Mycobacterium-Inducible Nramp in Striped Bass (Morone saxatilis)†

INFECTION AND IMMUNITY, Mar. 2004, p. 1626–1636 Vol. 72, No. 30019-9567/04/$08.00�0 DOI: 10.1128/IAI.72.3.1626–1636.2004Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Mycobacterium-Inducible Nramp in Striped Bass (Morone saxatilis)†Erin J. Burge,1* David T. Gauthier,1 Christopher A. Ottinger,2 and Peter A. Van Veld1

Department of Environmental and Aquatic Animal Health, Virginia Institute of Marine Science, College of Williamand Mary, Gloucester Point, Virginia 23062,1 and U.S. Geological Survey, Leetown Science Center, National

Fish Health Research Laboratory, Kearneysville, West Virginia 254302

Received 2 October 2003/Returned for modification 6 November 2003/Accepted 24 November 2003

In mammals, the natural resistance-associated macrophage protein 1 gene, Nramp1, plays a major role inresistance to mycobacterial infections. Chesapeake Bay striped bass (Morone saxatilis) is currently experiencingan epizootic of mycobacteriosis that threatens the health of this ecologically and economically importantspecies. In the present study, we characterized an Nramp gene in this species and obtained evidence that thereis induction following Mycobacterium exposure. The striped bass Nramp gene (MsNramp) and a 554-amino-acidsequence contain all the signal features of the Nramp family, including a topology of 12 transmembranedomains (TM), the transport protein-specific binding-protein-dependent transport system inner membranecomponent signature, three N-linked glycosylation sites between TM 7 and TM 8, sites of casein kinase andprotein kinase C phosphorylation in the amino and carboxy termini, and a tyrosine kinase phosphorylation sitebetween TM 6 and TM 7. Phylogenetic analysis most closely grouped MsNramp with other teleost Nramp genesand revealed high sequence similarity with mammalian Nramp2. MsNramp expression was present in all tissuesassayed by reverse transcription-PCR. Within 1 day of injection of Mycobacterium marinum, MsNramp expres-sion was highly induced (17-fold higher) in peritoneal exudate (PE) cells compared to the expression incontrols. The levels of MsNramp were three- and sixfold higher on days 3 and 15, respectively. Injection ofMycobacterium shottsii resulted in two-, five-, and threefold increases in gene expression in PE cells over thetime course. This report is the first report of induction of an Nramp gene by mycobacteria in a poikilothermicvertebrate.

Mycobacteriosis has been reported in more than 150 speciesof freshwater and marine fish worldwide, including striped bass(Morone saxatilis) (43). Chesapeake Bay is currently experienc-ing an epizootic of mycobacteriosis in striped bass that threat-ens the health of an economically important commercial andrecreational fishery (32, 46) and has important consequencesfor production in aquaculture (33). The prevalence of splenicmycobacterial lesions and the prevalence of dermal mycobac-terial lesions in striped bass from Chesapeake Bay tributarieshave been reported to be as high as 62.7 and 28.8%, respec-tively (8). Diseased striped bass harbor multiple species ofMycobacterium, including Mycobacterium marinum, a knownfish and human pathogen (35, 64), and Mycobacterium shottsiisp. nov., which is also a member of the Mycobacterium tuber-culosis clade (47). Approximately 76% of mycobacterium-pos-itive striped bass sampled to date harbor M. shottsii, either asa monoinfection or as part of a coinfection with multiple My-cobacterium spp. (M. W. Rhodes, H. Kator, I. Kaattari, D.Gauthier, W. Vogelbein, and C. Ottinger, Abstr. 103rd Gen.Meet. Am. Soc. Microbiol., abstr. Q-264, 2003). Gauthier et al.(21) investigated the relative pathogenicity of three Mycobac-terium spp. isolated from wild Chesapeake Bay fish for labo-ratory-reared striped bass and found that M. marinum causedacute peritonitis and extensive granulomatous inflammation.

In some cases, a secondary phase of reactivation disease wasobserved. The pathology in fish inoculated with M. shottsii orMycobacterium gordonae was considerably less severe than thepathology in fish inoculated with M. marinum, and secondarydisease did not occur. Both M. gordonae and M. shottsii, how-ever, did establish persistent infections in the spleen.

Breeding studies with Mycobacterium-resistant (Bcgr) and-susceptible (Bcgs) inbred mouse phenotypes resulted in iden-tification of a single dominant, autosomal gene (termed Bcg)responsible for increased resistance to mycobacteria during theearly stages of infection (27). Positional cloning of Bcg fromthe proximal region of mouse chromosome 1 led to the dis-covery of the gene for the natural resistance-associated mac-rophage protein (Nramp) (61). Vidal et al. demonstrated thatNramp transcripts were detected only in the reticuloendothe-lial organs (spleen and liver) of mice and were highly expressedin purified macrophages and macrophage cell lines from thesetissues. In addition, murine Nramp1 is highly upregulated fol-lowing infection with intracellular parasites (23, 26) and ad-ministration of lipopolysaccharide (LPS) and gamma inter-feron (25), and a strong synergistic effect is observed under thelatter conditions. Transfection of the resistant, wild-typeNramp1G169 allele in susceptible Nramp1G169D knockout micerestored resistance to Mycobacterium bovis BCG and Salmo-nella enterica serovar Typhimurium in the transgenic animals(26), while overexpression of Nramp1 by a cytomegaloviruspromoter-enhancer completely inhibited intracellular replica-tion of S. enterica serovar Typhimurium in normally susceptiblemouse macrophages (24), indicating the crucial role of thisgene in resistance to intracellular parasites.

The mechanism of mycobacterial resistance due to Nramp1

* Corresponding author. Mailing address: Chesapeake Bay Hall,P. O. Box 1346, 1208 Greate Road, Department of Environmental andAquatic Animal Health, Virginia Institute of Marine Science, Glouces-ter Point, VA 23062. Phone: (804) 684-7234. Fax: (804) 684-7186.E-mail: [email protected].

† Virginia Institute of Marine Science contribution no. 2577.

1626

on February 8, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

is not fully understood (4), but Nramp2 is known to take upiron from the intestinal brush border in mammals and has beenlinked to transferrin-independent iron transport into acidifiedendosomes in many different tissues (18, 31). One of the splicevariants of DCT1 (Rattus norvegicus Nramp2 homolog) con-tains an iron-responsive element (IRE) in the 3� untranslatedregion (UTR) (31). There is a very high degree of homology inall the transmembrane domains (TM) between Nramp1 andNramp2 (44), and a mutation in Nramp2 immediately C ter-minal of the loss-of-function mutation in Nramp1 TM 4 isassociated with microcytic anemia iron deficiency (54).

