector for Secretory Expression
![Page 75: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/75.jpg)
• PGAP• AOX1 TT• ZeoR
• C-myc Epitope• 6xHis• alpha-factor• ColE1 ori• Multicopy Integration
“in vivo”
Resistance selection in Pichia pastoris ,multiple integration and secretion
![Page 76: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/76.jpg)
![Page 77: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/77.jpg)
Zeocin
![Page 78: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/78.jpg)
……AAACAACGAATTCTTCGAAACGAGGCTTGGCGGCCGC……EcoRI
…GAATTCTTCGAAACGATGNNNNNN…………………TAAGCGGCCGC…
NotI
Gene of interest
p A H Bgl
Promoter: A AOX1
Restriction site:Bgl BglIISph SphISwa SwaI
Selection Marker: H HIS4Z ZeocinR
A ARG4K KanamycinR
pAHBgl7111 bp
His4
bla (ApR)
P Aox1 P ARG4
Ori pMB1
Aox1 TT
ARG4 TT3' UTR Aox1
Eco RI (7078)
Xba I (3074)
Nde I (598)
Pst I (3136)
Hin dIII (7024)
Not I (7101)
Sac I (6360)
Bgl II (4161)
Bgl II (6153)
P.pastoris vectors for intracellular expression
NotI
![Page 79: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/79.jpg)
p A a H Bgl
Promoter: A AOX1
Restriction site:BglBglIISphSphISwa SwaI
Selection Marker: H HIS4Z ZeocinR
A ARG4K KanamycinR
..ATCTCTCGAGAAAAGAGCGGCCGC.....
pAaHBgl7359 bp
His4ble (ApR)
P ARG4P Aox1
Ori PMB1 Mutant
Aox1 TT
ARG4 TT3' UTR Aox1
AlphaF SP (Invitrogen)
Xba I (3074)
Xho I (7336)
Nde I (598)
Pst I (3136)
Hin dIII (7024)
Not I (7349)
Sac I (6360)
Bgl II (4161)
Bgl II (6153)
Secretion Signal: a alpha factor
Kex2 processing signal
. L E K R X X . ....CTCGAGAAAAGAGNNNNNNNNNN.........TAAGCGGCCGC
Gene of interest
P.pastoris vectors for secretory expression
NotIXhoI
![Page 80: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/80.jpg)
Vectors for multiple Integrations
intracellularsecretory
![Page 81: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/81.jpg)
![Page 82: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/82.jpg)
Baculovirus Expression System
![Page 83: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/83.jpg)
Baculovirus Expression System
![Page 84: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/84.jpg)
E.coli replicon
selectionmarkerfor eukaryote
Eukaryotic replication system e.g. viral systems
Expression signals
Mammalian Expression System
![Page 85: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/85.jpg)
Mammalian Expression System
Simple Plasmid for ectopic integration
![Page 86: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/86.jpg)
6.11.14
![Page 87: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/87.jpg)
Retroviral Expression system
expression cassette
LTRLTR Ψpackaging signal
Packaging Cell Line Expression Vector
gag pol
![Page 88: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/88.jpg)
Expression strategies
DHFR: Selection for high expressionwith methotrexate
![Page 89: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/89.jpg)
Simultaneous expression oftwo polypeptides
![Page 90: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/90.jpg)
Simultaneous expression oftwo polypeptides
![Page 91: Plasmids - ZID: FTP-/Storage-Server · PDF fileL - V-P-R- G - S. Proteolytic cleavage of Tag Removal of Tag ... Allows propagation of plasmids in yeast at high copy numbers (10-50](https://reader034.fdocuments.in/reader034/viewer/2022051720/5a78c59a7f8b9a70238c2d0f/html5/thumbnails/91.jpg)
IRES:
Internal RibosomeEntry Site
Simultaneous expression oftwo polypeptides