Overexpression of Sphingosine-1-Phosphate Lyase or Inhibition of … · S-1-P lyase. The...

EUKARYOTIC CELL, June 2004, p. 795–805 Vol. 3, No. 31535-9778/04/$08.00�0 DOI: 10.1128/EC.3.3.795–805.2004Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Overexpression of Sphingosine-1-Phosphate Lyase or Inhibition ofSphingosine Kinase in Dictyostelium discoideum Results in a

Selective Increase in Sensitivity to Platinum-BasedChemotherapy Drugs

Junxia Min, Andrew L. Stegner, Hannah Alexander, and Stephen Alexander*Division of Biological Sciences, University of Missouri, Columbia, Missouri 65211-7400

Received 26 January 2004/Accepted 4 March 2004

The efficacy of the chemotherapy drug cisplatin is often limited due to resistance of the tumors to the drug,and increasing the potency of cisplatin without increasing its concentration could prove beneficial. A previouslycharacterized Dictyostelium discoideum mutant with increased resistance to cisplatin was defective in the geneencoding sphingosine-1-phosphate (S-1-P) lyase, which catalyzes the breakdown of S-1-P, an important reg-ulatory molecule in cell function and development and in the regulation of cell fate. We hypothesized that theincreased resistance to cisplatin was due to an elevation of S-1-P and predicted that lowering levels of S-1-Pshould increase sensitivity to the drug. We generated three strains that stably overexpress different levels of theS-1-P lyase. The overexpressor strains have reduced growth rate and, confirming the hypothesis, showed anexpression-dependent increase in sensitivity to cisplatin. Consistently, treating the cells with D-erythro-N,N,-dimethylsphingosine, a known inhibitor of sphingosine kinase, increased the sensitivity of mutant and parentcells to cisplatin, while addition of exogenous S-1-P or 8-Br-cyclic AMP made the cells more resistant to cis-platin. The increased sensitivity of the overexpressors to cisplatin was also observed with the cisplatin analogcarboplatin. In contrast, the response to doxorubicin, 5-flurouracil, or etoposide was unaffected, indicating thatthe involvement of the sphingolipid metabolic pathway in modulating the response to cisplatin is not part ofa global genotoxic stress response. The augmented sensitivity to cisplatin appears to be the result of anintracellular signaling function of S-1-P, because D. discoideum does not appear to have endothelial differen-tiation growth (EDG/S1P) receptors. Overall, the results show that modulation of the sphingolipid pathway atmultiple points can result in increased sensitivity to cisplatin and has the potential for increasing the clinicalusefulness of this important drug.

Chemotherapy is frequently used to treat cancer. However,the efficacy of treatment is often limited because some tumorsare intrinsically resistant to anti-tumor drugs, while in othersresistance is selected for during the course of therapy. Oneimportant example is the chemotherapy drug cisplatin [cis-diamminedichloroplatinum (II)], which is widely used in thetreatment of small-cell and non-small-cell lung cancer, non-Hodgkin’s lymphoma, testicular cancer, ovarian cancer, headand neck cancer, esophageal cancer, and bladder cancer,among others (33). Various mechanisms of resistance havebeen proposed, including reduced drug concentration in thecell, drug inactivation, increased DNA repair, or failure to turnon cell death pathways (40). However, despite numerous stud-ies, our understanding of resistance to this widely used drugremains poor, and the signaling pathways that activate thevariety of proposed mechanisms of resistance are, for the mostpart, unknown. To some degree this is the result of the diffi-culty of using animal cell lines for identifying specific geneticloci associated with drug resistance.

We have used the cellular slime mold Dictyostelium discoi-deum to identify specific genes that are involved in a cell’sresponse to cisplatin. The amenability of this organism to mo-

lecular genetic manipulations allowed us to isolate by inser-tional mutagenesis a number of mutants— with disruptions insingle genes—that have increased resistance to cisplatin. Thedisrupted genes were identified by sequencing the DNA flank-ing the insertions. None of the identified genes had been as-sociated previously with cisplatin resistance, and as such theyrepresented potential new targets for improving therapy (20).

One of the genes identified in the above study encodes theenzyme sphingosine-1-phosphate (S-1-P) lyase (sglA), whichcatalyzes the last step in the sphingomyelin degradation path-way, the conversion of S-1-P to phosphoethanolamine andhexadecanal (Fig. 1) (45). In addition to its resistance to cis-platin, the S-1-P lyase null mutant (sglA�) exhibited dramaticphenotypic changes in its growth and development. These in-cluded the inability of aggregating cells to form anterior F-actin-filled pseudopods, the inability to form multicellular slugsthat can phototax, and a block in late development resulting ina decrease in spore production (19). Overall, the multiplephenotypes indicated that S-1-P is a central regulatory mole-cule in D. discoideum development, similar to the much-stud-ied regulatory molecule cyclic AMP (cAMP) (39). Subsequentstudies have reported that the S-1-P lyase plays important rolesin cell function and development in other systems as well,including yeast (7), Caenorhabditis elegans (27), Drosophilamelanogaster (8), and mouse cells (16). Evidence now existsshowing that S-1-P functions both as an intracellular second

* Corresponding author. Mailing address: Division of Biological Sci-ences, 303 Tucker Hall, University of Missouri, Columbia, MO 65211-7400. Phone: (573) 882-6670. Fax: (573) 882-0123. E-mail: [email protected].

795

on May 22, 2021 by guest

http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

messenger and as an extracellular ligand for the family of Gprotein-coupled endothelial cell growth (EDG) receptors, anda substantial body of evidence has implicated S-1-P in mam-malian cell movement and tumor cell metastasis through G-protein-coupled mechanisms (29, 41).

Earlier work in animal systems has led to the rheostat model,which suggests that it is the relative level of ceramide to S-1-P(24, 42), or sphingosine to S-1-P (36), that determines a cell’sdecision to proliferate or die. Thus, cells with increased levelsof ceramide or sphingosine follow a pathway of cell death,while increasing the level of S-1-P counteracts this and resultsin cell differentiation, proliferation, and inhibition of celldeath. Accordingly, we hypothesized that the increased resis-tance of the sglA� strain to cisplatin was due to an increasedlevel of intracellular S-1-P. If so, altering the S-1-P levels,either genetically or pharmacologically, would result in corre-sponding changes in cisplatin sensitivity. This approach wouldpotentially identify new molecular targets for increasing thesensitivity of tumors to cisplatin.

In this paper we describe the generation and the phenotypicanalysis of mutants that stably overexpress the SglA protein todifferent levels. The overexpressor mutants exhibit the pre-dicted increase in sensitivity to cisplatin and the related drugcarboplatin but not to other drugs tested. Treating the parentcells with the sphingosine kinase inhibitor D-erythro-N,N,-di-methylsphingosine (DMS) mimicked the sglA overexpression(sglAOE) phenotype and resulted in increased sensitivity tocisplatin as well. The increased sensitivity was reversed by theaddition of 8-Br-cAMP or by the addition of S-1-P to themutant strains. These studies support our idea that sphingo-lipids are involved in the cell’s specific response to cisplatin and

that manipulations of these sphingolipid biosynthesis and bio-degradation pathways could augment treatment with cisplatin.Additionally, the sglAOE mutants have an impaired growthphenotype, which results in slower proliferation in liquid cul-tures and smaller plaque size when grown on bacteria, con-firming the pleiotropic role of S-1-P in the regulation of cel-lular processes.

MATERIALS AND METHODS

Strains and culture conditions. Ax3-ORF�, the parent strain for the overex-pressing S-1-P lyase gene, and the transformation vector pDXA3C were giftsfrom D. Manstein, National Institute for Medical Health, London, United King-dom (18, 26). The 7.7-kb transformation construct carrying the myc-tagged sglAgene (pDXA3C/sglA) is pJM5. The S-1-P lyase overexpressors [sglA-myc]neor-1,[sglA-myc]neor-2, and [sglA-myc]neor-3 (strains SA601 to SA603) are referred toin the text as sglAOE-1, -2, and -3. Strain SA555 contains a homologous deletionof the sglA gene, is blasticidin resistant, and is referred to in the text as sglA�(previously named cis2B [19, 20]).

Strains were stored either frozen in liquid nitrogen in a mixture of 5% di-methyl sulfoxide (DMSO) in horse serum or as desiccated spores on silica gel at4°C. Fresh cultures were started monthly from stocks. Cells were grown in HL5medium (43). Clonal isolation of strains and some growth rate experiments weredone by growing cells on SM agar in association with Klebsiella aerogenes as afood source (43). All cell growth was done at 22°C.

Construction of sglA overexpression vector. A full-length cDNA for the S-1-Plyase gene (sglA; accession no. AY283052) was derived by reverse transcription-PCR (Gibco Superscript Preamplification System; Gibco-BRL, Gaithersburg,Md.) by using total RNA from D. discoideum strain Ax4. First-strand synthesiswas done using the gene-specific reverse primer 5� CTCCAATGCATCGTAAGTTGATTGAGAAGG 3�, and the ensuing PCRs were carried out using theforward primer 5� CTCGAGCTCATGGATAAAGCAAATGAT 3�, the reverseprimer above, and the high-fidelity polymerase Easy-A Hi-Fi PCR cloning en-zyme (Stratagene, La Jolla, Calif.) (underlined regions are gene-specific se-quences). NsiI or SacI sites were introduced for the purpose of cloning. Theamplified DNA was ligated directly into the corresponding sites of pDXA3C togenerate expression vector pJM5. The construct includes the 5� ATG of the sglAgene and is missing the 3� stop codon. Expression is driven by the actin 15promoter, and the protein product is myc tagged at the C terminus. Manstein etal. (26) reported high levels of expression with this vector. The entire sglAfragment was sequenced by using sglA gene-specific primers. Prior to transfor-mation the plasmid was purified by using a QIAGEN (Valencia, Calif.) Maxiplasmid preparation kit.

Generation of overexpressor strains. Logarithmically growing D. discoideumAx3-ORF� cells (5 � 106 cells/ml) were mixed with 15 �g (10 �l) of vector DNAand were immediately electroporated as described previously (17). Cells werebrought up to 40 ml in DD broth (26), plated in four 100-mm petri dishes, andincubated at 22°C for 24 h. Transformants were selected by the addition of 20 �gof G418/ml at 22°C. Cells were fed every 4 to 5 days with DD broth-G418, andsmall colonies of G418-resistant cells began to appear after 10 to 12 days. Controltransformations were Ax3-ORF� cells transformed with pDXA3C vector. Cellsfrom 20 individual sglA transformant colonies and from control transformantcolonies were transferred to 24-well plates for expansion. These were incubatedfor 4 days and then were inoculated both onto 24-well plates containing SM agarand bacteria in order to examine the phenotype of the cells during growth anddevelopment on the agar and also onto a replica 24-well plate containing DDbroth-G418. Ten single clones, which appeared to be growing more slowly thanthe control transformants, were chosen for Western analysis for the presence ofthe c-myc-tagged SglA protein. To this end, cells from the corresponding 24-wellplates were plated clonally onto 100-mm-diameter SM agar plates with bacteriaand single clones were isolated.

Western blots. Putative mutant cells were plated on SM agar in associationwith K. aerogenes and were allowed to grow to confluence (until the plates wereclear of bacteria). The cells were scraped off the plate, washed twice in SS buffer(0.6 g of NaCl/liter, 0.75 g of KCl/liter, 0.4 g of CaCl2/liter), pelleted, and keptfrozen at �80°C. Cell pellets were lysed in 1 ml of lysis buffer (50 mM Tris-HCl[pH 8.0], 5 mM EDTA, 0.5% Triton X-100) including protease inhibitor [1:100dilution of 100� protease inhibitor cocktail, which contained 20 mM 4-(2-aminoethyl)benzenesulfonyl fluoride, 100 �g of pepstatin A/ml, 10 �g of leu-peptin/ml] on ice. Protein concentration was determined by bicinchoninic acidprotein assay (Pierce, Rockford, Ill.). Fifty micrograms of protein was separated

FIG. 1. Schematic presentation of the last steps in the sphingomy-elin degradation pathway. The S-1-P lyase and sphingosine kinaseenzymes shown in shaded boxes are the primary focus of this study.The compounds that were used in this study (DMS and cAMP) andtheir effects on sphingosine kinase are shown. sglAOE is the S-1-P lyaseoverexpressor strain, and sglA� is the S-1-P lyase null strain.

796 MIN ET AL. EUKARYOT. CELL


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

on sodium dodecyl sulfate–10% polyacrylamide gel electrophoresis and wasblotted onto nitrocellulose (OPTITRAN; Schleicher & Schuell, Keene, N.H.) for4 h at 63 V. The blots were developed with monoclonal anti-c-myc antibodies,clone 9E10 (Sigma-Aldrich, St. Louis, Mo.), and horseradish peroxidase-conju-gated immunopure goat anti-mouse secondary antibody (Pierce). The reactionwas developed by using BM chemiluminescence blotting substrate (Roche, In-dianapolis, Ind.). The films were scanned, and the relative density of the bandswas determined by using Metamorph version 4.6.

Growth rate measurements. Growth on a solid surface was measured byplating cells at low density (about 40 cells per plate) on 100-mm-diameter SMagar plates in association with bacteria. As cells consume the bacteria they formplaques. The plates were scanned daily on a flatbed scanner starting at day 3,when the plaques were first visible. The diameters of 10 random plaques perstrain were measured, and areas were calculated. For measuring growth rate inliquid cultures, cells were inoculated in HL5 medium at 5 � 104 cells/ml, andduplicate samples were counted daily in a hemocytometer.