Nramp1 belongs to a small family of related proteins en-coded by genes that include two known murine genes, Nramp1and Nramp2, as well as related sequences in many other taxa(10). Nramp homologs have been found in many evolutionarilydistantly related groups, such as humans (11, 37), rats (31),birds (36), fish (15), insects (48), nematodes (57), plants (5),yeast (45), and bacteria (42). Complete Nramp mRNA codingsequences for five teleosts have been published recently (12,14, 15, 49, 52). Paralogs of Nramp seem to be present in twoteleost species, Oncorhynchus mykiss (15) and Takifugu ru-bripes (52), while single genes are present in other teleostspecies, including Cyprinus carpio (49), Ictalurus punctatus (12),Danio rerio (14), and M. saxatilis (this study). Expression stud-ies and phylogenetic analysis of fish have indicated that thenonteleost sequence similarity and tissue-specific expressionpatterns most closely resemble those of mammalian Nramp2.Little is known about the function of Nramp in teleosts, al-though in one study Chen et al. (12) demonstrated by usingNorthern hybridization and reverse transcription (RT)-PCRthat channel catfish (I. punctatus) spleen NrampC levels wereelevated in response to LPS exposure in vivo in a dose-depen-dent fashion. Direct evidence of induction due to exposure offish to pathogens has not been reported previously.

The purposes of the present study were to isolate and se-quence striped bass Nramp homolog(s), to characterize thecoding sequence, to determine the tissue expression patterns,and to evaluate induction of the striped bass Nramp gene(MsNramp) in vivo after exposure to mycobacteria. Expressionwas measured in several tissues by using real-time RT-PCR(see references 7, 53, and 59 for descriptions of recent appli-cations) following injection of M. marinum or M. shottsii intostriped bass. This report is the first report of induction of anNramp gene by an intracellular pathogen in a poikilothermicvertebrate.

MATERIALS AND METHODS

Experimental fish and maintenance. Striped bass (M. saxatilis) (500 to 2,000 g)were collected from the York River, Chesapeake Bay, Va. (Virginia MarineResources permit 02-27 and VIMS Research on Animal Subjects Committeepermit 0101). The tissues of these fish were used for sequencing and normaltissue expression of MsNramp. The fish were maintained in 1,160-liter tanks withflowthrough, sand-filtered water at the ambient temperature and salinity. Thetanks were lit with fluorescent lights adjusted to the local photoperiod. The fishwere fed daily to satiation with wild-caught small fish and crabs and were kept formore than 2 weeks prior to experimental use.

The striped bass used for the mycobacterial challenge and in vivo expressionexperiments were obtained as fingerlings (1 year postspawn) from the VirginiaDepartment of Game and Inland Fisheries Vic Thomas Striped Bass Hatchery inBrookneal, Va. The fish were reared until the mean weight was approximately200 g (2 years postspawn) in circular 1,000-liter tanks containing 21°C well waterexchanged at a rate of 12 liters/min. The inflow water was degassed and oxygen-

ated to saturation, and the tank water was treated with 1% (wt/vol) NaCl eachtime that the fish were handled to alleviate stress. The fish were fed trout chow(Ziegler Bros, Gardner, Pa.). Tank illumination was provided by a combinationof fluorescent and natural light, with the former adjusted to the local photope-riod. Thirty striped bass (198.1 � 67.4 g) were randomly selected, separated intothree treatment groups, and moved to an isolation facility prior to infection withmycobacteria.

RNA extraction and RT for cDNA: sequencing and tissue expression. Perito-neal exudate (PE) cells were isolated from wild striped bass by a modification ofstandard techniques (51). Cells were elicited to the peritoneal cavity by injectionof adjuvant (100 �l of Freund’s incomplete medium) 7 to 10 days prior toharvesting. Anesthetized fish were inoculated intraperitoneally with 10 ml ofice-cold Leibowitz’s L-15 medium containing 100 U of penicillin-streptomycinper ml and 100 U of sodium heparin per ml. After 10 min, lavage fluid waswithdrawn through a ventral incision (51). Anterior kidney, brain, heart, gill,gonad, intestine, liver, muscle, and spleen samples (approximately 100 mg each)were dissected from the fish and either stored in RNAlater (Ambion) or ex-tracted immediately. Total RNA was isolated with TRIzol (Invitrogen) usedaccording to the manufacturer’s protocol. The integrity of the total RNA wasassessed by electrophoresis in 1% denaturing formaldehyde–agarose gels. TheRNA quality and concentration were determined by UV spectrophotometry at260 and 280 nm, with background correction for protein contamination at 320nm. The total RNA was resuspended in RNA Storage Solution (Ambion) andstored at �80°C until it was used. RT of 5 �g of RNA was accomplished by usingSuperScript II RNase H� reverse transcriptase and oligo(dT12-18) (Invitrogen)priming according to the manufacturer’s recommendations.

Amplification of MsNramp cDNA. Primers and hybridization probes used instandard PCR, RT-PCR, RNA ligase-mediated rapid amplification of cDNAends (RACE), and sequencing analyses are listed in Table 1. An initial 262-bpfragment of striped bass MsNramp was obtained by using primers NrampA andNrampB, which were derived from consensus mammalian sequences (12), andstriped bass PE cDNA. Fragments 5� and 3� of this initial fragment were obtainedby using combinations of striped bass-specific MsNramp primers (MsNramp736and MsNramp1020), which were developed by sequencing RT-PCR products,and primers developed for O. mykiss Nramp (MDNMP1F, MDNMP4,OmNramp1263, OmNramp1463) (15). PCR parameters were empirically deter-mined for each primer set, and the PCRs were performed with thermocyclersfrom MJ Research, Inc. The PCR mixtures (final volume, 50 �l) contained (finalconcentrations) 1.0 U of Platinum Taq High Fidelity DNA polymerase, eachdeoxynucleoside triphosphate at a concentration of 0.2 mM, 2 mM MgSO4, 1�PCR buffer (Invitrogen), each primer at a concentration of 0.2 �M, and 1 to 2 �lof cDNA template. A total of 1,242 bp of MsNramp sequence was generated inthis manner. Tissue expression of MsNramp was shown by amplification of cDNAfrom a variety of tissues (see above) by using primer sets (NrampA plusMDNMP4, MDNMP1F plus OmNramp1463, and MsNramp736 plusMsNramp1020). MsNramp-positive tissues were visualized by 1% agarose gelelectrophoresis and ethidium bromide staining.

