of Industrial Application of SPring-8 Easy-to-Understand ...

1
The photograph shows the SPring-8 storage ring used to generate synchrotron radiation. Synchrotron radiation is an electromagnetic wave generated when a high-energy electron beam is bent in a magnetic fifield, and SPring-8 provides X-rays that are 100 million times brighter than conventional X-rays. Similarly to microscopes, the brighter the light, the higher the resolution. C C C C C C CO O O O ON N N N NT T T T T TE E E E E EN N N N N N NT T T T TS S S S S Research method using synchrotron radiation; synchrotron radiation is irradiated to a target substance to measure its absorption, transmission, diffraction, scattering, and the emission of fluorescent X-rays and photoelectrons. Rea Rea Rea Rea Rea Realiz liz liz liz lizat at ati ati ati ati ti io o o o n o n o o n of E f E f E f E Envi n nvi nvi nviron ron on ronme me m m me e e nta nta t ta ntally lly ly lly lly–Fr –Fr –Fr –Fr –Fr –Fr rien ien ie ie i ien i d dly dly Hi Hi igh- gh- gh-Per Per Per Per r er rfor for for for for for fo man ma man mance ce Thr Three- e- - e -Wa Wa Wa Way Wa Way Wa Wa Ca Catal tal t ys yst h-P P e e en ——— 2 C Clar Clar Clar ar Clar r r rifica ific ific ifica ifica fication tion tion tion tion t of of of of of two tw two t o o wo majo majo majo majo ajo m m r m r me r me r m chan chan chanisms isms ms sms ms s of of of of of of of of cata c cata cata cata c c cat lyst lyst yst y s fo s for au r au uto tomo tomo omo omo otive tive tive tive tive tive ive ive exh exh exh ex exh exh ex exhaust au aust ust pur purifica ification tio Rea Rea Rea Re Rea Realiz liz liz liz l at ati ti ti ati t on on on on n of of of of of f Int Int I Int Int n ell ell l ell el ige ige ige ige ge ent nt nt nt nt nt nt t Cat Cat Cat Ca C C aly aly aly a st st for for for A Au Au Autom tom tom tom tom tom tom moti ot ot oti ot ot o ve- ve v ve- v Emi Emissi ssi s ons ons ons s Co Co Co Co Co Co Co C ntr ntr nt nt ol ol —— ——— 4 Clar Clar Clar Clar Cla Cla ifica ific ifica fica fica fica ation tion tion tion tio o on on of of of of of f self self self self e f-reg -reg - -reg reg gener ener ener ener eneratin atin atin atin atin ating me g g me g me echan ch chanism ism to m to m to m o maint aint int aint aint aintain ain ain ain ain in cat cata cata cata cata c alyti y c ac activi tivity ty Dev Dev D De Dev Dev Dev D Dev velo elo elo elo elo o o o lopme pm pme me pm pme pme ent nt nt nt nt of of of of of f hig hig hig hig hig hi hi h highp h p h p h p h erf erf erform orm orm manc anc an nc nc nc an e, e, e, e, e, e, , fu fue fue fu fu l-e le l ffici ffici ent ent ti t ti ires es es res ——— —— 6 6 6 Anal Anal Ana Ana Anal Anal Ana ysi ysis ysis ys ysis ysis ysis s of of of of thre thre thre hre ree-di e-di e-di e-di e-d di d m men mens mens mens mensiona iona ion o o l st l st truct ruc ruct ruct cture ure ure ure re r in t in t in t in t in t in t in t n tire i ire ire ire r mate m mate mate m rial ria al at at the the nano na ano to to to micr micr micr micr micr microm omet omet om om om om o er s er scale cale a Dev Dev D Dev Dev De Dev D velo elo elo elo o e pme pme pme pme pme me m nt nt n nt nt n nt of of of f o Hai Hai i H H r-C C -C r-C r C Care are are are re are are are Pr Pr Pr Pr Pr Pr Pr Pro od odu odu odu odu o c cts ts ts Th Th hat at Mak k M k ake H e H e H H e H e H Hai air air air a S Sh Shiny ny ——— 8 Quan Quan Qu Quan Quan u tific tific tific tific ficatio atio atio atio ation of n of n of n o of hai hai h h r sh r sh shine ine n n n ne e ne at t at t at t at t at t at t tt tthe c he c he c he c he c he c he c he cellu ellu ellu ellu e lar lar r l la leve evel l Dev Dev Dev Dev Dev Develo elo elo elo e elo l pme pme pme p pme pm nt nt t nt t t t of o of of of o o Hai Hai Hai Hai Ha ai air-C r-C r-C r-C r-C r-C r are are are ar re Pr Pr P odu oducts cts s fr fr from om om om Ric Ric Ric Ric Ric ce W e W e W e e e Wate ter r ——— 10 Visu Visu Visu Visu isualiz aliz aliz aliz iz li ing ing ing g ng g the he th th t the h he h pene pene pene pene p pene pe trat trat trat trat trat t a ion ion ion ion ion io ion of a of a of a of a of a pro protect tective ive comp c mpound ound ound d ound int int int int nt n o th o th o th othe ha e e ir u r sing ng sp spectroscopy Dev Dev Dev v De De Dev Dev De elo elo elo elo elo elo elo o e pme pme pme pme pme m pm nt nt nt nt nt t o of of of of of Ant A A Ant Ant A i-c i-c i ari aries es e Che Che Chewin win win win ng G g G g G g G g G G Gum um um ——— ——— 12 1 Crys y Cry Crys C Crys r Crys C tall tall tall al llogra ogra ogra ogra ogra ographic phic phic phic phic h vis vis vis vis v uali uali u u zati zati z on o on of th f the pr e p e p oces oces oces es ss of s of s of s o s of o s res res res res res es restora tora tora tora t tion tio aft fter e early