Nuclei counting. Logarithmically growing cells (3 � 104 cells) were washed inLPS buffer (43), deposited on coverslips, and allowed to settle and adhere. Thecells were fixed in 3.7% formaldehyde for 3.5 min, washed thoroughly with LPS,permeabilized with 0.5% NP-40 in LPS, and stained with 20 �g of 4�,6-dia-midino-2-phenylindole (DAPI)/ml. Random fields of cells were examined on aZeiss IM microscope with a 100� Neofluor lens, and the number of nuclei ineach cell was counted. The results are the averages of 300 cells for each strain.

Drug sensitivity. All drugs used in this study were purchased from Sigma-Aldrich (St. Louis, Mo.). Stock solutions were constructed as follows: cisplatin,1 mg/ml (3.3 mM) in Pt buffer (3 mM NaCl, 1 mM NaPO4 [pH 6.5]); carboplatin,1 mg/ml (2.69 mM) in Pt buffer; doxorubicin, 2 mg/ml (3.45 mM) in Pt buffer;etoposide, 30 mg/ml (50.97 mM) in DMSO; 5-flurouracil (5-FU), 25 mg/ml(192.2 mM) in DMSO. For each drug we ran a preliminary experiment on Ax4cells to determine the optimal drug concentration and pH which resulted in alevel of cell death where increased sensitivity or resistance could be detected(data not shown). In all cases the drugs had a stronger effect when the experi-ments were done in buffer rather than in growth medium. However, becausesudden starvation of the cells causes stress by itself, all the experiments weredone in HL5 growth medium. Duplicate 10-ml cultures of parent or mutantstrains were then treated with drugs at the concentrations and times indicated inthe figures while being shaken at 200 rpm at 22°C and were assayed for viabilityby using a rapid plaque viability assay in 24-well plates (1). Survival was calcu-lated as the percentage of the untreated culture. All viability determinationswere done in duplicate, and the results were averaged. This assay allows thequantitation of viability over 4 orders of magnitude and is therefore extremelysensitive. Error was calculated by using the statistical tool in Microsoft Excel, andstandard error bars are presented in all the graphs. P values were calculated byusing Student’s t test in Microsoft Excel.

Cotreatments of cells with cisplatin and sphingolipid metabolism-related

compound. 8-Br-cAMP was dissolved to 40 mg/ml (93 mM) in HL5. DMS wasdissolved to 2.5 mg/ml (7.63 mM) in DMSO, and S-1-P was dissolved to 1 mg/ml(2.64 mM) in DMSO. All experiments were done in duplicate in 2-ml cultures in20-ml glass scintillation vials. Each experiment consisted of an untreated culture,a culture treated with cisplatin alone, a culture treated with the tested chemicalalone, and a culture treated with both. For the combination treatments, thechemicals being tested were added to growing cultures 1 h prior to the additionof cisplatin. The rest of the experiment was carried out as described in the abovesection on drug sensitivity. Survival was calculated as a percentage of the un-treated culture. Fold change in resistance or sensitivity was calculated as the ratioof the survival after combination treatment to the expected survival if each of thecompounds acted independently, e.g., survival after DMS and cisplatin togetherdivided by (survival after DMS alone times survival after cisplatin alone). Stan-dard error and P values were calculated as described above.

RESULTS

Stable overexpression of S-1-P lyase. The S-1-P lyase nullmutant was originally obtained in our random insertional mu-tagenesis selection for cisplatin resistance. In addition to itsincreased resistance to the drug, the mutant displayed aberrantdevelopment. The aim of this study was to construct mutantsthat overexpressed the S-1-P lyase to test the hypothesis thataltering the levels of S-1-P in the cells would result in increasedsensitivity to cisplatin. In addition, we predicted that sglA over-expression would provide additional clues to the role of thisenzyme in cell function.

Three mutant strains that overexpress a myc-tagged fusionprotein of the S-1-P lyase were isolated. These strains pro-duced the expected 58-kDa fusion protein to different levelsand were named sglAOE-1, sglAOE-2, and sglAOE-3. Figure2B shows the levels of c-myc expression in the three strains asdetected by reactivity with anti-myc antibody. The level ofexpression in strain sglAOE-1 and sglAOE-2 was approximately15 and 7 times that of strain sglAOE-3 (Fig. 2C). Figure 2Ashows the Coomassie blue-stained proteins in the samples usedfor the Western analysis and confirms that the level of proteinin each sample was equal. Moreover, the increasing amounts ofthe recombinant SglA-myc fusion protein can be observed in

FIG. 2. Expression of the SglA protein in D. discoideum. Cells of each of the sglA-myc transformants were harvested, washed, and lysed indenaturing buffer, and the protein concentration was determined. Fifty micrograms of total protein per lane was separated by sodium dodecylsulfate–10% polyacrylamide gel electrophoresis. (A) Total protein, stained with colloidal Coomassie blue. Note that the samples have equalamounts of protein. Vector1 and Vector2 are vector control transformants. Ax3-ORF� is the untransformed parental cells. MW, molecular sizestandards. (B) Proteins were transferred to nitrocellulose membranes and were probed with anti-c-myc antibodies. (C) The exposed film shownin panel B was scanned and quantitated. The image shows relative units of expression, using sglAOE-3 as a reference (1).

VOL. 3, 2004 S-1-P LYASE REGULATES CISPLATIN SENSITIVITY 797


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

the samples from all three overexpressing strains. The varia-tions in SglA-myc expression are stable and are presumablydue to differences in copy number.

Overexpression of S-1-P lyase results in altered growth reg-ulation. The S-1-P lyase-overexpressing strains have slowergrowth rates than the parent strain. This is reflected both in thesize of the plaque for bacterially grown cells and in a slowergrowth rate in liquid. Figure 3A and B depicts the change inplaque size over 3 days for each strain and shows that eachoverexpressing strain has a different growth rate. The decreasein plaque size reflects the level of overexpression of the SglAprotein. The inset in Fig. 3B magnifies the differences at day 3,when the plaques were very small.

Figure 3C shows the growth rate of the strains when growingaxenically in HL5 medium. The sglAOE strains also grow moreslowly in liquid medium, although the difference becomes lesspronounced at densities over 5 � 106 cell/ml. This growth

behavior was observed in three consecutive passages. Again,the degree of growth inhibition is parallel to the level ofSglA overexpression, although the differences are not as pro-nounced as when the cells are growing on agar. Importantly,the cell density at which the cells enter stationary phase isaltered in the overexpressing strains, with the higher levels ofoverexpression causing a lower stationary phase density. SglAoverexpression also results in a delayed decrease in cell num-ber in late stationary phase. The change in growth phenotypeis accompanied by an increasing number of multinucleate cells,as is shown in Fig. 3D.

S-1-P lyase overexpression increases sensitivity to the che-motherapeutic agents cisplatin and carboplatin but not to oth-er drugs. The original sglA� mutant had increased resistanceto cisplatin, and we hypothesized that the lack of S-1-P lyaseresulted in the buildup of S-1-P, a lipid associated with growthpromotion and inhibition of cell death. Based on this hypoth-

FIG. 3. Growth rate of the sglAOE strains. The three sglAOE strains, the vector control transformation strains, and the parent strain were platedon SM agar plates in association with K. aerogenes. Plates were scanned daily, and the diameter of the plaques was measured. (A) Photographsof the plates at day 4. (B) Plaque size. The results are presented as the area of the plaque over 3 days, and each point is the average of 10 randomlyselected plaques. Inset is a visual representation of the results at day 3, when the plaques were still very small. (C) The three sglAOE strains, thevector control transformation strain, and the parent strain were inoculated at a density of 105 cells/ml in 20 ml of HL5 medium and were grownwith shaking at 200 rpm at 22°C. Cultures were counted daily. When the cultures reached approximately 5 � 106 cells/ml they were diluted downto 5 � 104 cells/ml so that the culture could be followed through three consecutive passages. The last passage was allowed to go through stationaryphase. (D) Cells of the three sglAOE strains, the vector control transformation strain, and the parent strain were harvested from HL5 medium ata density of 3 � 105 (mid-log phase) and washed, and 100 �l was allowed to settle on coverslips, where they were fixed with 3.7% formaldehyde.The cells were stained with 20 �g of DAPI/ml. The number of nuclei per cell was counted in 300 cells from each strain on a Zeiss IM microscopewith a Chroma Technology Corp. lucifer yellow filter. Results are presented as the percentages of the total number of cells.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

esis, it is predicted that cells overexpressing S-1-P lyase shouldbe more sensitive to cisplatin. Cells were treated with threeconcentrations of cisplatin for 4 h and were scored for viability.The results shown in Fig. 4 confirm our hypothesis and showthat the SglA-overexpressing cells are indeed more sensitive tocisplatin than the parent. The increase in sensitivity parallelsthe level of expression of the myc-tagged SglA protein in eachstrain, with slgAOE-1 being 10-fold more sensitive, followed bysglAOE-2 (3.3-fold) and sglAOE-3 (1.6-fold). Confirming theresults of previous studies (20), sglA� cells assayed in the sameexperiment are more resistant to cisplatin than Ax4 cells.

Cross-resistance to drugs is an important aspect of chemo-

therapy and can considerably limit the options for treatment.Thus, it was determined whether the sglAOE and sglA� mu-tants have increased sensitivity or resistance to other drugs inaddition to cisplatin. To this end we tested the response of thetwo mutants and the Ax4 parent in parallel to a 24-h treatmentwith cisplatin, carboplatin (a cisplatin analog widely used inchemotherapy), and three other non-platinum drugs (Fig. 5).The data show that the same altered sensitivity to cisplatin wasobserved in the case of carboplatin. Carboplatin is less toxic tothe Ax4 cells (65% survival at 300 �M), but sglAOE-1 is moresensitive to carboplatin and sglA� is more resistant to the drug,similar to the results obtained with cisplatin. In contrast, nei-ther mutant showed altered sensitivity or resistance to doxo-rubicin, 5-FU, or etoposide. Therefore, altering SglA expres-sion did not affect the cells’ responses to these drugs.

Inhibition of the sphingosine kinase synergistically in-creases sensitivity to cisplatin. Deleting or overexpressing thesglA gene resulted in increased resistance or increased sensi-tivity to cisplatin, respectively. These results suggested that in-hibiting sphingosine kinase should mimic the sglAOE pheno-type and would result in increased sensitivity to cisplatin. Tothis end we tested the effect of the sphingosine kinase inhibitorDMS on cells of the sglAOE-1, sglA�, and parental strains, andthe results are shown in Fig. 6.

(i) Parental wild-type cells. High levels of DMS are toxic toD. discoideum cells. Treatment with concentrations of 20 and50 �M resulted in complete cell death (data not shown), un-derscoring the importance of sphingosine kinase for normalcell growth. To test the effect of DMS on cisplatin sensitivity,lower doses were chosen, which resulted in a lower level of celldeath. Figure 6A and B shows that DMS kills the parentalwild-type cells in a dose- and time-dependent manner. Con-centrations of 2.5, 5, and 10 �M DMS result in 97, 89, and 28%survival after 5 h and 113, 74, and 11% after 24 h. Treatmentof parallel cultures with 150 �M cisplatin alone reduced cellviability to 74% percent after 5 h and 36% after 24 h. Cotreat-ment of cells with both DMS and cisplatin resulted in a syn-ergistic increase in drug sensitivity. For example, at 5 �M DMS

FIG. 4. sglAOE strains are sensitive to cisplatin. Cultures of 106

cells/ml in HL5 medium were treated with increasing concentrations ofcisplatin (0, 75, 150, and 300 �M) for 4 h, serially diluted, and platedfor viability on SM agar in 24-well plates with K. aerogenes as the foodsource. Viability is expressed as the percentage of surviving cells rel-ative to an untreated culture. sglA� is the SglA null strain. Because thesglA� and sglAOE strains had different parents, we established that theAx3-ORF� and Ax4 strains had identical sensitivities to cisplatin (datanot shown).

FIG. 5. Overexpression of sglA renders the cells more sensitive to cisplatin and carboplatin but not to other drugs. Ten milliliters of culturesof 106 cells/ml in HL5 medium were treated with the indicated drugs for 5 h, serially diluted, and plated for viability measurements as describedfor Fig. 4. Survival was calculated as a percentage of the untreated culture. (A) 300 �M cisplatin; (B) 300 �M carboplatin; (C) 450 �M doxorubicin;(D) 400 �M 5-FU; (E) 300 �M etoposide. Strain names are the same as those shown in Fig. 4. P values (by Student’s t test) for cisplatin andcarboplatin were �0.05 and �0.001, respectively.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

FIG. 6. Pretreatment with DMS increased the cell response to cisplatin. Growing cultures of sglAOE-1, sglA�, and the parent strain at 106 inHL5 medium were treated with 0, 2.5, 5, and 10 �M DMS for 1 h prior to adding 150 �M cisplatin. The cultures were assayed for viability at 5and 24 h as described in the legend to Fig. 4. (A and B) parent strain; (C and D) sglAOE-1; (E and F) sglA�. Closed circles, 150 �M cisplatin withincreasing concentrations of DMS. Open circles, increasing concentrations of DMS alone. (G) Photograph of the plaques of the viable cells at day3 after plating. Note that increasing concentrations of DMS result in smaller plaques.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

survival is reduced 2.8-fold after 5 h and 8.9-fold after 24 h overwhat would be predicted if the two drugs were working inde-pendently. Clearly, inhibiting sphingosine kinase increases sen-sitivity to cisplatin in the parental cells, as was predicted.

(ii) SglA overexpressor cells. The effect of DMS on thesglAOE-1 cells is shown in Fig. 6C and D. Again, the sglAOE-1cells were killed by DMS in a dose- and time-dependent man-ner. As shown above, these cells are initially more sensitive tocisplatin. In contrast to the results with the parental cells, thereis no synergistic effect of cotreatment, and the killing with bothDMS and cisplatin was not greater than the expected com-bined killing of the two drugs alone. This is presumably be-cause the level of S-1-P in these cells is already very low due tothe increase in the S-1-P lyase enzyme, such that inhibition ofthe kinase has no additional effect.

(iii) SglA� cells. SglA� mutant cells are more resistant tocisplatin than the parent cells, and 5 h of treatment with 150�M cisplatin resulted in virtually no cell killing. Similar tothe results described for the parent cells, cotreatment withDMS and cisplatin resulted in a synergistic reduction in viabil-ity of 6.5-fold at 5 h and 4.2-fold at 24 h when treated with 5�M DMS.

Cells treated with DMS produced small plaques, and the sizeof the plaques decreased with increasing DMS concentrations(Fig. 6G). This is in agreement with the smaller plaque sizethat was seen with the sglAOE strains and is consistent with theidea that reducing the level of S-1-P results in a decrease ingrowth rate.

Exogenous S-1-P increases resistance to cisplatin. Based onthe results with the sglAOE and null mutants, it was predictedthat adding S-1-P to cells would increase resistance to cispla-

tin—essentially mimicking the sglA� mutant. It was previouslyshown that the developmental timing phenotype of the sglA�mutant could be mimicked by adding exogenous S-1-P to wild-type cells (19). The results showed that S-1-P does indeedmake parental and sglAOE-1 cells more resistant to cisplatin,as was predicted. Figure 7A and B depicts the results with theparent strain. At 5 h with 150 �M cisplatin there was littlekilling, and therefore adding S-1-P had no obvious effect. How-ever, at 24 h there was approximately 50% killing with cispla-tin alone, and S-1-P at even the lowest dose of 2 �M reversedthis to almost the untreated level, i.e., made the cells moreresistant. In the case of the initially more-cisplatin-sensitivesglAOE-1 cells (Fig. 7C and D), S-1-P also increased resistance.The sensitivity to cisplatin was never fully reversed in thesglAOE-1 mutant. This is presumably because of the high levelsof S-1-P lyase.

8-Br-cAMP increases resistance to cisplatin. cAMP hasbeen reported to be an activator of sphingosine kinase (25),and this suggested that increasing levels of cAMP could in-crease resistance to cisplatin in a fashion similar to that ofadding S-1-P to the cells. Therefore, the membrane-permeableanalog 8-Br-cAMP was used to increase intracellular concen-trations of cAMP. 8-Br-cAMP has been shown to be effectiveat mimicking the effects of cAMP in D. discoideum develop-ment, including the late stages of spore development, where 20mM levels were used for maximum effect (15). The resultsdepicted in Fig. 8 show that 8-Br-cAMP does indeed makeboth parental and sglAOE-1 cells more resistant to cisplatin.We initially found that high levels of 8-Br-cAMP (10 to 20 mM)were toxic to mitotically dividing cells and therefore chose totest lower concentrations. The effect of 8-Br-cAMP on the

FIG. 7. Pretreatment with S-1-P increases resistance of cells to cisplatin. Growing cultures at 106 cells/ml in HL5 medium were treated with 0,10, 20, and 50 �M S-1-P 1 h prior to the addition of 150 �M cisplatin. Cells were sampled at 5 and 24 h and were assayed for viability as describedin the legend to Fig. 4. (A and B) Parental strain at 5 and 24 h, respectively. (C and D) sglAOE-1 at 5 and 24 h, respectively. Closed circles, 150�M cisplatin with increasing concentrations of S-1-P. Open circles, increasing concentration of S-1-P alone.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

parent strain (Fig. 8A) was mild, and the effect on the sglAOEstrain (Fig. 8B) was more pronounced, where survival in-creased from 30 to 70%.

DISCUSSION

Genetic studies using insertional mutagenesis revealed newand unexpected genes and pathways that are involved in mod-ulating a cell’s sensitivity to the chemotherapeutic drug cispla-tin (20). These genes included those encoding sphingosine-1-Plyase, cAMP phosphodiesterase (regA), golvesin (a Golgi pro-tein), a P2Y purine receptor homolog, and a CAAX prenylprotease homolog. Similar mutational strategies with yeasthave also identified cAMP phosphodiesterase (3) as well as anovel copper transporter, CTR1 (9, 21).

The S-1-P lyase null mutant was chosen for additional study,because the defective enzyme in this strain represents the laststep in a pathway that has been previously shown to play animportant role in cell signaling, cell proliferation, and celldeath via controlling the levels of ceramide, sphingosine, andS-1-P (36, 42). The D. discoideum genome encodes homologsto the genes encoding the enzymes of this pathway found inmammals (28), including the sphingomylinase, ceramidase,sphingosine kinase, S-1-P phosphatase, and S-1-P lyase en-zymes. The resistance of the S-1-P null mutant suggested thatthis pathway could be manipulated either pharmacologically orgenetically to increase drug sensitivity and that this informa-tion could ultimately be used to increase the efficacy of treat-

ment of human tumors that are resistant to cisplatin. Thestudies described here confirm the idea that this pathway rep-resents new targets for modulating cisplatin action.

The increased resistance of the sglA� mutant to cisplatinsuggested that this was due to an increase in S-1-P. Thus, wepredicted that either increasing the level of the SglA protein orreducing the activity of the sphingosine kinases would makecells more sensitive to cisplatin. Indeed, overexpression of theS-1-P lyase as well as inhibition of the sphingosine kinases hasvalidated these predictions and strongly suggests that it is thelevel of S-1-P that ultimately modulates drug sensitivity. Theisolation of three stable sglAOE strains that produce differentlevels of the SglA protein allowed us to show that the level ofexpression parallels the level of increased cisplatin sensitivity.The sglAOE-1 strain with the highest level of SglA overexpres-sion was up to 10-fold more sensitive to cisplatin. Consistentwith this result is a recent report that overexpression of S-1-Plyase in HEK-293 cells resulted in increased stress-inducedapoptosis (38).

The sglAOE strains also exhibit an expression-dependentdecrease of growth rate and stationary phase density and anincrease in the average number of nuclei per cell. The increasein the number of nuclei per cell may be related to a decreasein the rate of cytokinesis, which would account for the slowergrowth rate. Whether the decrease in growth rate directlyrelates to an increase in drug sensitivity remains to be deter-mined. A similar decrease in cell growth rate has been ob-served in HEK-293 cells overexpressing the S-1-P lyase gene(38), and yeast lacking the sphingosine kinase gene are delayedfrom entering S phase (12). The level of protein in the threesglAOE strains that was detected by Western blotting is notprecisely linear with the increases in drug sensitivity or growthrate, but it is possible that the signaling systems affected be-come saturated so that additional expression has no effect.

Treating the cells with the sphingosine kinase inhibitor DMSessentially mimicked the phenotype of the sglAOE strains andshowed that modulating the activity of the sphingosine kinaseshas the predicted effect of also making cells more sensitive tocisplatin. Experiments are in progress with sphingosine kinasenull mutants to further test this idea.

The data on the direct addition of S-1-P further strengthensthe idea that the pathway of S-1-P synthesis and degradation isintimately involved in modulating the cellular response to cis-platin. Exogenous addition of S-1-P renders the cells moreresistant to cisplatin in a manner similar to that of the increasein resistance we observed in the sglA� mutant. It was previ-ously shown that exogenous addition of S-1-P to developingDictyostelium cells can mimic the aberrant developmental phe-notype of the sglA� mutant (19). S-1-P most likely functionsintracellularly after uptake by pinocytosis, because there are noobvious homologs of the G-protein-coupled EDG receptors(S1P receptors) in D. discoideum. This also supports the ideathat the changes in cisplatin sensitivity observed in the sglA�and sglAOE mutants are due to S-1-P acting as an intracellularsecond messenger, a function demonstrated in mammaliancells by overexpression of the sphingosine kinase gene inmouse cells lacking the receptors (32).

cAMP has been reported to activate sphingosine kinase (25),and the addition of 8-Br-cAMP to cells had the predicted effectof increasing resistance to cisplatin. It is important to note that

FIG. 8. Pretreatment with 8-Br-cAMP increases resistance of cellsensitivity to cisplatin. Growing cultures of 106 cell/ml in HL5 mediumwere treated with 0, 2, and 5 mM 8-Br-cAMP for 1 h prior to theaddition of 150 �M cisplatin. Viability and strain names are as de-scribed in the legend to Fig. 4. Closed circles, 150 �M cisplatin withincreasing concentrations of 8-Br-cAMP. Open circles, increasing con-centrations of 8-Br-cAMP alone.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

in a previous paper it was shown that deletion of the regAcAMP phosphodiesterase resulted in increased cisplatin resis-tance (20), and this is in agreement with the discovery that theyeast PDE2 null cells are cisplatin resistant. Thus, cAMP mayalso be signaling through protein kinase A to modulate cispla-tin resistance.

All the previous data show that increasing the S-1-P lyase ordecreasing the sphingosine kinase results in altered sensitivityto cisplatin. Consistent with this, sphingosine kinase mRNAhas been shown to be overexpressed in a variety of solid tumors(6). This suggests that cotreatment with cisplatin and com-pounds that lower the levels of S-1-P in cells could result inincreased antitumor activity of cisplatin. Cisplatin is generallyused in therapy at the maximum allowable dose, and thereforeits dosage cannot be increased to treat resistant tumors. Thus,DMS or other sphingosine kinase inhibitors could be useful incombination with cisplatin to increase its efficacy in antitumortherapy—either with tumors such as lymphomas, malignantmelanoma, and prostate cancer that do not respond to treat-ment or in cases such as ovarian tumors that initially respondand then become more resistant (33). Additional sphingosinekinase inhibitors have been reported recently (6), and oneinhibitor, phenoxodiol, has been shown to promote apoptosis

in ovarian cancer cells (13). Other enzymes of the pathway ofsphingosine metabolism conceivably could also be targeted forthe purpose of increasing cisplatin sensitivity.

Cross-resistance to drugs is an important aspect of chemo-therapy, and it can limit the options for treatment. The spec-ificity of this pathway for the sensitivity to cisplatin is intrigu-ing. The sglAOE strains also showed increased sensitivity forthe related platinum drug carboplatin but, interestingly, didnot show increased sensitivity for other drugs that we tested.Carboplatin is a closely related derivative of cisplatin, whichundergoes aquation and has the same platination nucleotidespecificity as cisplatin (37). Therefore, it was expected thatchanging sensitivity to cisplatin would change sensitivity tocarboplatin as well, although its toxicity level to wild-type cellsis less than that of cisplatin. Indeed, the sglAOE cells are moresensitive to carboplatin and the sglA� cells are more resistant.It will be interesting to see if this relationship holds for themany cisplatin analogs, which have a wide range of toxicitiesand structures (31). In contrast to the platinum drugs, thesglAOE and sglA� cells did not show altered sensitivity todoxorubicin (DNA intercalator and topoisomerase II inhibitor[2, 5]), 5-FU (inhibits thymidylate synthase and incorporationof fluordeoxyuridine triphosphates into DNA [22]), and eto-

FIG. 9. Schematic model of the interactions that address the specificity of the resistance of cells to cisplatin with respect to sphingolipidsignaling.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

poside (topoisomerase II inhibitor [35]). Thus, although allthree drugs affect DNA metabolism and structure, the result-ing cell death does not appear to be modulated by the level ofS-1-P lyase. Consistent with this, it was previously shown thatthe sglA� mutant did not show significant cross-resistance toUV light, the alkylating agent methylmethane sulfonate, orH2O2 (20).

Two major issues arise from these studies: (i) how do sphin-golipids affect the cellular response to cisplatin, and (ii) howcan these interactions account for the specificity for cisplatin.These questions are particularly important for translating theresults from a model system, like D. discoideum, to humantumor cells. Figure 9 presents a model that aims to addressthese questions and makes predictions for further experiments.

Cisplatin exerts its cytotoxic effect by causing damage toDNA. The DNA damage is recognized by a host of enzymes—some that will target the lesions for repair and others that willtarget the cell to die. Damaged DNA-dependent protein ki-nases activate a cascade of signaling that ultimately activatesthe mitogen-activated protein (MAP) kinase family of pro-teins, including the MAP kinase ERK family as well as thestress-activated protein kinases of the JNK and p38 families. Ithas been suggested that the relative balance between p38-JNKand ERK determines the response to cisplatin (40).

The lipids ceramide and S-1-P have also been shown toregulate these MAP kinases. Ceramide activates JNK and p38and inhibits ERK, while S-1-P activates ERK and downregu-lates the stress activated enzymes JNK and p38, such that thebalance between the MAP kinases reflects the lipids rheostat(4). Thus, in a cell treated with a lethal dose of cisplatin thebalance between ceramide and S-1-P usually favors the activa-tion of the p38-JNK enzymes and results in cell death. Basedon this model, interfering with the balance of these lipidseither by overexpression of the S-1-P lyase or by inhibiting thesphingosine kinase (both of which should result in reducedlevels of S-1-P) would increase cell death. In contrast, deletingthe S-1-P lyase, activating sphingosine kinase, or adding exog-enous S-1-P should result in the downregulation of the JNK-p38-related proteins and in the upregulation of ERK andshould result in decreased sensitivity to the drug (34).

The specificity of the sphingolipid pathway for regulatingsensitivity to cisplatin can be attributed to several elements ofthis model. (i) The cytotoxic effect of cisplatin, but not doxo-rubicin or taxol, is mediated primarily through p38 (23). (ii)protein kinase C, phosphatidylinositol 3-kinase, and Akt-PKBare all upregulated by S-1-P (4) and have been linked to cis-platin resistance (11, 40, 46). (iii) Glutathione S-transferase isupregulated by ERK (44). Glutathione S-transferase, in turn,acts as an inhibitor of JNK in addition to interacting withglutathione to directly inactivate cisplatin (10, 14).

Overall, the hypothesis emerging from these studies is thateven though the sphingolipid pathway is involved in the re-sponse to a number of stresses, the sensitivity of cells to dif-ferent chemotherapeutic agents may be independently con-trolled. It is possible that some of these behaviors will end upbeing cell type and/or drug specific, but together these findingsare of considerable significance for the planning of therapeuticstrategies when a particular drug is found to be ineffective. Weare presently translating the findings of this study to mamma-lian cells.

ACKNOWLEDGMENTS

This work was supported by NIH grants GM53929 and CA95872.We thank Jason Edward for assistance during his undergraduate

internship (College of Arts and Science Undergraduate ResearchMentor Program). We also thank the Dictyostelium cDNA sequencingproject in Tsukuba, Japan (30), for clones throughout the course ofthis work and the Baylor/Sanger/Jena multinational DictyosteliumDNA sequencing consortium for sequence data (http://www.dictybase.org).

REFERENCES

1. Alexander, H., A. N. Vomund, and S. Alexander. 2003. Viability assay forDictyostelium for use in drug studies. BioTechniques 35:464–470.

2. Arcamone, F. 1981. Doxorubicin anticancer antibiotics, medicinal chemistry,a series of monographs, vol. 17. Academic Press, New York, N.Y.

3. Burger, H., A. Capello, P. W. Schenk, G. Stoter, J. Brouwer, and K. Nooter.2000. A genome-wide screening in Saccharomyces cerevisiae for genes thatconfer resistance to the anticancer agent cisplatin. Biochem. Biophys. Res.Commun. 269:767–774.

4. Cuvillier, O., G. Pirianov, B. Kleuser, P. G. Vanek, O. A. Coso, S. Gutkind,and S. Spiegel. 1996. Suppression of ceramide-mediated programmed celldeath by sphingosine-1-phosphate. Nature 381:800–803.

5. Doroshow, J. H. 1996. Anthracyclines and anthracenediones, p. 500–537. InB. A. Chabner and D. L. M. Longo (ed.), Cancer chemotherapy and bio-therapy: principles and practice, 3rd ed. Lippincott Williams and Wilkins,Philadelphia, Pa.

6. French, K. J., R. S. Schrecengost, B. D. Lee, Y. Zhuang, S. N. Smith, J. L.Eberly, J. K. Yun, and C. D. Smith. 2003. Discovery and evaluation ofinhibitors of human sphingosine kinase. Cancer Res. 63:5962–5969.

7. Gottlieb, D., W. Heideman, and J. D. Saba. 1999. The DPL1 gene is involvedin mediating the response to nutrient deprivation in Saccharomyces cerevi-siae. Mol. Cell. Biol. Res. Commun. 1:66–71.

8. Herr, D. R., H. Fyrst, V. Phan, K. Heinecke, R. Georges, G. L. Harris, andJ. D. Saba. 2003. Sply regulation of sphingolipid signaling molecules isessential for Drosophila development. Development 130:2443–2453.

9. Ishida, S., J. Lee, D. J. Thiele, and I. Herskowitz. 2002. Uptake of theanticancer drug cisplatin mediated by the copper transporter Ctr1 in yeastand mammals. Proc. Natl. Acad. Sci. USA 99:14298–14302.

10. Ishikawa, T. 1992. The ATP-dependent glutathione S-conjugate exportpump. Trends Biochem. Sci. 17:463–468.

11. Isonishi, S., K. Ohkawa, T. Tanaka, and S. B. Howell. 2000. Depletion ofprotein kinase C (PKC) by 12-O-tetradecanoylphorbol-13-acetate (TPA)enhances platinum drug sensitivity in human ovarian carcinoma cells. Br. J.Cancer 82:34–38.

12. Jenkins, G. M., and Y. A. Hannun. 2001. Role for de novo sphingoid basebiosynthesis in the heat-induced transient cell cycle arrest of Saccharomycescerevisiae. J. Biol. Chem. 276:8574–8581.

13. Kamsteeg, M., T. Rutherford, E. Sapi, B. Hanczaruk, S. Shahabi, M. Flick,D. Brown, and G. Mor. 2003. Phenoxodiol—an isoflavone analog—inducesapoptosis in chemoresistant ovarian cancer cells. Oncogene 22:2611–2620.

14. Kartalou, M., and J. M. Essigmann. 2001. Mechanisms of resistance tocisplatin. Mut. Res. Fund. Mol. Mech. Mutagen. 478:23–43.

15. Kay, R. R. 1989. Evidence that elevated intracellular cyclic AMP triggersspore maturation in Dictyostelium. Development 105:753–759.

16. Kihara, A., M. Ikeda, Y. Kariya, E. Y. Lee, Y. M. Lee, and Y. Igarashi. 2003.Sphingosine-1-phosphate lyase is involved in the differentiation of F9 em-bryonal carcinoma cells to primitive endoderm. J. Biol. Chem. 278:14578–14585.

17. Kuspa, A., and W. F. Loomis. 1992. Tagging developmental genes in Dic-tyostelium by restriction enzyme-mediated integration of plasmid DNA.Proc. Natl. Acad. Sci. USA 89:8803–8807.

18. Leiting, B., I. J. Lindner, and A. A. Noegel. 1990. The extrachromosomalreplication of Dictyostelium plasmid Ddp2 requires a cis-acting element anda plasmid-encoded trans-acting factor. Mol. Cell. Biol. 10:3727–3736.

19. Li, G., C. Foote, S. Alexander, and H. Alexander. 2001. Sphingosine-1-phosphate lyase has a central role in the development of Dictyosteliumdiscoideum. Development 128:3473–3483.

20. Li, G. C., H. Alexander, N. Schneider, and S. Alexander. 2000. Molecularbasis for resistance to the anticancer drug cisplatin in Dictyostelium. Micro-biology 146:2219–2227.

21. Lin, X., T. Okuda, A. Holzer, and S. B. Howell. 2002. The copper transporterCTR1 regulates cisplatin uptake in Saccharomyces cerevisiae. Mol. Pharma-col. 62:1154–1159.

22. Longley, D. B., D. P. Harkin, and P. G. Johnston. 2003. 5-Fluorouracil:mechanisms of action and clinical strategies. Nat. Rev. Cancer 3:330–338.

23. Losa, J. H., C. P. Cobo, J. G. Viniegra, V. J. Sanchez-Arevalo Lobo, S.Ramon y Cajal, and R. Sanchez-Prieto. 2003. Role of the p38 MAPK path-way in cisplatin-based therapy. Oncogene 22:3998–4006.

24. Maceyka, M., S. G. Payne, S. Milstien, and S. Spiegel. 2002. Sphingosine



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

kinase, sphingosine-1-phosphate, and apoptosis. Biochim. Biophys. Acta1585:193–201.

25. Machwate, M., S. B. Rodan, G. A. Rodan, and S. I. Harada. 1998. Sphin-gosine kinase mediates cyclic AMP suppression of apoptosis in rat periostealcells. Mol. Pharmacol. 54:70–77.

26. Manstein, D. J., H. P. Schuster, P. Morandini, and D. M. Hunt. 1995.Cloning vectors for the production of proteins in Dictyostelium discoideum.Gene 162:129–134.

27. Mendel, J., K. Heinecke, H. Fyrst, and J. D. Saba. 2003. Sphingosine phos-phate lyase expression is essential for normal development in Caenorhabditiselegans. J. Biol. Chem. 278:22341–22349.

28. Merrill, A. H., Jr. 2002. De novo sphingolipid biosynthesis: a necessary, butdangerous, pathway. J. Biol. Chem. 277:25843–25846.

29. Morii, T., and L. Weissbach. 2003. Sphingosine 1-phosphate and cell migra-tion: resistance to angiogenesis inhibitors. Biochem. Biophys. Res. Commun.310:884–888.

30. Morio, T., H. Urushihara, T. Saito, Y. Ugawa, H. Mizuno, M. Yoshida, R.Yoshino, B. N. Mitra, M. Pi, T. Sato, K. Takemoto, H. Yasukawa, J. Wil-liams, M. Maeda, I. Takeuchi, H. Ochiai, and Y. Tanaka. 1998. The Dictyo-stelium developmental cDNA project: generation and analysis of expressedsequence tags from the first-finger stage of development. DNA Res. 5:335–340.

31. Najajreh, Y., J. M. Perez, C. Navarro-Ranninger, and D. Gibson. 2002.Novel soluble cationic trans-diaminedichloroplatinum(II) complexes thatare active against cisplatin resistant ovarian cancer cell lines. J. Med. Chem.45:5189–5195.

32. Olivera, A., H. M. Rosenfeldt, M. Bektas, F. Wang, I. Ishii, J. Chun, S.Milstien, and S. Spiegel. 2003. Sphingosine kinase type 1 induces G12/13-mediated stress fiber formation, yet promotes growth and survival indepen-dent of G protein-coupled receptors. J. Biol. Chem. 278:46452–46460.

33. Perry, M. C. (ed.). 1997. The chemotherapy source book, 2nd ed. Williams& Wilkins, Baltimore, Md.

34. Pitson, S. M., P. A. B. Moretti, J. R. Zebol, H. E. Lynn, P. Xia, M. A. Vadas,and B. W. Wattenberg. 2003. Activation of sphingosine kinase 1 by ERK1/2-mediated phosphorylation. EMBO J. 22:5491–5500.

35. Pommier, Y. G., F. Goldwasser, and D. Strumberg. 2001. Topoisomerase II

inhibitors: epipodophyllotoxins, acridines, ellipticines, and bisdioxopepera-zines, p. 538–578. In B. A. Chabner and D. L. Longo (ed.), Cancer chemo-therapy and biotherapy: principles and practice, 3rd ed. Lippincott Williamsand Wilkins, Philadelphia, Pa.

36. Pyne, S. 2002. Cellular signaling by sphingosine and sphingosine 1-phos-phate. Their opposing roles in apoptosis, p. 245–268. In A. Quinn and A.Kagan (ed.), Phospholipid metabolism in apoptosis, vol. 36. Kluwer Aca-demic/Plenum, New York, N.Y.

37. Reed, E. 2001. Cisplatin and analogs, p. 447–465. In B. A. Chabner and D. L.Longo (ed.), Cancer chemotherapy and biotherapy: principles and practice,3rd ed. Lippincott Williams and Wilkins, Philadephia, Pa.

38. Reiss, U., B. Oskouian, J. Zhou, V. Gupta, P. Sooriyakumaran, S. Kelly, E.Wang, A. H. Merrill, Jr., and J. D. Saba. 2003. Sphingosine-phosphate lyaseenhances stress-induced ceramide generation and apoptosis. J. Biol. Chem.279:1281–1290.

39. Saran, S., M. E. Meima, E. Alvarez-Curto, K. E. Weening, D. E. Rozen, andP. Schaap. 2002. cAMP signaling in Dictyostelium. Complexity of cAMPsynthesis, degradation and detection. J. Muscle Res. Cell Motil. 23:793–802.

40. Siddik, Z. H. 2003. Cisplatin: mode of cytotoxic action and molecular basisof resistance. Oncogene 22:7265–7279.

41. Spiegel, S., D. English, and S. Milstien. 2002. Sphingosine 1-phosphatesignaling: providing cells with a sense of direction. Trends Cell Biol. 12:236–242.

42. Spiegel, S., and S. Milstien. 2002. Sphingosine 1-phosphate, a key cell sig-naling molecule. J. Biol. Chem. 277:25851–25854.

43. Sussman, M. 1987. Cultivation and synchronous morphogenesis of Dictyo-stelium under controlled experimental conditions. Methods Cell Biol. 28:9–29.

44. Townsend, D. M., and K. D. Tew. 2003. The role of glutathione-S-transferasein anti-cancer drug resistance. Oncogene 22:7369–7375.

45. van Veldhoven, P. P., and G. P. Mannaerts. 1993. Sphingosine-phosphatelyase. Adv. Lipid Res. 26:69–98.

46. Yuan, Z. Q., R. I. Feldman, G. E. Sussman, D. Coppola, S. V. Nicosia, andJ. Q. Cheng. 2003. AKT2 inhibition of cisplatin-induced JNK/p38 and Baxactivation by phosphorylation of ASK1: implication of AKT2 in chemoresis-tance. J. Biol. Chem. 278:23432–23440.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

Overexpression of Sphingosine-1-Phosphate Lyase or Inhibition of … · S-1-P lyase. The...

Documents

Transcript of Overexpression of Sphingosine-1-Phosphate Lyase or Inhibition of … · S-1-P lyase. The...