Page 10.. Do Now 77 1.What is the difference between digestion and synthesis? 2.Put in order from smallest to largest: Cell Atom Organelle Molecule/compound Macromolecule 3.Where are proteins synthesized in a cell? 4.Where are nutrients used to synthesize energy in a cell? How do plants and animals get nutrients necessary to make energy? Plant vs. Animal Differences in Nutrition How do plant cells get food in order to make energy? Chloroplasts is where photosynthesis takes place! Photosynthesis: CO 2 + H 2 O + Sunlight = O 2 + C 6 H 12 O 6 (glucose) Sugar is used by mitochondria to synthesize energy (ATP) Autotrophs Autotrophs make their own food. Also called producers Plants do not need to ingest glucose. Sugar (nutrient) synthesized during photosynthesis (some organisms) Differences in Nutrition How do animal cells get food in order to make energy They ingest material outside the cell! Just like we ingest material outside us for nutrition. The plasma membrane ingests and excretes food and waste! Heterotrophs Unable to synthesize own food. Ingests food (nutrients) produced by, or available in, other organisms. Why Nutrients? 1.Why are nutrients Important? 2.Why is glucose (C 6 H 12 O 6 ) used for energy? 3.How / where is energy stored in glucose? To synthesize energy! To obtain (get) materials to grow! There is lots of energy stored in glucose Energy is stored in Carbon-Hydrogen bonds! C 3 H 8 CH 4 C 6 H 12 O 6 C 12 H 30 O 10 Biochemistry A look at the Structure and Function of Organic & Inorganic Compounds Organic compounds ALL organic compounds contain the elements carbon and hydrogen always! Carbon & Hydrogen together = Organic Inorganic compounds Any of Earths elements combined but will rarely contain carbon and hydrogen together. Carbon & Hydrogen not together = Not Organic Types of Compounds All organisms contain both Organic and Inorganic materials! 1.Water (H 2 O) 2.Methane (CH 4 ) 3.Carbon Dioxide (CO 2 ) 4.Salts (NaCl) 5.Carbonic Acid (CH 2 O 3 ) 6.Sugar (C 6 H 12 O 6 ) 7.Ozone (O 3 ) Organic or Inorganic Compound? Do Now 78 1.Which compound has the most stored energy? Why? a)C 24 H 60 O 20 b)C 12 H 24 O 12 c)C 3 H 7 O 2 N 2.Where is chemical energy stored? 3.How is an organic compound different from an inorganic compound? Do Now 1.Which compound has the most stored energy? Why? a)C 24 H 60 O 20 b)C 12 H 24 O 12 c)C 3 H 7 O 2 N 2.Where is chemical energy stored? 3.How is an organic compound different from an inorganic compound? WATER! H 2 O Living things consist of 60-98% water. Important for transport and chemical reactions Polar molecule (like a magnet!) More positive (+) on one side More negative (-) on opposite side Why is this important (turn the page) Important INORGANIC compound Why is it important that water has a positive and negative side? Gives water special properties: 1.Cohesion - water sticks together 2.Adhesion water sticks to other surfaces 3.Water is the universal solvent! Many substances in the body dissolve in water Importance of Water being Polar Lets go Organic Major Organic Macromolecules 1.Carbohydrates 2.Proteins 3.Nucleic Acids 4.Lipids Organic Macromolecules The molecules found in living things are composed of hundreds of atoms, sometimes more (macromolecules). Cells create macromolecules by joining monomers (smaller molecules) in to long chains of monomers called polymers. Monomers and Polymers Polymers are made up of many monomers Dimer = Two units Monomer = One unit. Polymer = Several units bonded together. Carbohydrates Carbohydrates contain the elements: 1.Carbon C 2.Hydrogen H 3.Oxygen O Carbon, Hydrogen, Oxygen atoms are in the ratio 1:2:1 (C:H:O) What does this mean? There are always 2 Hydrogen for 1 Oxygen H:O ratio = 2:1 Carbohydrates How are carbohydrates created? Made by plants (autotrophs) during photosynthesis How do carbohydrates look? Single ring-like compound (monomer) Many single rings bonded together (polymer) Major functions: Energy and energy storage in organisms Structural support in plant cell wall Carbone Hydrogen bonds = store energy!! Do Now 80 1.Describe these prefixes or suffixes : a)Monoc) Poly b)Did) Saccharide 2.What is the ratio of C:H:O atoms in a sugar? 3.What does the structure of sugar look like? 4.What foods contain carbohydrates? Carbohydrates Basic forms of Carbohydrates: 1.Monosaccharides (one sugar) 2.Disaccharides (two sugar) 3.Polysaccharides (many sugar) Carbohydrates are made of monomers called monosaccharides A B Types of Carbohydrates Monosaccharides : simple sugars (monomers) (SMALLEST) Glucose C 6 H 12 O 6 Disaccharides: 2 sugars bonded together Sucrose (table sugar) Lactose (milk sugar) Carbohydrates Polysaccharide: more than 2 sugars bonded together Starch energy storage in plants Example: potatoes Cellulose provides structural support in cell walls Glycogen used for energy storage in animals ( liver/muscles ) What kind of saccharide 1.Glucose + Glucose = 2.Glucose + Glucose + Glucose = 3.Starch + Glucose = 4.Cellulose = 5.Glucose = What do you notice about the names for most sugars? Glucose Fructose Maltose Sucrose Galactose Cellulose Identify the molecules Use vocabulary you know! 1 2 3 Do compounds change? Whats going on in the picture? How is the left side different from the right side? What is missing on the right side that is on the left side? Monomers are brought together to make Polymers Building Polymers Dehydration synthesis: process of removing water (H2O) which brings together, synthesizes, larger molecules Dehydration Synthesis Literally means: DehydrationSynthesis Summary How are macromolecules synthesized? 1.Is the molecule organic or inorganic? a)Water (H 2 O) b)Methane (CH 4 ) c)Carbon Dioxide (CO 2 ) d)Sugar (C 6 H 12 O 6 ) e)Ozone (O 3 ) 2.Explain what is happening and fill-in the blank: a)Glucose + Glucose = ________________ a)Process = ______________________ b)Starch + Glucose = ____________________ a)Process = _______________________ Do Now 88 Whats going on in the picture? How is the left side different from the right side? What is missing on the left side that is on the right side? How do you break larger molecules apart? Simply add water! Hydrolysis Adding water breaks large molecules into smaller parts! Hydrolysis Literally means: Hydro Lysis What is going on in the picture? 1 2 Stop We know: Inorganic vs. Organic Carbohydrates Dehydration Synthesis Hydrolysis .what about the other Macromolecules? They seem pretty cool too! Lipids Contain the elements : Carbon, Hydrogen, Oxygen NOT a 1:2:1 ratio! H:O ratio = greater than 2:1 Function: 1.Energy Storage Stores more energy than other types of molecules 2.Large part of cell membrane structure Are lipids organic? Why? Lipids Examples of Lipids : 1.Fats 2.Oils 3.Waxes 4.Steroids (Cholesterol) Lipids are non-polar Do lipids and water mix? NO! Lipids are considered hydrophobic Hydro phobic - Lipid Structure No ring structure Only in steroids (you dont have to know) Building Blocks (Also known as monomers) 1.Glycerol backbone Holds the fatty acids together 2.Fatty Acids Long chains of H-C bonds Common lipid Triglyceride Glycerol backbone and 3 fatty acids Lipid Structure Common lipid Triglyceride Glycerol backbone and 3 fatty acids += Carbohydrate or Lipid? C 12 H 24 O 2 C 6 H 12 O 6 C 10 H 18 O 2 C 11 H 22 O 11 Whats going on here? Carbohydrate or Lipid? 1.C 12 H 24 O 2 2.C 10 H 18 O 2 3.What building blocks, monomers, do you need to synthesize a lipid? Proteins Elements in Proteins: Carbon Hydrogen Oxygen Nitrogen (N) Are proteins organic? Why? Proteins Proteins have several very important functions: H ormones (insulin) E nzymes (break things down and build things up) A ntibodies R eceptors Membrane transport Cell structure Muscle contraction They help cells communicate and get things done! Building Blocks are amino acids Polymer = Protein (Polypeptide) Monomers = Amino Acids Proteins are long chains of amino acids Proteins Amino Acid How can I make these amino acids a protein? Proteins: made of amino acids Amino Acids There are 20 different types of Amino Acids Amino acids combine to form unlimited types of proteins Just like the 26 letters in the alphabet AMINO ACID SEQUENCE (order) DETERMINES : Protein SHAPE (how it folds) and protein FUNCTION Proteins: made of amino acids Peptide bonds join amino acids together Polypeptide = long chain of amino acids connected by many peptide bonds. Another name for a protein a.a. Peptide Bond Nucleic Acids Found: In the nucleus of a cell (eukaryotic) Is the macromolecule that makes-up your genetic code! Blueprints for every trait, protein in your body! Elements: All contain: C,H,O, N and Phosphorus (P) 2 kinds of Nucleic Acids: 1.Deoxy-ribo-nucleic-acid (DNA) 2.Ribo-nucleic-acid (RNA) Nucleic Acids Building Blocks (monomers): Nucleotides make Nucleic Acids Nucleic Acids: Made of many nucleotides Put many small nucleotides (small pieces) together, you get a big nucleic acid (polymer). Nucleic Acids: Made of nucleotides 5 types of nucleotides (bases): 1.Adenine 2.Guanine 3.Cytosine 4.Thymine (only DNA) 5.Uracil (only RNA) The sequence of your nucleotides CGATTCGATCGCCTAGCAACTCGATC is your unique (one of a kind) genetic code. It makes you, YOU! The Molecules of Life Know the Building Blocks of Macromolecules Carbohydrates (monosaccharides) Lipids (fatty acids) Proteins (amino acids) Nucleic Acids (nucleotides) Do Now 11:11 1.What nutrients would your body receive if the macromolecules in a peperoni pizza were digested? DO NOW Create Graphic Organizer on Macromolecules