arly-s -stage caries Dev Dev Dev Dev ev D velo elo elo elo elo el e opme pme pme pme p nt nt n of of o of Lon Long-L g-L g-L -Last ast ast ast asting ing ing ing ing ing n ng Ar Ar Ar Ar Ar A A tifi tifi tifi ti ificia cia cial J l Join oi ts ts ——— 14 A ne A ne A ne A ne A ne An w di w di w di w direct rec rect rection ion o in d in desig esig esig signing ning ng ning n mat mat mat mat mat t materia eria eria eria eria erials t ls t ls t ls t ls t ls o pr o pr o p o pr o even e event ox t oxidat a ion on and and degradation of artificial joints Dev D Dev D velo elo el l pme pme me pme me me ment nt nt nt nt n n n of of of of o Mat Mat Mat M eri erial al a Des es Design ign i Me Metho t d for Autoclaved Lightweight Aerated Concrete ——— 18 Anal Analysis ysis ysis ysis of of of of form form form form form o atio atio i i ation me n me n chan chanism sm of c f c of ryst rystalli al ne c ne omponent tobermorite Est Est Est Establ abl abl ablish ish sh i ing ing ing Me Me M M tho tho tho tho ho ods ds ds d ds ds ds to to to to to to to o De Des De Des Des D ign ign Ma M ter terial ials f s for o Polymer-Modified Cement Waterproofing Coating ——— 16 Purs Purs Purs Pur Pur uit uit u of h of h hydra yd yd tion tion on n on n and and and and and har har har har har hardeni deni den den n ng p ng p g roce rocesses s Res Res R Res Respo pon pon n p di d din din ng t g g to t o t the he he e Res Res Restri tri tricti ction o of Hazardous Substances in Electronic Products ——— 20 Esta Esta Esta tablis blis bli blishmen hmen hment of t of hig hig h h-se h-se -sensit ns nsit itivit ivit vi y no y n ndestructive inspection method for hexavalent chromium Dev Dev Dev Develo elo elo pme pme pment nt of of of of Hi Hig Hig Hi h-E h-Effici ffic ency Recycling Technology for Tungsten ——— 22 Chem Chem Chem e ical ical ica sta sta sta ate a te te a te te naly naly naly alysis sis sis sis of t of t f ungs ung n ten during ion exchange in collection system Dev Dev De e Develo elo elo opme pme pme m nt nt nt nt of of of of Lon Lo Long-L g ife Next-Generation Li-Ion Batteries ——— 24 Clar Clar Clarifica ifica ifica ifica ca ation tion tion of of of the the th the caus cau c c es o s f performance deterioration of Li-ion batteries Imp Imp Imp Imp prov rov rov ro r r eme eme eme ment of Capacity of Nickel-Metal Hydride Battery ——— 26 Clar Clar Clar Clar Clarifica ifica ifica fication tion tion of of the th optimal composition of the electrode Con Con Con C tri t tribut butio ion to Development of Next-Generation CMOS Products ——— 28 Deve Developm lopment ent of t of echnology for evaluating ultrathin-film laminated structures Develo opme n nt of of Photonic Integrated Devices with High Luminescent Efficiency i I t t dD i ith Hi hL i tEffi i Development of Photonic Integrated Devices with High Luminescent Efficiency ——— 32 32 Est Establ ablish ishmen ment o t f Method for Analyzing Next-Generation Metal-Oxide-Semiconductor Field-Effect Transistors ——— 30 Nond Nond N estr estructi uctive a ve analy nal sis is of internal states of semiconductor laminated structures ——— 34 34 ——— 36 36 6 36 6 36 ——— 4 4 4 40 40 4 40 4 4 4 4 4 4 4 4 40 4 4 40 4 40 4 40 40 40 0 0 40 0 0 0 0 0 0 0 0 0 4 40 0 0 0 0 40 40 0 0 0 40 40 40 0 4 4 4 4 4 40 ——— 44 44 44 44 4 44 44 4 4 4 4 44 4 4 4 44 44 44 4 4 4 4 44 4 44 4 4 44 X-ray Fluorescence analysis Photoelectron spectroscopy Irradiation of synchrotron radiation X-ray absorption fine structure (XAFS) Infrared absorption spectroscopy X-ray diffraction/scattering Imaging Industrial applications account for more than 20% of the total number of research proposals carried out at SPring-8. The world’s highest measurement and analysis technologies with high-performance synchrotron radiation have become essential for material evaluation for manufacturing in companies. This booklet is a collection of research proposals with industrial applications conducted at SPring-8, the achievements of which are presented to be easily understood by people outside the field of expertise. This booklet was prepared for general readers to easily comprehend the contents when they see the title and the “achievements” in the blue box. Such clear and simple explanations have been strongly requested by the managers of companies using or considering the use of SPring-8 as well as by the politicians and policymakers who determine the social significance of SPring-8. I hope that this booklet will help such people and the general public to understand the contribution of SPring-8 to industry. I sincerely appreciate the cooperation of the many parties involved, including those from companies involved in the preparation of this booklet. Yoshiharu Doi, President Japan Synchrotron Radiation Research Institute (JASRI) Easy-to-Understand Examples of Industrial Application of SPring-8

Transcript of of Industrial Application of SPring-8 Easy-to-Understand ...

The photograph shows the SPring-8 storage ring used to generate synchrotron radiation. Synchrotron radiation is an electromagnetic wave generated when a high-energy electron beam is bent in a magnetic fifield, and SPring-8 provides X-rays that are 100 million times brighter than conventional X-rays. Similarly to microscopes, the brighter the light, the higher the resolution.

CCCCCCCOOOOONNNNNTTTTTTEEEEEENNNNNNNTTTTTSSSSS

Research method using synchrotron radiation;synchrotron radiation is irradiated to a target substance to measure its absorption, transmission, diffraction, scattering, and the emission of fluorescent X-rays and photoelectrons.

ReaReaReaReaReaRealizlizlizlizlizatatatiatiatiatitiioooon on o on of Ef Ef Ef EEnvinnvinvinvironrononronmememmmeeentantattantallyllylyllylly–Fr–Fr–Fr–Fr–Fr–Frrienienieieiieni ddlydly HiHiigh-gh-gh-PerPerPerPerrerrforforforforforforfo manmamanmance ce ThrThree-e--e -WaWaWaWayWaWayWaWa CaCataltalt ysyst h-PP eeen ——— 2CClarClarClararClarrrrificaificificificaificaficationtiontiontiontiont of of of of of two twtwo t oo wo majomajomajomajoajomm r mr mer mer m chanchanchanismsismsmssmsmss of of of of ofofof of cataccatacatacatacccat lystlystysty s fos for aur auutotomotomoomoomootivetivetivetivetivetiveiveive exhexhexhexhexhexhexexhaustauaustust purpurificaificationtio

ReaReaReaReReaRealizlizlizlizl atatititiatit on on on on n of of ofof of f IntIntIIntIntn ellelllellel igeigeigeigegeent nt nt nt ntnt nt t CatCatCatCaCC alyalyalya st st forforfor AAuAuAutomtomtomtomtomtomtommotiotototiototo ve-vevve-v EmiEmississis onsonsonss CoCoCoCoCoCoCoC ntrntrntnt ol ol —————— 4ClarClarClarClarClaCla ificaificificaficaficaficaationtiontiontiontiooonon of ofof of off selfselfselfselfe f-reg-reg--regreggenerenerenerenereneratinatinatinatinatinating meg g meg meechanchchanismism to mto mto mo maintaintintaintaintaintainainainainainin catcatacatacatacatac alytiyyt c acactivitivityty

DevDevDDeDevDevDevDDevveloeloeloeloeloooolopmepmpmemepmpmepmeent nt nt nt nt of of of of of fo highighighighighihihhigh ph ph ph ph erferferformormormmancancanncncncance,e,e,e,e,e,, fufuefuefufu l-el el fficiffifficiffi entente t tittiiresesesres —————————— 666AnalAnalAnaAnaAnalAnalAna ysiysisysisysysisysisysiss of of of of threthrethrehreree-die-die-die-die-ddid mmenmensmensmensmensionaionaionoo l stl sttructrucructructcture ureure ure re r in tin tin tin tin tin tin tn tireiireireirer matemmatematem rialriaal at at the the nanonaano tototo micrmicrmicrmicrmicrmicromometometomomomomo er ser scalecalea

DevDevDDevDevDeDevD veloeloeloelooe pmepmepmepmepmemem nt nt nnt ntnnt of ofof fo HaiHaiiHH r-CC-Cr-Cr CCarearearearereareareare PrPrPrPrPrPrPrProododuoduoduoduo cctststs ThThhat at MakkM kake He He HHe He HHaiairairaira SShShinynyy ———— 8QuanQuanQuQuanQuanu tifictifictifictificficatioatioatioatioation ofn ofn ofn o of haihaihh r shr shshine inennnneene at tat tat tat tat tat tt tt the che che che che che che che celluelluelluellue lar lar rlla leveevell

DevDevDevDevDevDeveloeloeloeloeelol pmepmepmeppmepm ntnt tnttt t of oofof of oo HaiHaiHaiHaiHaaiair-Cr-Cr-Cr-Cr-Cr-Cr arearearearre PrPrP oduoductsctss frfrfrom om omom RicRicRicRicRicce We We Weee Wateterr r ———— 10VisuVisuVisuVisuisualizalizalizalizizli inginginggngg the heththtthehheh penepenepenepeneppenepe trattrattrattrattratta ion ionionion ion ioion of aof aof aof aof a proprotecttectiveive compc mpoundoundounddound intintintintntn o tho tho tho the haee ir ur singng spspectroscopy

DevDevDevvDeDeDevDevDe eloeloeloeloeloeloelooe pmepmepmepmepmempm nt ntnt nt ntt oof of of ofof AntAAAntAntA i-ci-ci ariariesese CheCheChewinwinwinwinng Gg Gg Gg Gg GGGumumum —————— 121CrysyCryCrysCCrysrCrysC talltalltallalllograograograograograographicphicphicphicphich visvisvisvisv ualiualiuu zatizatiz on oon of thf the pre pe p ocesocesocesesss ofs ofs ofs os ofos resresresresresesrestoratoratoratorat tiontio aftfter eearlyarly-s-stage caries

DevDevDevDevevD veloeloeloeloeloele opmepmepmepmep nt nt n of of oof LonLong-Lg-Lg-L-Lastastastastastingingingingingingnng ArArArArArAA tifitifitifitiificiaciacial Jl Joinoi tsts ———— 14A neA neA neA neA neA n w diw diw diw directrecrectrectioniono in din desigesigesigsigningningngningn matmatmatmatmattmateriaeriaeriaeriaeriaerials tls tls tls tls tls o pro pro po pro eveneevent oxt oxidata ion on and and degradation of artificial joints

DevDDevD veloeloell pmepmemepmememement nt nt nt ntnnn ofof ofof o MatMatMatM erierial ala DesesDesignigni MeMethot d for Autoclaved Lightweight Aerated Concrete ——— 18AnalAnalysisysisysisysis of of of of formformformformformo atioatioiiation men men chanchanism sm of cf cof rystrystallial ne cne omponent tobermorite

EstEstEstEstablablablablishishshi ingingingg MeMeMM thothothothohoods ds ds dds ds ds to to toto to toto o DeDesDeDesDesD ignign MaM terterialials fs for o Polymer-Modified Cement Waterproofing Coating ——— 16PursPursPursPurPur uituitu of hof hhydraydyd tiontiononnonn andandandandand harharharharharhardenidenidendenn ng png pg rocerocessess

ResResRResRespoponponnp diddindinng tgg to to tthe he hee ResResRestritritrictictiono of Hazardous Substances in Electronic Products ——— 20EstaEstaEstatablisblisbliblishmenhmenhment oft of highigh h-seh-se-sensitnsnsititivitivitvi y noy n ndestructive inspection method for hexavalent chromium

DevDevDevDeveloeloeloe pmepmepment nt of of of of HiHigHigHi h-Eh-Efficiffic ency Recycling Technology for Tungsten ——— 22ChemChemCheme icalicalica stastastaate atete ate te nalynalynalyalysissississis of tof tf ungsungn ten during ion exchange in collection system

DevDevDeeDeveloeloeloopmepmepmem nt nt nt nt of ofof of LonLoLong-Lg ife Next-Generation Li-Ion Batteries ——— 24ClarClarClarificaificaificaificacaationtiontion of of of the theththe causcaucc es os f performance deterioration of Li-ion batteries

ImpImpImpImpprovrovrovrorr emeemeemement of Capacity of Nickel-Metal Hydride Battery y ——— 26ClarClarClarClarClarificaificaificaficationtiontion of of the th optimal composition of the electrode

ConConConC trittributbutioion to Development of Next-Generation CMOS Products ——— 28DeveDevelopmlopment ent of tof echnology for evaluating ultrathin-film laminated structures

Develoopmep nnt of of Photonic Integrated Devices with High Luminescent Efficiencyi I t t d D i ith Hi h L i t Effi iDevelopment of Photonic Integrated Devices with High Luminescent Efficiency ——— 3232

EstEstablablishishmenment ot f Method for Analyzing Next-Generation Metal-Oxide-Semiconductor Field-Effect Transistors ——— 30NondNondN estrestructiuctive ave analynal sis is of internal states of semiconductor laminated structures

——— 3434

——— 363636366636

——— 4444040440444444444044404440440404000400000000004400000404000040404004444440

——— 44444444444444444444444444444444444444444

X-ray Fluorescence analysis

Photoelectron spectroscopy

Irradiation of synchrotron radiation

X-ray absorption fine structure (XAFS)

Infrared absorptionspectroscopy

X-ray diffraction/scattering

Imaging

Industrial applications account for more than 20% of the total number of research proposals carried out at SPring-8. The world’s highest measurement and analysis technologies with high-performance synchrotron radiation have become essential for material evaluation for manufacturing in companies. This booklet is a collection of research proposals with industrial applications conducted at SPring-8, the achievements of which are presented to be easily understood by people outside the field of expertise. This booklet was prepared for general readers to easily comprehend the contents when they see the title and the “achievements” in the blue box. Such clear and simple explanations have been strongly requested by the managers of companies using or considering the use of SPring-8 as well as by the politicians and policymakers who determine the social significance of SPring-8. I hope that this booklet will help such people and the general public to understand the contribution of SPring-8 to industry. I sincerely appreciate the cooperation of the many parties involved, including those from companies involved in the preparation of this booklet.

Yoshiharu Doi, President Japan Synchrotron Radiation Research Institute (JASRI)

Easy-to-Understand Examples of Industrial Application of SPring-8