RNA ligase-mediated RACE. The 5� and 3� ends of MsNramp cDNA wereamplified by RACE, based on procedures developed by Frohman et al. (20). The5� and 3� ends of MsNramp were isolated by using a GeneRacer kit (Invitrogen).For the 5� end, 5 �g of RNA from mycobacterium-inoculated striped bass PEcells was dephosphorylated with calf intestinal phosphatase, and the 5� capstructure was removed by using tobacco acid pyrophosphatase. An RNA oligo-nucleotide sequence was ligated to the dephosphorylated, decapped 5� end ofstriped bass mRNA, and the hybrid molecule was reverse transcribed by usingSuperScript II RT. RACE-ready 3� cDNA was obtained by RT of 5 �g of PE cellsRNA by using the GeneRacer Oligo dT primer, a modified oligo(dT) primer witha 36-nucleotide tail complementary to the 3� poly(A) tail of full-length mRNA.RACE-ready first-strand cDNA was treated with RNase H to remove the RNAtemplate.

The RACE PCR mixture for 5� MsNramp consisted of 1 �l of RACE-ready 5�cDNA, 0.6 �M GeneRacer 5� primer (complementary to the GeneRacer RNAoligonucleotide ligated to 5� cDNA), 0.2 �M gene-specific primer 5RACE1, eachdeoxynucleoside triphosphate at a concentration of 0.2 mM, 1� PCR buffer, 2mM MgSO4 and 2.5 U of Platinum Taq DNA polymerase. The cycling param-eters for a touchdown PCR program were as follows: 94°C for 2 min, 94°C for 0.5min, and 72°C for 1 min for five cycles; 94°C for 0.5 min and 70°C for 1 min forfive cycles; 94°C for 0.5 min and 68°C for 1.5 min for 25 cycles; and 68°C for 10min.

The 3� RACE PCR mixture for MsNramp consisted of reaction componentssimilar to those in the 5� RACE PCR mixture, with the following exceptions: 1�l of RACE-ready 3� cDNA, 0.6 �M GeneRacer 3� primer [complementary tothe 36-nucleotide tail of the oligo(dT) primer], and 0.2 �M primer 3RACE1, 0.2

VOL. 72, 2004 Nramp INDUCTION IN STRIPED BASS 1627


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

�M primer 3RACE2, or 0.2 �M primer 3RACE4. The cycling parameters forprimer 3RACE1 were as follows: 94°C for 2 min; 94°C for 0.5 min and 72°C for2 min for five cycles; 94°C for 0.5 min and 70°C for 2 min for five cycles; 94°C for0.5 min, 65°C for 0.5 min, and 68°C for 2 min for 25 cycles; and 68°C for 10 min.Multiple products were obtained in the reaction initiated with primer 3RACE1,so a nested PCR was performed by using the standard PCR components alongwith 0.2 �M GeneRacer 3� nested primer, 0.2 �M primer 3RACE2, and 1 �l ofthe 3RACE1-amplified products. The conditions for this reaction were opti-mized as follows: 94°C for 2 min; 94°C for 0.5 min, 65°C for 0.5 min, and 68°C for2 min for 25 cycles; and 68°C for 10 min. Primer 3RACE4 was used to confirmthat a full-length 3� sequence was obtained after 3RACE2 products were se-quenced. The reaction conditions and cycling parameters were identical to thoseused for primer 3RACE1.

Cloning. Putative internal MsNramp fragments were blunt-end cloned intopSTBlue-1 by using T4 DNA ligase and were transformed into Escherichia colistrain NovaBlue competent cells for blue-white screening (Clonetech). Trans-formants were grown on Luria broth (LB) agar plates with kanamycin selectionfor plasmid uptake and X-Gal (5-bromo-4-chloro-3-indolyl-�-D-galactopyrano-side)-IPTG (isopisopropyl-�-D-thiogalactopyranoside) screening for transforma-tion. Insert-containing white colonies were amplified in LB, and their plasmidswere isolated by using PERFECTprep spin columns (5�33�, Inc.). Screening ofclones was accomplished by using MsNramp-specific PCR or vector primers thatyielded products of the expected insert size. RACE PCR products were clonedinto pCR4-TOPO with topoisomerase I by using single deoxyadenosine residuesadded by Taq polymerase during amplification with a TOPO TA cloning kit(Invitrogen). Insert-containing vector molecules were transformed into E. coliTOP10, thereby disrupting the lethal gene ccdB. Insert-containing transformantswere screened for insert size by performing vector-specific PCR. Transformantscontaining complete 5� and 3� inserts were amplified in LB, and plasmids wereisolated with a Qiaprep Spin miniprep kit (Qiagen).

Sequencing. MsNramp fragments were bidirectionally determined with a Li-Cor 4000L DNA sequencer by the dideoxy chain termination method by using aThermoSequenase cycle sequencing kit according to the manufacturer’s instruc-tions (Amersham Biosciences). Plasmid DNA (1 to 2 �g) and 3 pmol of thefluorescent primers M13F (forward) and M13R (reverse) were used in thesequencing reaction (LI-COR Biosciences). At least 10 clones were sequencedfor each fragment.

Sequence analysis. MsNramp fragments were aligned and edited in Se-quencher (version 4.1; Gene Codes Corp.). Full-length cDNA nucleotide anddeduced amino acid sequences were analyzed to determine similarity to previ-ously published sequences by using GenBank resources (http://www.ncbi.nlm.nih.gov/GenBank/index.html). Searches for similar sequences were performed by

using the Basic Local Alignment Tool (BLAST) algorithms (1). Multiple-se-quence alignment was performed by using ClustalX (version 1.81) (58). Potentialmicrosatellite sequences were detected with the Tandem Repeats Finder soft-ware (version 3.21) (6), and polyadenylation signals were analyzed by usingpolyadq (55). The amino acid sequences of the following proteins were used inthe alignment and phylogenetic analyses: Bos taurus Nramp1 (GenBank acces-sion number U12852), C. carpio NRAMP (AJ133735), D. rerio DMT1(AF529267), Drosophila melanogaster malvolio (U23948), Gallus gallusNRAMP1 (U40598), Homo sapiens NRAMP1 (L32185), H. sapiens NRAMP2(NP_000608), I. punctatus NrampC (AF400108), Macaca fascicularis(AF153279), M. saxatilis MsNramp (AY008746), Mus musculus Nramp1(AAA39838), M. musculus Nramp2 (AAC42051), O. mykiss Nramp�(AF048760), O. mykiss Nramp� (AF048761), Ovis aries NRAMP (U70255),Pimephales promelas Nramp (AF190773), R. norvegicus DCT1 (AAC53319), T.rubripes Nramp� (AJ496549), and T. rubripes Nramp� (AJ496550). TM werepredicted by using HMMTOP (version 2.0) (60), and a motif analysis was per-formed by using the PROSITE reference library (34).

Phylogenetic analysis. A phylogenetic analysis was conducted by using theMEGA software (version 2.1) (39). An optimal tree was constructed by using thepairwise distance model and neighbor joining (50). Indels were removed fromthe multiple-sequence alignment, and the reliability of the trees was assessed byexamining 10,000 bootstrap replicates. Drosophila malvolio (48) was used as anoutgroup.

Mycobacteria. M. marinum (Virginia Institute of Marine Science strain M30)(M. W. Rhodes, I. Kaattari, S. Kotob, H. Kator, W. K. Vogelbein, E. Shotts, andS. Kaattari, Fish Health Sect. Am. Fish. Soc. Annu. Conf., abstr. Q-423, 2000)and M. shottsii (Virginia Institute of Marine Science strain M175 [ ATCC700981]) (46) were isolated from splenic tissue of Chesapeake Bay striped bassand grown as described by Gauthier et al. (21). Briefly, mycobacteria wereinoculated into Middlebrook 7H9 medium with oleate-albumin-dextrose-cata-lase enrichment and 0.05% polyoxyethylenesorbitan monooleate (Tween 80) andgrown until the log phase (10 days). Cultures were pelleted by centrifugation at12,000 � g for 20 min and washed once in phosphate-buffered saline (PBS) with0.05% Tween 80 (PB). Washed cultures were resuspended in PB, vortexedvigorously with glass beads (diameter, 500 �m) for 2 min, and filtered throughWhatman no. 1 paper to reduce clumping and obtain a homogeneous suspen-sion. The absorbance at 590 nm was adjusted with PB to 0.05 (concentration,approximately 107 CFU/ml), and the preparation was diluted 10-fold prior toinjection with PBS. Effluent water from the isolation facility was treated for aminimum contact time of 20 min with hypochlorite maintained at a diluted finalconcentration of 100 mg/liter after the fish were infected with mycobacteria.

TABLE 1. Primers used in tissue-specific RT-PCR, RNA ligase-mediated RACE, real-time RT-PCR, and sequencing

Primer Sequence (5� 3 3�) Source (reference or accessionno.)

NrampA GGAAGCTGTGGGCCTTCAC Consensus mammalian (12)NrampB CTGCCGATGACTTCCTGCAT Consensus mammalian (12)OmNramp1263 CCCCTCCGCCTATCTTCCACACCAGTCC O. mykiss (AF054808)OmNramp1463 CCCGCTCCATCGCCATCTTCCCCAC O. mykiss (AF054808)MDNMP1F GCCCCATAATATCTACCTGCACTC O. mykiss (15)MDNMP4 GGTGCCCGTCATGGTAGAGCTCTG O. mykiss (15)5RACE1 TCAGCCAAAGGATGACCCGAGGAAC M. saxatilis (AY008746)3RACE1 TCTGACCTTCACCAGTCTGACATC M. saxatilis (AY008746)3RACE2 CACTTACTCGGGGCAGTTTGTTATG M. saxatilis (AY008746)3RACE4 GATACCGTCCTCCTACCAACATACTG M. saxatilis (AY008746)MsNramp736 TTGTCGTAGCGGTCTT M. saxatilis (AY008746)MsNramp1020 GGGACCACCGTAGGTTTA M. saxatilis (AY008746)5�MsNramp942f GCTGGACAGAGTTCCACCA-fa M. saxatilis (AY008746)3�MsNrampRed963p LCRed640-ACAGGCACTTACTCGGGG-pb M. saxatilis (AY008746)T3 ATTAACCCTCACTAAAGGGA Invitrogen Corp.T7 TAATACGACTCACTATAGGG Invitrogen Corp.GeneRacer 5� primer CGACTGGAGCACGAGGACACTGA Invitrogen Corp.GeneRacer 3� primer GCTGTCAACGATACGCTACCGTAACG Invitrogen Corp.GeneRacer 3� nested CGCTACGTAACGGCATGACAGTG Invitrogen Corp.M13F IRDye 800 CACGACGTTGTAAAACGAC LI-COR BiosciencesM13R IRDye 700 GGATAACAATTTCACACAGG LI-COR Biosciences

a f, fluorescein.b LCRed640, LightCycler Red 640 dye; p, phosphate.

1628 BURGE ET AL. INFECT. IMMUN.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Infection. Immediately before introduction of striped bass into the isolationfacility, fish were separated into three groups (10 fish each), anesthetized byusing 100 mg of Finquel (MS-222; Argent Chemical) per liter, weighed, andinoculated intraperitoneally with 1.5 ml of a diluted mycobacterial suspension orsterile PBS. Group 1 fish received 1.5 ml of PBS; group 2 fish received 1.4 � 106

CFU of M. marinum; and group 3 fish received 0.93 � 106 CFU of M. shottsii. Inorder to model mycobacterial infections as they might appear in a wild popula-tion (i.e., a long-term, chronic condition with low initial doses), the mycobacterialdoses were adjusted to ensure that fish received a sublethal challenge thatcorresponded to approximately 5,000 CFU/g. Previous work indicated that thedoses used were sublethal and would establish chronic infections (21). The dosesinjected were calculated by plating mycobacteria on Middlebrook agar.

Sampling. Three fish from each group were randomly selected 1, 3, and 15days postinoculation, anesthetized with a lethal dose of Finquel (500 mg/liter),and dissected to remove tissues for measurement of MsNramp. All media andreagents used for sample preparation and storage were obtained from SigmaChemical unless indicated otherwise. Samples (100 to 200 mg) of anterior kid-ney, spleen, and white muscle were removed, rinsed once in phenol-red freeHanks’ balanced salt solution (HBSS), and stored in RNAlater. Samples in RNAstorage buffer were kept overnight at 4°C and stored at �20°C, as recommendedby the manufacturer. PE cells were isolated as described above, without the useof Freund’s incomplete medium. PE cells were washed once in L-15 mediumcontaining 2% fetal bovine serum (Invitrogen), penicillin-streptomycin, and 10 Uof sodium heparin per ml and were counted with a Reichert Brightline hema-cytometer. The viability as assessed by trypan blue exclusion was greater than95% for all fish sampled. An aliquot containing 2 � 107 PM was removed forRNA extraction, washed once in HBSS, and resuspended in RNAlater. Analiquot containing 5 � 106 cells in HBSS was adhered to individual glass slidesby using a cytospin (Shandon, Inc., Pittsburgh, Pa.) at 700 � g for 7 min. Cytospinslides were either fixed in methanol (10 s) and stained with Wright-Giemsa stainor fixed in 1% paraformaldehyde (10 min) and stained by the Ziehl-Neelsenacid-fast technique (41). The remaining cells were fixed in 1.5% glutaraldehyde–0.1 M sodium cacodylate–0.15 M sucrose (pH 7.2) for 1 h for electron micros-copy.

Electron microscopy. Glutaraldehyde-fixed cells were postfixed for 1 h in 1%OsO4–0.1 M sodium cacodylate. The cells were dehydrated with a graded ethanolseries (10 to 100% ethanol) by using 15 min per step, with 1 h of en bloc stainingwith saturated uranyl acetate at the 70% ethanol step. Dehydration was followedby three 30-min incubations in 100% propylene oxide, and cells were embeddedin Spurr’s resin. Ultrathin sections (thickness, 90 nm) were prepared with aReichert-Jung ultramicrotome, mounted on Formvar-coated copper grids, andstained with Reynold’s lead citrate for 7 min. Stained sections were examinedwith a Zeiss CEM902 transmission electron microscope.

RNA extraction for induction of MsNramp in vivo. PM were removed fromRNAlater by dilution with 1 volume of HBSS and centrifugation at 4,000 � g for5 min. Anterior kidney, spleen, and white muscle samples were removed fromstorage buffer, and 100-mg subsamples were taken just prior to extraction. TotalRNA was isolated and evaluated as previously described. The integrity andquality of total RNA were assessed as previously described.

Real-time semiquantitative RT-PCR. Two gene-specific primers and two gene-specific hybridization probes were used to measure PCR product formation inreal time (Table 2) (63). This procedure was performed by using the RocheMolecular Biochemicals LightCycler system and the appropriate primers andhybridization probes developed by using LightCycler Probe Design software

(version 1.0; Idaho Technologies, Inc). All reagents were prepared at 4°C in lowlight to minimize nonspecific amplification and fluorophore degradation.

The PCR mixture consisted of water, manganese acetate (final concentration,4.25 mM), hybridization probes (each at a concentration of 0.2 �M), primers(each at a concentration of 0.5 �M), and a LightCycler RNA master hybridiza-tion probe enzyme mixture. To initiate the reaction, 500 ng of sample RNA wasadded to each capillary, and LightCycler cycling was begun immediately. RNAsamples were quantified immediately before use by spectrophotometric detec-tion at 260 and 280 nm, and the values were corrected for protein concentrationat 320 nm. RNA sample concentrations calculated by spectrophotometry werereproducible within 5%.

RT was performed at 61°C for 20 min, and this was followed by primarydenaturation of the RNA-cDNA hybrid at 95°C for 30 s. The amplificationreaction consisted of 45 cycles of denaturation at 95°C for 1 s, annealing andhybridization at 54°C for 15 s, and elongation at 72°C for 11 s. Each cycle wasfollowed by fluorescence monitoring with the LightCycler at 640 nm. Two am-plification reactions were performed for each RNA sample. Data collection andpreliminary analyses were conducted by using the LightCycler data analysissoftware (version 3.3).

Real-time RT-PCR analysis. MsNramp expression was quantified by calculat-ing the percent increase or decrease in transcript number in mycobacterium-infected tissues or cells compared to the transcript number in sham-injectedcontrols. Six replicates of each of five RNA concentrations (1,000, 500, 250, 100,and 50 ng of RNA) were amplified two or three times for each tissue type, anda mean efficiency of PCR (PCRE) was calculated (Table 2). The PCRE wascalculated as follows: PCRE 10�1/slope, where 1 � PCRE � 2.

The slopes for anterior kidney, PM, spleen, and white muscle were measuredby linear regression of the crossing points of the six replicates against the RNAconcentration. The crossing point of a real-time RT-PCR is the point duringamplification at which fluorescence of a sample increases above the backgroundfluorescence. This point on the amplification curve is proportional to the amountof starting template (MsNramp) in the sample. A percent difference is thencalculated as follows: percent difference (PCRE

Cp � 100) � 100 (22), whereCp (control sample crossing point � experimental sample crossing point).

Statistical analysis. To calculate crossing points and the slope for PCRE,linear regression was performed by using the LightCycler software (version 3.3).Intra- and interassay variations were analyzed by single-factor analysis of vari-ance (� 0.05), linear regression, Student’s t test, and power analysis of theexperimental system (22). Each time point sample (1, 3, and 15 days postinocu-lation) was analyzed by single-factor analysis of variance, and multiple compar-isons were performed by using Tukey’s multiple comparison (� 0.05 and � 0.01) in SAS (version 8.0; SAS Institute, Cary, N.C.), with Kramer’s modificationfor unequal sample sizes where appropriate.

Nucleotide and amino acid accession number. The M. saxatilis MsNrampnucleotide and deduced amino acid sequences have been deposited in the Gen-Bank database under accession number AY008746.

RESULTS

MsNramp is a 3,530-bp gene encoding a 554-amino-acidprotein. M. saxatilis PE cell cDNA for MsNramp was isolatedby using combinations of consensus mammal-, trout-, andstriped bass-specific primers (Table 1). Internal coding regionsequences were obtained by using primers NrampA andNrampB, primers NrampA and MDNMP4, and primersMDNMP1F and OmNramp1463. A total of 1,242 bp of theinternal coding region was sequenced in this manner. Theinternal fragments were used to design primers 5RACE1,3RACE1, 3RACE2, and 3RACE4 for use in 5� and 3� RACE-PCR. 5� RACE, performed with primers 5RACE1 and theGeneRacer 5� primer (Invitrogen), produced a 620-bp productthat included a 183-bp 5� UTR and the translation start codonat position 184. 3� RACE fragments contained a TAG termi-nation codon at position 1848 and a 1,682-bp 3� UTR. Com-pilation and alignment of all the fragments produced by RT-PCR and RACE demonstrated that MsNramp is a 3,530-bpgene with a 1,665-nucleotide single open reading frame encod-ing a 554-amino-acid polypeptide (Fig. 1). There are three

TABLE 2. Tissue-specific constitutive expression of MsNramp

Tissue Cp for controls(avg � SEM)a PCRE

bFold differencecompared withwhite musclec

Anterior kidney 21.01 � 0.29 1.72 85PE cells 23.54 � 0.18 1.80 28Spleen 18.90 � 0.32 1.70 240White muscle 29.20 � 0.32 1.72 NA

a The average crossing point (Cp) was calculated from nine control fish (threefish per time point); the crossing point is the cycle during amplification (45 totalcycles) at which fluorescence rises above the background level. The values for alltissues types are significantly different (P � 0.01).

b PCRE is the efficiency of the PCR for each tissue type.c The fold difference was calculated by using PCRE

Cp. NA, not applicable.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

regions of tandem repeats in the 3� UTR, at positions 1876 to1890 (consensus pattern TTCCTCT), 2050 to 2071 (AATCAGAA), and 2949 to 2971 (GTGTGATAAAAT). Two prospec-tive, atypical polyadenylation signals are present at position3425 (nonamer) and position 3436 (hexamer) and are followedclosely by a poly(dA) tail that is at least 32 nucleotides long.

Striped bass MsNramp has all the important motifs andregulatory elements of mammalian Nramp. The deducedamino acid sequence of striped bass MsNramp shows that thisprotein has a minimum molecular mass of 61,157 and contains

12 putative membrane-spanning domains composed of highlyhydrophobic amino acids (Fig. 2). Analysis of the protein to-pology predicted that the amino and carboxy termini existbelow the membrane with alternating internal and externalloops of hydrophilic amino acids. MsNramp contains threepotential amino-linked glycosylation sites in the external loopbetween TM 7 and TM 8. Two potential phosphorylation sitesrelated to protein kinase C, along with two casein kinase phos-phorylation signatures, are located in the amino terminus, anda single protein kinase C site and two additional casein kinase

FIG. 1. Striped bass MsNramp nucleotide and MsNramp amino acid sequences (GenBank accession number AY008746). Included are the183-bp 5� UTR, the 1,665-bp open reading frame, and the 1,682-bp 3� UTR. The numbers on the right indicate nucleotide and amino acid positions.The brackets indicate the ATG translation start codon (position 184) and the TAG termination codon (position 1848). Single-letter amino aciddesignations are located under the second nucleotide of the corresponding codons. The arrows indicate primer binding (see Table 1 and 2 forsequences). The motifs in boxes are potential microsatellite tandem repeats, the shaded areas indicate polyadenylation signals, and the double boxindicates the poly(dA) tail.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

FIG

.2.

ClustalX

amino

acidalignm

entofselected

Nram

phom

ologs.Abbreviations:M

s,M.saxatilis

MsN

ramp;T

rB

,T.rubripes

Nram

p�

;Dr,D

.rerioN

ramp;C

c,C.carpio

Nram

p;Ip,I.punctatusNram

p;Om

B,O

.mykissN

ramp�

;Hs2,H

.sapiensNram

p2;Mm

2,M.m

usculusNram

p2.Accession

numbersare

listedin

Materialsand

Methods.Periods

indicateam

inoacid

identitycom

paredto

thestriped

basssequence.T

heresidues

surroundedby

thicklines

arepotentialprotein

kinaseC

(PKC

)phosphorylation

sites,andthe

areasin

boxesare

caseinkinase

(CK

)m

otifs.The

polypeptidesthat

arein

doubleboxes

andshaded

areputative

TM

numbered

consecutively.The

cross-hatchedarea

between

TM

6and

TM

7is

aconsensus

tyrosinekinase

(TK

)m

otif,andthe

sequencessurrounded

bybroken

linesare

amino-linked

glycosylationsignatures

(N-gly).T

heconsensus

binding-protein-dependenttransport

systeminner

mem

branecom

ponentsignature

(transport)is

indicatedby

white

typeon

ablack

background.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

motifs are present in the carboxy-terminal end. A single ty-rosine kinase site is located between TM 6 and TM 7. Each ofthe potential phosphorylation sites is located within hydro-philic amino acid subsequences predicted to be intracellular. Ahighly conserved binding-protein-dependent transport systeminner membrane component signature, a prominent feature ofmurine Nramp1 and the proteins encoded by members ofseveral other iron transporter and channel gene families (13),is located in the intracellular region between TM 8 and TM 9.Unlike the C. carpio homolog (49) and other Nramp2 isoforms(31, 40) but similar to channel catfish NrampC (12), no iden-tifiable iron-responsive regulatory-binding-protein site (IRE)consensus sequence (CNNNNNCAGUG) (9) was identified inthe striped bass 3� UTR.

Alignment and phylogenetic analysis group striped bassMsNramp with other teleost and mammalian Nramp2 pro-teins. The striped bass MsNramp nucleotide and MsNrampamino acid sequences were aligned with the sequences of othervertebrate homologs (Nramp1 and Nramp2) (Fig. 2) in orderto examine potentially important distinguishing characteristics.Three distinct clades were evident in the phylogenetic analysisof Nramp nucleotide and Nramp amino acid sequences. Ver-tebrate Nramp1 clustered in one subgroup, while all teleostsequences clustered with mammalian Nramp2 proteins. Nrampsequences of the Cyprinidae and both paralogs from rainbowtrout formed a separate clade within the teleost sequences.MsNramp was phylogenetically most similar to T. rubripesNramp� (Fig. 3).

MsNramp mRNA is expressed in several tissues but at vari-able levels. Anterior kidney, brain, heart, gill, female and male

gonad, intestine, liver, muscle, PE, peripheral blood leukocyte,and spleen samples were positive for MsNramp mRNA tran-scripts as determined by qualitative RT-PCR with three primersets for three male and female striped bass (data not shown).PCR performed with total RNA prior to cDNA generationconfirmed that no genomic DNA contamination was present inthe mRNA samples. For each tissue 5 �g of RNA was ana-lyzed. Constitutive expression of MsNramp in striped bass tis-sues was variable, as determined by real-time semiquantitativeRT-PCR. The average crossing points for the different tissuetypes of control striped bass demonstrated that there werelarge constitutive differences in MsNramp expression. Compar-ison of constitutive expression (Table 2) in different tissuesrevealed that expression of MsNramp was lowest in white mus-cle. The levels of expression were approximately 28-, 85-, and240-fold higher in PE, anterior kidney, and spleen samples,respectively. Analysis of variance and Tukey’s multiple-com-parison test showed that each tissue type was significantly dif-ferent from each of the other tissue types (P � 0.01).

Cytology and ultrastructure confirmed that infection of PEcells occur within 1 day of injection of mycobacteria. To con-firm that striped bass exposed to Mycobacterium harbored my-cobacteria intracellularly within 1 day after infection, light mi-croscopy and transmission electron microscopy were used toexamine PE cells. All infected and control fish survived to theend of the experiment (15 days), and no outward manifesta-tions of disease were apparent. Fish inoculated with M. mari-num had gross inflammation of visceral fat and mesenteries at15 days postinfection, whereas sham-inoculated fish and M.shottsii-inoculated fish displayed no gross inflammation.

FIG. 3. Phylogenetic analysis of teleost and mammalian Nramp proteins. The numbers at the nodes are bootstrap values obtained after 10,000resampling efforts. The GenBank accession number for each taxon is indicated, and the relative genetic distances are indicated by the scale barand the branch lengths. The Nramp1 and Nramp2 proteins form two distinct clades, and all teleost sequences group with Nramp2.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Wright-Giemsa-stained cytospin preparations showed thatperitoneal lavages were composed primarily of macrophages(�50%), along with various numbers of lymphocytes andthrombocytes and low numbers of granulocytes. Ziehl-Neelsenstaining indicated that both M. marinum and M. shottsii werephagocytosed by PE cells within 1 day after injection. Electronmicroscopy revealed mycobacteria within membrane-limitedphagosome macrophages (Fig. 4).

MsNramp in M. marinum-inoculated striped bass is highlyinduced. A primary objective of this study was to document theinduction of MsNramp in fish exposed to M. marinum and M.shottsii (Fig. 5). The expression of MsNramp in PE cells ofstriped bass infected with M. marinum (Fig. 5B) was 1,701.0%� 14.02% higher than the expression in control PE cells within1 day after injection. The levels of MsNramp in PE cells con-tinued to be elevated after 3 and 15 days, and the levels ofexpression were 412.46% � 10.00% and 623.47% � 66.66% ofthe level of expression in the control, respectively. Anteriorkidney (Fig. 5A) MsNramp expression in fish exposed to M.marinum did not differ significantly from control expressionuntil 15 days, when the anterior kidney level of expression was130.31% � 10.58% of the level of expression in the control. Nosignificant increases were seen in spleen or white muscle sam-ples on any day (data not shown).

M. shottsii induces expression of MsNramp in striped bassPE cells. PE cells of striped bass inoculated with M. shottsiiexpressed MsNramp at levels that were 216.47% � 9.86%,461.34% � 20.79%, and 311.89% � 21.45% of the controllevels on days 1, 3, and 15, respectively (Fig. 5B). No significantinduction of MsNramp was seen in anterior kidney samples(Fig. 5A) at any time after injection. The expression in thespleen was depressed at 3 days (P � 0.05) compared with theexpression in day 3 controls, but by 15 days the levels ofMsNramp in spleen samples were statistically similar for con-trol and M. shottsii-inoculated fish. The results for white mus-cle were more variable than the results for the other tissues,although the values were much lower, and depression ofMsNramp transcription was observed at day 1 (P � 0.01) (datanot shown).

DISCUSSION

In this study, we examined the in vivo expression of the M.saxatilis homolog of the Nramp gene (MsNramp) during expo-sure to mycobacteria. We found that striped bass MsNramptranscription is significantly upregulated (17-fold) in PE cellsfollowing infection with M. marinum. M. shottsii also inducedexpression, although not to the degree seen with M. marinum.Induction of expression was rapid (less than 24 h) and longlasting (more than 15 days) in PE cells. The long-lasting natureof the induction may have been the result of mycobacterialreplication, additional infection of previously naı̈ve PE cells,and/or long-lasting induction within individual PE cells. Stim-ulation of mouse bone marrow-derived macrophages with LPSand gamma interferon has shown that there is rapid inductionof Nramp1, which peaks at 12 h (3), while functional alleles ofmurine Nramp1 have a bacteriostatic effect on Mycobacteriumavium-containing phagosomes for at least 10 days (19). In themurine model, Nramp1 is recruited to the membrane of thephagolysosome during the initial stages of mycobacterial infec-tion (29), where it maintains the fusiogenic properties of thiscompartment (19). It is likely, based on the high sequencesimilarity between mammalian and striped bass homologs andon the pattern of induction seen for mycobacterium-infectedPE cells, that striped bass uses the gene product in a similarfashion.

PE cells of fishes consist of an enriched population of highlyactivated phagocytes that serve as important mediators of theimmune response to infection within the peritoneal cavity (16).Assuming that the elevated levels of MsNramp expression inperitoneal preparations is of macrophage origin, lower totallevels of MsNramp in anterior kidney and spleen samples fromfish inoculated with mycobacteria would be expected as theproportion of macrophages in these tissues is significantlylower than the proportion of PE cells. Trafficking of mycobac-teria by infected PE cells may account for the late increase inMsNramp expression observed in anterior kidney samples. Pre-vious work has shown that well-developed granulomas are notpresent histologically in anterior kidney samples 2 weeks after

FIG. 4. (a) M. marinum (arrow) within a striped bass macrophage. (b) M. shottsii (arrowheads) within striped bass macrophages. Mycobacteriaare contained within a membrane-limited phagosome and are surrounded by electron-opaque material. The images were obtained 24 h afterinjection. Bars 1 �m.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

intraperitoneal injection of mycobacteria (21). In the samestudy the workers did observe small numbers of acid-fast my-cobacteria within inflammatory foci of anterior kidney andspleen samples 2 weeks after intraperitoneal injection. Longer-term analysis of MsNramp expression may indicate that asinfection occurs within the anterior kidney and spleen, differ-entiation and activation of resident macrophages are accom-panied by upregulation of this gene.

The conserved features of MsNramp include a topology of12 TM, N- and C-terminal phosphorylation sites, extracyto-plasmic glycosylation, and the binding protein-dependenttransport system inner membrane component signature. Thetransport signature is implicated in ATP-binding related totransport functions (2) and is found in several gene familieswhose members encode iron transporters and channels (13).Alternative splicing has been identified in several Nramp2 ho-mologs, including human (40), mouse and rat (56), macaque(65), and channel catfish (12) homologs. In the mammalianNramp studies, alternative splicing was shown to correspond toalternate C-terminal amino acids, distinctive subcellular or tis-sue expression, and the presence or absence of an IRE. IREsare stem-loop RNA structures often found in genes that areposttranscriptionally regulated by cellular iron concentrations,as Nramp2 (DCT1) appears to be in rats (30). Channel catfish

splice variants resulted in a single, non-IRE-encoding openreading frame, irregardless of which transcript was translated.No genetic evidence for a second locus or alternative splicingwas found for the striped bass homolog, and preliminary workwith polyclonal antisera directed against the C-terminal 20amino acids of channel catfish NrampC resulted in identifica-tion of a single band in striped bass but two separate bands inchannel catfish (Charles Rice, Clemson University, personalcommunication).

In summary, isolation of important disease resistance lociand characterization of gene products are important prelimi-nary steps toward a greater understanding of disease resistancein economically valuable finfish (17). Genes responsible forinnate resistance to intracellular pathogens are likely candi-dates for selective breeding in aquaculture (62) and enhanceour understanding of the evolution of innate immunity in ver-tebrates. This study demonstrated that striped bass contain ahighly conserved natural resistance-associated macrophageprotein, MsNramp, that has a high level of homology to mam-malian Nramp2 and has all the hallmark features of the pro-teins encoded by the Nramp gene family described for humans(37, 38) and mice (28, 61). MsNramp is induced in vivo in PEcells within 1 day of injection of Mycobacterium spp. This is the

FIG. 5. Expression of M. saxatilis MsNramp as measured by real-time RT-PCR 1, 3, and 15 days after inoculation of M. marinum or M. shottsii.(A) Anterior kidney (AK) results; (B) PE cell results. Note the difference in scale. The data are the means � standard errors of the means ofduplicate measurements for three fish per tissue per time point. One asterisk and two asterisks indicate that values are significantly different (P� 0.05 and P � 0.01, respectively) from the corresponding control values (uninfected group), as determined by multiple comparison with the Tukeytest or the Kramer modification of Tukey’s test for unequal sample sizes.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

first report of induction of an Nramp gene from fish exposed tointracellular pathogens.

ACKNOWLEDGMENTS

We thank the staff of the laboratory of John Graves for technicalassistance with sequencing, Martha Rhodes and Howard Kator forcultures of M. marinum and M. shottsii, Corinne Audemard and Seon-Sook An for LightCycler assay development, Courtney E. Harris forstatistical analysis, and Stephen L. Kaattari for editorial comments anda critical review.

REFERENCES

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.Basic local alignment search tool. J. Mol. Biol. 215:403–410.

2. Ames, G. F. 1986. Bacterial periplasmic transport systems: structure, mech-anism, and evolution. Annu. Rev. Biochem. 55:397–425.

3. Atkinson, P. G. P., J. M. Blackwell, and C. H. Barton. 1997. Nramp1 locusencodes a 65 kDa interferon- -inducible protein in murine macrophages.Biochem. J. 325:779–786.

4. Bellamy, R. 2003. Susceptibility to mycobacterial infections: the importanceof host genetics. Genes Immun. 4:4–11.

5. Belouchi, A., M. Cellier, T. Kwan, H. S. Saini, G. Leroux, and P. Gros. 1995.The macrophage-specific membrane protein Nramp controlling natural re-sistance to infections in mice has homologues expressed in the root system ofplants. Plant Mol. Biol. 29:1181–1196.

6. Benson, G. 1999. Tandem repeats finder: a program to analyze DNA se-quences. Nucleic Acids Res. 27:573–580.

7. Blaschke, V., K. Reich, S. Blaschke, S. Zipprich, and C. Neumann. 2000.Rapid quantitation of proinflammatory and chemoattractant cytokine ex-pression in small tissue samples and monocyte-derived dendritic cells: vali-dation of a new real-time RT-PCR technology. J. Immunol. Methods 246:79–90.

8. Cardinal, J. L. 2001. Mycobacteriosis in striped bass, Morone saxatilis, fromVirginia waters of Chesapeake Bay. M.S. thesis. College of William andMary, Virginia Institute of Marine Science, Gloucester Point, Va.

9. Casey, J. L., M. W. Hentze, D. M. Koeller, S. W. Caughman, T. A. Rouault,R. D. Klausner, and J. B. Harford. 1988. Iron-responsive elements: regula-tory RNA sequences that control mRNA levels and translation. Science240:924–928.

10. Cellier, M., A. Belouchi, and P. Gros. 1996. Resistance to intracellularinfections: comparative genomic analysis of Nramp. Trends Genet. 12:201–204.

11. Cellier, M., G. Govoni, S. Vidal, T. Kwan, N. Groulx, J. Liu, F. Sanchez, E.Skamene, E. Schurr, and P. Gros. 1994. Human natural resistance-associ-ated macrophage protein: cDNA cloning, chromosomal mapping, genomicorganization, and tissue-specific expression. J. Exp. Med. 180:1741–1752.

12. Chen, H., G. C. Waldbieser, C. D. Rice, B. Elibol, W. R. Wolters, and L. A.Hanson. 2002. Isolation and characterization of channel catfish natural re-sistance associated macrophage protein gene. Dev. Comp. Immunol. 26:517–531.

13. Dassa, E., and M. Hofnung. 1985. Sequence of gene malG in E. coli K12:homologies between integral membrane components from binding protein-dependent transport systems. EMBO J. 4:2287–2293.

14. Donovan, A., A. Brownlie, M. O. Dorschner, Y. Zhou, S. J. Pratt, B. H. Paw,R. B. Phillips, C. Thisse, B. Thisse, and L. I. Zon. 2002. The zebrafish mutantgene chardonnay (cdy) encodes divalent metal transporter 1 (DMT1). Blood100:4655–4659.

15. Dorschner, M. O., and R. B. Phillips. 1999. Comparative analysis of twoNramp loci from rainbow trout. DNA Cell Biol. 18:573–583.

16. Enane, N. A., K. Frenkel, J. M. O’Connor, K. S. Squibb, and J. T. Zelikoff.1993. Biological markers of macrophage activation: applications for fishphagocytes. Immunology 80:68–72.

17. Fjalestad, K. T., T. Gjedrem, and B. Gjerde. 1993. Genetic improvement ofdisease resistance in fish: an overview. Aquaculture 111:65–74.

18. Forbes, J. R., and P. Gros. 2001. Divalent-metal transport by NRAMPproteins at the interface of host-pathogen interactions. Trends Microbiol.9:397–403.

19. Frehel, C., F. Canonne-Hergaux, P. Gros, and C. De Chastellier. 2002. Effectof Nramp1 on bacterial replication and on maturation of Mycobacteriumavium-containing phagosomes in bone marrow-derived mouse macrophages.Cell. Microbiol. 4:541–556.

20. Frohman, M. A., M. K. Dush, and G. R. Martin. 1988. Rapid production offull-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. 85:8998–9002.

21. Gauthier, D. T., M. W. Rhodes, W. K. Vogelbein, H. Kator, and C. A.Ottinger. 2003. Experimental mycobacteriosis in striped bass Morone saxa-tilis. Dis. Aquat. Organisms 54:105–117.

22. Gentle, A., F. Anastasopoulos, and N. A. McBrien. 2001. High-resolutionsemi-quantitative real-time PCR without the use of a standard curve. Bio-Techniques 31:502–508.

23. Gomes, M. S., and R. Appelberg. 2002. NRAMP1- or cytokine-inducedbacteriostasis of Mycobacterium avium by mouse macrophages is indepen-dent of the respiratory burst. Microbiology 148:3155–3160.

24. Govoni, G., F. Canonne-Hergaux, C. G. Pfeifer, S. L. Marcus, S. D. Mills,D. J. Hackam, S. Grinstein, D. Malo, B. B. Finlay, and P. Gros. 1999.Functional expression of Nramp1 in vitro in the murine macrophage lineRAW264.7. Infect. Immun. 67:2225–2232.

25. Govoni, G., S. Gauthier, F. Billia, N. N. Iscove, and P. Gros. 1997. Cell-specific and inducible Nramp1 gene expression in mouse macrophages invitro and in vivo. J. Leukoc. Biol. 62:277–286.

26. Govoni, G., S. Vidal, S. Gauthier, E. Skamene, D. Malo, and P. Gros. 1996.The Bcg/Ity/Lsh locus: genetic transfer of resistance to infections inC57BL/6J mice transgenic for Nramp1 Gly169 allele. