Optimal preservation of liver biopsy samples for downstream translational applications

ORIGINAL ARTICLE

Optimal preservation of liver biopsy samples for downstreamtranslational applications

Alana R. Sherker • Vera Cherepanov •

Zahra Alvandi • Ryan Ramos • Jordan J. Feld

Received: 11 September 2012 / Accepted: 15 January 2013 / Published online: 12 February 2013

� Asian Pacific Association for the Study of the Liver 2013

Abstract

Objective: Molecular analysis of liver biopsy samples

from patients requires ideal tissue preservation and handling

to yield suitable material for laboratory analysis. Biopsy size,

tissue handling and preservation method all may affect the

quality and quantity of DNA, RNA and protein that can be

extracted from liver biopsy samples.

Method: In the present study, murine liver biopsies were

performed and stored under various conditions: snap-freez-

ing, RNAlater and Allprotect. Yield was compared to fresh

biopsy tissue.

Results: Fresh tissue generated the highest yield of RNA

while samples subjected to the snap-freezing generated the

lowest yield of RNA. Preservation in RNAlater yielded

higher quantities of RNA than storage in Allprotect, par-

ticularly with larger biopsy samples. There was a non-

significant trend toward improved RNA quality with

RNAlater (p = 0.35). DNA and protein yield were similar

with RNAlater and Allprotect under a number of handling

condition. Errors in tissue handling such as delays in tissue

submersion or freezing did not significantly affect tissue

yields in either preservation solution. Tissue yield was

unchanged with up to three freeze-thaw cycles in both

solutions. Biopsy size (5 vs 2 mm) and width (15 vs 18 g)

had a marked effect on tissue yield.

Conclusion: Ideally 5-mm biopsies with 15-gauge nee-

dles should be used to maximize yield. RNAlater provided

higher RNA yield with similar yields of DNA and protein

and was notably cheaper and easier to handle.

Keywords Liver biopsy preservation � RNAlater �Allprotect � RNA integrity

Introduction

Molecular analysis of liver biopsy tissue is often required for

translational research studies. Although various approaches

have been evaluated, there is no standardized method of

preserving tissue at the bedside to ensure high-quality sam-

ples make it to the laboratory. Samples left at room tem-

perature are subject to RNases, DNases and proteinases,

resulting in degradation. The traditional preservation tech-

nique employed has been the snap-freeze method. However,

this approach requires the use of liquid nitrogen at the

patient’s bedside, and samples must remain frozen during

transit in order to protect the tissue from degradation. Many

investigators have been disappointed with low-yield, poor-

quality results from snap-frozen tissue, particularly when

Electronic supplementary material The online version of thisarticle (doi:10.1007/s12072-013-9423-6) contains supplementarymaterial, which is available to authorized users.

A. R. Sherker (&) � V. Cherepanov � Z. Alvandi � R. Ramos �J. J. Feld

University Health Network, McLaughlin-Rotman Centre for

Global Health, Toronto General Research Institute, University of

Toronto, Toronto, Canada

e-mail: [email protected]

V. Cherepanov


Z. Alvandi


R. Ramos


J. J. Feld


J. J. Feld

Toronto Western Hospital Liver Centre, 399 Bathurst Street 6B

FP Rm 158, Toronto, ON M5T 2S8, Canada

123

Hepatol Int (2013) 7:758–766

DOI 10.1007/s12072-013-9423-6

http://dx.doi.org/10.1007/s12072-013-9423-6

RNA is required for analysis. Furthermore, snap-freezing is

quite cumbersome.

The commercial products RNAlater (Qiagen) and All-

protect (Qiagen) were developed in order to facilitate

preservation of tissue samples [1, 2]. Biopsies can be

submerged directly in either RNAlater or Allprotect and

left at room temperature for up to 1 week at 4 �C, for up to

6 months at -20 �C or at -80 �C for archival storage [1,

2]. The mechanisms by which RNAlater and Allprotect

protect the tissue from degradation are different. The All-

protect molecule has contact points, which envelop the

tissue and protect it from degradation [2]. Once the tissue is

submerged in Allprotect, a protective viscous layer engulfs

the tissue and makes it difficult to manipulate. RNAlater

contains an aqueous sulfate salt solution with a controlled

pH that precipitates RNases and other soluble proteins [1,

3]. Both solutions denature proteins and are therefore only

appropriate for use in experiments that do not require their

tertiary or quaternary structure or functionality [1, 2].

In addition to the method of preservation, other factors

can affect the yield and quality of tissue for analysis.

Ideally, tissue would be preserved immediately and remain

undisturbed until it is analyzed; however, this may not

always be possible. There may be delays in submerging

tissue in the preservation solution or transferring the pre-

served tissue to the freezer. Tissue may also be freeze–

thawed on multiple occasions if it is stored in individual

pieces rather than aliquots. How these factors affect tissue

quality and quantity and whether one preservation tech-

nique performs better under these conditions is currently

unknown. We evaluated the effects of different preserva-

tion approaches and different handling techniques on the

yield of RNA, DNA and protein from liver biopsy speci-

mens to clarify how precious patient samples should best

be preserved.

Methods and materials

Liver samples

Five mice (C57BL/6) were killed by exposure to a carbon

dioxide chamber for 5 min. The livers were excised and

samples (taken in triplicate) were collected and stored in

RNAlater or Allprotect or snap-frozen in liquid nitrogen

with subsequent nucleic acid and protein extraction. The

yield and quality of RNA, DNA and protein extraction was

compared in the preservation solutions to a fresh sample

extracted immediately after biopsy. The ability of RNA-

later and Allprotect to preserve tissue was also compared

between samples of different size and from samples

exposed to delays at various steps of tissue handling. To

assess the importance of biopsy length, samples were cut

with a scalpel and measured to be 5 9 1 or 2 9 1 mm

prior to being placed in RNAlater or Allprotect. To assess

the importance of biopsy width, samples obtained with a

Klatskin 15-gauge liver biopsy needle (Thermo) were

compared to those obtained with an 18-gauge Thermo

biopsy gun (B–D). Once the biopsy had been performed,

samples were immediately put in RNAlater or Allprotect.

In the assessment of the effects of tissue handling, 5 9 1-

mm biopsy samples were used. The effect of a delay in

submerging the tissue in preservation solution was com-

pared by leaving the liver sample out of solution for 0, 30

or 120 min. To assess the effect of a delay in freezing after

tissue submersion, liver samples were placed in RNAlater

or Allprotect immediately but were then left at room

temperature for 0, 8 or 24 h prior to freezing at -80 �C.

Finally, the effect of freeze-thaw cycles was assessed by

thawing and re-freezing samples stored in RNAlater or

Allprotect 0, 1 or 3 times prior to extraction.

Storage

Following the biopsy, samples were either stored in

RNAlater or Allprotect. For samples stored in RNAlater,

10 ll of RNAlater was used per 1 mg of liver tissue.

Samples were less that 0.5 cm thick in order to ensure

proper diffusion of RNAlater through the liver tissue.

Samples were immediately put on ice (unless otherwise

specified by the condition) and frozen at -80 �C according

to the manufacturer’s instructions. For samples stored in

Allprotect, 100 ll of buffer was used per 10 mg of liver

tissue. Samples were immediately put on ice (unless

otherwise specified) and transferred to -80 �C as specified

in the manufacturer’s instructions. Because of its extremely

viscous nature, a dispenser pump was used to aliquot

Allprotect.

DNA/RNA/protein extraction

AllPrep extraction kit was used to allow for extraction of

DNA, RNA and protein from each tissue sample following

the manufacturer’s instructions. Briefly, buffer RLT was

added to the samples, and they were then homogenized

with an electrical biovortexer. Following homogenization,

samples were spun down at full speed for 3 min. The

supernatant was collected and transferred to the AllPrep

DNA spin column. The column was stored on ice until the

DNA extraction step, when the column was washed with

buffers AW1 and AW2 and eluted with 100 ll of buffer

EB. Ethanol was added to the flow through which was

mixed and transferred to the RNAeasy spin column. The

flow-through from the RNAeasy column was stored for

protein purification while the column was washed with

buffer RW1 and RPE. RNA was eluted from the RNAeasy

Hepatol Int (2013) 7:758–766 759

123

column in 50 ll of RNase-free water. Buffer APP was

added to the flow-through kept for protein purification.

After incubation, the sample was spun down, and a large

protein pellet was washed with ethanol. The protein pellet

was partially dissolved in 8 M urea and 49 SDS with beta-

mercaptoethanol. The sample was boiled for 5 min, and the

supernatant was stored at -20 �C until it was used for

protein analysis.

RNA analysis

RNA was extracted from the liver biopsies and analyzed for

quality and quantity. Extracted RNA was treated with DNase

to remove contaminating genomic DNA. RNA concentration

(ng/ml) was measured using Nanodrop2000 Spectrophotom-

eter (Thermo Scientific). An equal volume of eluted RNA

from each sample was converted to cDNA and quantified

using real-time quantitative PCR (qPCR) for GAPDH. Mouse

GAPDH standard copies were run in triplicate and used to

calculate unknown mouse GAPDH copies. RNA quality was

assessed using the Agilent 2100 Bioanalyzer (Agilent Tech-

nologies, USA). Using a very small amount of RNA (200 pg),

samples are separated on a micro-fabricated chip electro-

phoretically and then detected using laser-induced florescence

[4]. The RNA generates peaks corresponding to the 18 and

28 s rRNA as well as a small peak corresponding to the 5 s [4].

Based on the shape of the electrophoretogram, the quality and

ratio of the peaks, an RNA Integrity Number or RIN, ranging

from 1 to 10 is assigned. The most intact RNA is assigned a

RIN of 10, while a RIN of 1 corresponds to highly degraded

RNA [5]. RIN values of at least 5 are required for downstream

applications such as microarray. RNA was also run on a 1 %

agarose gel in order to see the degree of degradation of the 28S

and 18S subunits.

DNA analysis

Extracted DNA was analyzed for quantity and quality. The

concentration of DNA (ng/ml) was measured using nano-

drop. DNA was then run on a 1 % agarose gel to assess

quality. QPCR was performed on the DNA with mouse

GAPDH primers that amplified genomic DNA: forward

primer: ACCCAGAAGACTGTGGATGG (20 nt); reverse

primer: ACACATTGGGGGTAGGAACA (20 nt).

Protein analysis

The protein pellet obtained using the AllPrep extraction

method was insoluble. However, by using 8 M urea and 49

SDS with beta-mercaptoethanol, a sufficient amount of

protein was resuspended. Total protein yield was assessed

using a Coomassie Blue gel. Standard concentrations of

BSA were run on the gel as well to estimate absolute

protein concentration. Protein was also analyzed by Wes-

tern blot for actin.

Results

RNAlater vs. AllProtect

RNA preservation

The yield of RNA and DNA from 5-mm biopsy samples

stored in RNAlater, Allprotect or snap-frozen in liquid

nitrogen was compared. A fresh biopsy sample subjected to

immediate extraction served as a measure of maximal yield.

Both RNAlater and Allprotect preserved RNA better than

snap-freezing (RNAlater 2,415 ± 1,242 vs. snap-freezing

210 ± 35 copies of GAPDH, p = 0.002; Allprotect 1,137

± 310 vs. snap-freezing 210 ± 35 copies of GAPDH,

p = 0.0095). Although RNAlater showed a higher yield

than Allprotect, the differences were not statistically sig-

nificant (p = 0.48) (Fig. 1a). Results were similar with

nanodrop, confirming higher RNA concentration with

RNAlater or AllProtect compared to snap-freezing (data not

shown). Notably, results were improved in all conditions

with DNase I treatment of the RNA prior to cDNA synthesis

to remove genomic DNA contamination. Because of the

low RNA yield with snap-freezing, only RNAlater and

Allprotect were compared for subsequent analyses.

To assess RNA quality, RNA was both visualized on a

1 % agarose gel and assessed using the Agilent 2100

Bioanalyzer. Biopsy samples had an average RIN of

6.7 ± 0.04 with Allprotect and 7.4 ± 0.6 with RNAlater

(Fig. 1b) (p = 0.35). Although the concentration of RNA

obtained from biopsy samples stored in Allprotect was

somewhat lower than that from samples stored in RNA-

later, both preservation solutions preserved RNA with

adequate integrity for downstream applications (Fig. 1b).

DNA preservation

DNA yield was evaluated by measurement of DNA con-

centration by nanodrop and DNA quantity by qPCR for

GAPDH. There were no significant differences in DNA yield

between samples stored in RNALater, AllProtect or snap-

freezing, with all preservation techniques leading to similar

yield compared to fresh tissue (Fig. 1c). Samples were run on

a 1 % agarose gel, which confirmed high-quality DNA with

all methods of preservation (data not shown).

Protein preservation

After nucleic acid extraction, biopsy samples were sub-

jected to protein extraction. The samples generated a

760 Hepatol Int (2013) 7:758–766

123

highly insoluble pellet that was partially solubilized in 8 M

urea. Total protein yield was analyzed by SDS-PAGE

followed by Coomassie Blue staining. Western blotting for

mouse actin was also performed. Protein yield was similar

with both preservation solutions but consistently slightly

higher from the samples stored in RNAlater compared to

those stored in Allprotect (Figs. 3a, b, 4b, c and 5b, c).

Effects of biopsy size

Biopsy size

Because biopsy size has a marked effect on the reliability

of histological evaluation, the majority of biopsy samples

are sent to pathology with only a small amount of tissue

saved for research. To determine the effect of biopsy length

on nucleic acid and protein yield, biopsy specimens of 5

and 2 mm length were compared. RNA yield was assessed

by RNA concentration and qPCR for GAPDH using equal

volumes of extracted RNA. With storage in RNAlater, the

RNA yield from the 5 and 2 mm samples was approxi-

mately proportional to the difference in biopsy size (2.3

fold). However, with Allprotect, the RNA yield from the

5-mm sample was very similar to that from the 2 mm

sample (1.1 fold). On direct comparison, there was 1.9-fold

more RNA recovered from 5-mm samples stored in

RNAlater than from those stored in Allprotect (Fig. 2a).

Data from nanodrop measurement of RNA concentration

paralleled the qPCR results (data not shown).

In addition to biopsy length, the biopsy width may vary

because of the size of the various needles used for liver

biopsy. Similar to the data on biopsy length, RNA yield

was proportional to biopsy width in samples stored in

RNAlater but not in those stored in Allprotect, and the

yield was higher (2.6 fold) with RNAlater on direct com-

parison of the 15-gauge biopsy samples (Fig. 2b).

RNA

Biopsy size also affected RNA quality. Biopsies of 2 mm

in length yielded RNA of lower quality (RIN 5.3 ± 0.15

for 2 mm vs. RIN 7.3 ± 0.32 for 5 mm, p = 0.014).

Biopsy width was less important than length with adequate

RIN values in both 15- and 18-gauge 5-mm biopsy speci-

mens (data not shown).

DNA

In contrast to the results with RNA, DNA yield was slightly

better with Allprotect than with RNAlater, particularly in

the smaller biopsy samples; however, the differences were

not significant. As expected, the 2-mm samples yielded less

DNA than the 5-mm samples (Fig. 2c). Similarly, the

biopsies performed with a 15-gauge needle yielded more

Fig. 1 RNA and DNA yield

with different liver preservation

techniques. Liver biopsy

samples of 5 mm of murine

liver were subjected to various

preservation techniques: fresh

tissue extraction (lined),

RNAlater (black), Allprotect

(white) and snap-freeze (grey).

Each preservation technique

was performed in triplicate.

a DNase-treated RNA was used

as a template for cDNA

synthesis. The cDNA was

subjected to qPCR for

quantification. b RNA integrity

was measured using an Agilent

2100 Bioanalyzer and assigned

an RNA Integrity Number

(RIN). High RIN values indicate

higher quality RNA. c Genomic

DNA was analyzed by qPCR

using GAPDH standard copies.

Samples were compared using

Student’s t test. **p \ 0.01

Hepatol Int (2013) 7:758–766 761

123

DNA than those performed with an 18-gauge needle

(Fig. 2d). DNA obtained from liver biopsy samples was

run on 1 % agarose gel, and trends were similar to the

results from qPCR (data not shown).

Protein

As expected, total protein yield was higher in the longer

(5 mm) and wider (15 g) biopsy samples (Fig. 3a–d).

However, biopsy width appeared to have a greater effect,

with very low protein yields from the 18-gauge samples.

Protein yield was adequate with both preservation solu-

tions, but consistently slightly higher from the samples

stored in RNAlater compared to those stored in Allprotect

(Fig. 3a–d).

Effects of tissue handling

Ideally, tissue is submerged into the preservation solution

(either RNAlater or Allprotect) immediately after the

biopsy is taken and then transferred to -80 �C for long-

term storage. To determine the effects of delays in tissue

submersion, samples were left out of solution at room

temperature for 30 or 120 min prior to submersion in either

Allprotect or RNAlater. Consistent with previous results,

RNA yield was higher from the samples stored in RNA-

later than from those stored in Allprotect, but there was

relatively little RNA degradation (Fig. 4a). Samples left

out for 30 min had similar RIN values to those submerged

immediately. With a 120-min delay in submersion, there

appeared to be some loss of RNA integrity with Allprotect

but not with RNAlater (Supplementary Fig. 1); however,

biological replicates were pooled prior to RIN analysis, and

thus these RIN measurements represent only one reading

and comparisons should be interpreted with caution. DNA

yield was unaffected by leaving the tissue at room tem-

perature for up to 2 h (data not shown). Protein yield was

not affected by 30 min at room temperature but by 2 h,

there was a notable loss in protein yield, which was slightly

more pronounced in the samples stored in RNAlater

(Fig. 4b–c).

Samples were left at room temperature for 8 or 24 h

after submersion in Allprotect or RNAlater to assess the

effect of delays in freezing after tissue submersion. There

Fig. 2 Effect of sample length, needle gauge and preservation

solution on RNA and DNA yield. Liver biopsy samples of murine

liver were subjected to either RNAlater (black) or Allprotect (white).

a Nucleic acids were extracted from murine liver samples of 5 mm

length or 2 mm length or b using needles of 15 or 18 gauge. RNA

yield was compared between samples of each size and width in

RNAlater and Allprotect. RNA yield was determined by qPCR for

GADPH using equal volumes of eluted RNA for cDNA synthesis.

c Genomic DNA yield and preservation were compared between

samples of 5 or 2 mm and d samples of 15 or 18 gauge in RNAlater or

Allprotect. DNA was quantified using qPCR for GAPDH. Each

condition was performed in triplicate. Samples were compared using

Student’s t test. *p \ 0.05 **p \ 0.01

762 Hepatol Int (2013) 7:758–766

123

was no loss in RNA yield or integrity with delays in

freezing. In fact, samples stored in Allprotect that were left

at room temperature for 24 h prior to freezing had a higher

yield than those that were put on ice immediately (Fig. 5a).

DNA yield was unaffected by delays in freezing (data not

shown). Protein yield was greater with both solutions in

samples left for 24 h prior to freezing (Fig. 5b–c).

Effects of freeze–thaw

To determine the ability of both preservation solutions to

prevent sample degradation with freeze–thawing, yields

were compared after 0, 1 or 3 freeze–thaw cycles. Both

solutions prevented sample degradation with no effects on

RNA, DNA or protein yield or quality with up to three

freeze–thaw cycles (Fig. 6a–c).

Discussion

Determination of the optimal method for storage of liver

biopsy samples is critical to ensure that maximal yield of

nucleic acids and proteins is obtained from these precious

samples. A comparison of different preservation techniques

showed that storage in RNAlater offers advantages over

other approaches, particularly for RNA preservation.

When comparing the RNA yield from biopsy samples,

extraction from fresh tissue was used as a measure of

Fig. 4 Effect of delay in tissue

submersion on RNA and protein

yield. Murine liver biopsies of

5 mm in length were left at

room temperature for 0, 30 and

120 min prior to being

submerged in Allprotect or

RNAlater. Each condition was

performed in triplicate. a RNA

yield was assessed by qPCR for

GAPDH with equal volumes of

RNA used for cDNA synthesis.

b Protein yield was analyzed by

Coomasie Blue staining and

compared to albumin standards.

c Protein yield was also

evaluated by Western blot (WB)

for actin. Samples were

compared using Student’s t test.

*p \ 0.05

Fig. 3 Effect of sample length, needle gauge and preservation

solution on protein yield and quality. Protein was extracted from

biopsies of a 5 or 2 mm length or b from needles of 15 gauge or 18

gauge. Samples were preserved in RNAlater or Allprotect. Protein

yield was analyzed by Coomasie Blue staining and compared to

albumin standards. Protein yield was also assessed by immunoblot-

ting for mouse actin with evaluation of the c biopsy length, d width

and preservation solution

Hepatol Int (2013) 7:758–766 763

123

maximal yield. Storage in RNAlater provided better RNA

yield than Allprotect, but both solutions preserved RNA

much better than snap-freezing and led to less tissue

damage. Unlike the snap-freeze method, Allprotect and

RNAlater protect the liver biopsy from RNases, DNases

and proteinases by precipitating them out of solution [1, 2].

Although RNA yield was somewhat higher with RNA-

later than Allprotect, both solutions provided RNA of

adequate quality for downstream applications. The Agilent

2100 Bioanalyzer was used to quantify RNA integrity by

assigning an RIN value based on the shape of the elec-

trophoretogram of RNA run on a micro-fabricated chip [4].

Because of the high content of connective tissue in liver

biopsy samples, there is often a significant amount of RNA

degradation and large variability in RIN values due to

damage during extraction [6]. Both RNAlater and Allpro-

tect preserved RNA with RIN values reliably above 5, the

minimum required for downstream applications like

microarray analysis [4]. RIN values above 7 are optimal,

and although there was some variability, most of the

Fig. 5 Effect of delay in

freezing on RNA and protein


5 mm in length were submerged

in Allprotect or RNAlater and

left at room temperature for 0, 8

and 24 h. Each condition was

performed in triplicate. a RNA

yield was assessed by qPCR for

GAPDH with equal volumes of

RNA used for cDNA synthesis.


Coomasie blue staining and






*p \ 0.05

Fig. 6 Effect of freeze-thaw

cycles on RNA and protein


5 mm length were submerged in

Allprotect or RNAlater and

properly stored at -80 �C for

long-term storage. Samples

were subjected to 0, 1 or 3

freeze-thaw cycles. Each

condition was performed in

triplicate. a RNA yield was

assessed by qPCR for GAPDH

with equal volumes of RNA

used for cDNA synthesis.


Coomasie blue staining and






*p \ 0.05

764 Hepatol Int (2013) 7:758–766

123

samples achieved this level of RNA integrity with preser-

vation in either solution [4].

DNA is much more stable than RNA or protein, and this

was reflected in the high yield compared to fresh tissue

with any of the preservation techniques assessed. Protein

yield was also relatively consistent with the various

methods; however, it is notable that protein subjected to

Allprotect and RNAlater is denatured and is thus only

suitable for assays that do not require the structural integ-

rity of the protein such as Western blotting [1, 2]. Analysis

that requires quaternary structure or functional protein

activity should be done using either fresh tissue extraction

or the snap-freeze method. In general, RNA yield was

higher with storage in RNAlater compared to Allprotect;

however; the differences were relatively modest and likely

not significant for downstream applications.

In addition to comparing the preservation solutions, the

effects of biopsy size and tissue handling on RNA, DNA

and protein yield were assessed. In optimal circumstances,

a large sample of tissue would be preserved with direct

adherence to the preservation protocol; however, this is not

always possible. The results confirm that biopsy size, both

length and width, are critical for optimal yields. Particu-

larly for protein analyses, size is critical, as smaller (and

thinner) samples had inadequate protein yields. Smaller

biopsy samples also yielded RNA of lower quality. Ideally

5-mm samples obtained with a 15-gauge needle should be

obtained.

Somewhat surprisingly, the differences in RNA preser-

vation between RNAlater and Allprotect were more pro-

nounced in the larger biopsy samples. With RNAlater, the

RNA yield was proportional to the biopsy size. However,

with Allprotect, the yield from 5-mm and 15-gauge sam-

ples was similar to that from the smaller 2-mm and

18-gauge samples. It is possible that Allprotect is only able

to stabilize a certain portion of RNA in the tissue or only

able to protect the surface and not penetrate the deeper

tissue. Thus, if the maximum amount of RNA is protected

from RNases in a 2-mm sample, increasing the amount of

tissue would not alter the amount of RNase-protected

RNA. RNAlater may be better able to penetrate tissue of

variable size and protect the RNA from RNases. In keeping

with the concept of a maximal threshold rather than a true

difference in protection from RNases, the RNA yield was

very similar with RNAlater or Allprotect preservation in

the smaller (2-mm or 18-g) samples. In contrast to the

differences seen with RNA, DNA preservation was similar

with both solutions and proportional to the biopsy size,

likely because of the overall stability of DNA rather than

better protection from DNases than RNases. The greater

stability of DNA is due to the use of the pyrimidine thy-

midine instead of uracil, used by RNA. Thymidine has a

methyl group at the 50 position, which protects DNA from

degradation. Uracil lacks a 50 methyl group, which reduces

its stability and makes it more susceptible to degradation,

particularly at room temperature, at which RNases function

efficiently [7].

Once the biopsy has been taken, it is important to handle

the tissue appropriately to prevent degradation. If the

preservation solution is not brought to the bedside, there

may be a delay in submerging the tissue into the solution.

To evaluate how such a delay would affect tissue yields,

tissue was left out at room temperature for 30 or 120 min

prior to submerging in RNAlater or Allprotect. Although

there was a decrease in RNA yield, the degradation was

modest and not statistically significant with up to a 2-h

delay in tissue submersion. Notably, however, although the

RNA yield was similar, there may have been some deg-

radation of RNA with a reduction in RIN in the samples

preserved in Allprotect. This may be because Allprotect is

more viscous and takes time to coat the tissue, whereas

RNAlater immediately inactivates RNAses. However, the

lack of biological replicates for this aspect of the experi-

ment markedly limits the conclusions. DNA yields were

unaffected by a delay in submersion. Protein yield, how-

ever, was notably decreased by 2 h at room temperature.

Therefore, although immediate submersion is likely opti-

mal, up to a 30-min delay seems to have minimal conse-

quence, while longer delays may lead to degradation,

particularly for protein.

After tissue submersion, samples are to be immediately

placed on ice (or at 4 �C) and then transferred to -80 �C

for long-term storage. Qiagen claims that samples will

remain stable for 7 days in Allprotect or RNAlater at

15–25 �C [1, 2]. There was no loss in RNA, DNA or

protein yield if samples were left at room temperature for

up to 24 h after submersion in either preservation solution.

In fact, there was a slight increase in RNA and protein

yield in samples left at room temperature. This is likely due

to better tissue penetration with both RNAlater and All-

protect with prolonged submersion prior to freezing, which

may then result in enhanced protection of the liver biopsy

from degradation by proteinases.

Thawing and refreezing samples can lead to a marked

reduction in tissue yields, particularly of RNA and protein.

Samples may thaw inadvertently with handling or even

with repeated opening and closing of freezers. Both

RNAlater and Allprotect are designed to protect tissue

from the damaging effects of freeze–thaw cycles. It was

reassuring to see that there was no loss in RNA, DNA or

protein with up to three freeze–thaw cycles.

In addition to the differences in tissue preservation,

there are also practical differences between Allprotect and

RNAlater. RNAlater is subjectively easier to use. The

mechanism of preservation is different between the two

substances; Allprotect is an extremely viscous solution that

Hepatol Int (2013) 7:758–766 765

123

uses contact points to protect the tissue, while RNAlater

contains an aqueous sulfate salt solution with a controlled

pH that precipitates RNases and other soluble proteins [1,

2]. Due to the viscous nature of Allprotect, it does not

freeze at -80 �C [2]. Even upon the dabbing of the sample

on paper to remove excess Allprotect, sufficient amounts of

Allprotect remain on the surface of the sample. This leaves

the biopsy sample harder to manipulate and homogenize

because of its adherence to plastic tubes. The difficulty of

handling tissue preserved in Allprotect may contribute to

the differences observed. Even if tissue is well preserved, if

subsequent extraction is more difficult, the yield may be

reduced. Additionally, Allprotect is five times the cost of

RNAlater.

In summary, both RNAlater and Allprotect offer better

tissue preservation than snap-freezing. Tissue yields of

RNA and to a lesser degree protein were superior with

RNAlater compared to Allprotect. Both solutions pre-

vented degradation after tissue submersion, even with

repeated freeze–thaw cycles. RNAlater has practical

advantages in terms of ease of use and cost. Biopsy length

and width were critical to tissue yields, particularly for

RNA and protein, and 5-mm, 15-gauge biopsies should be

the minimum standard used for translational research.

Acknowledgements The authors would like to thank Dr. Laura

Erdman for her generous gift of murine livers. We are also very

grateful to Kathleen Zhong for lending us murine qPCR primers. This

work was supported by the National Institutes of Health Hepatitis B

Clinical Research Network (NIH 5U01DK082874-02) and the

Canadian Liver Foundation.

Conflicts of Interest None.

References

1. Qiagen. RNAlater product handbook. 2006

2. Qiagen. Allprotect product handbook. 2011

3. Mutter GL, Zahrieh D, Liu C, Neuberg D, Finkelstein D, Baker

HE, Warrington JA. Comparison of frozen and RNALater solid

tissue storage methods for use in RNA expression microarrays.

BMC Genomics. 2004;5:88

4. Fleige S, Walf V, Huch S, Prgomet C, Sehm J, Pfaffl MW.

Comparison of relative mRNA quantification models and the

impact of RNA integrity in quantitative real-time RT-PCR.

Biotechnol Lett. 2006;28:1601

5. Imbeaud S, Graudens E, Boulanger V, Barlet X, Zaborski P, Eveno

E, Mueller O, Schroeder A, Auffry C. Towards standardization of

RNA quality assessment using user-independent classifiers of

microcapillary electrophoresis traces. Nucleic Acids Res. 2005;

33:e56

6. Fleige S, Pfaffl MW. RNA integrity and the effect on the real-time

qRT-PCR performance. Mol Aspects Med. 2006;27:126–139

7. Berg JM, Tymoczko J, Stryer L. Biochemistry. 5th ed.; 2002.

p 118–119, 781–808

766 Hepatol Int (2013) 7:758–766

123

Optimal preservation of liver biopsy samples for downstream translational applications

Documents

Transcript of Optimal preservation of liver biopsy samples for downstream translational applications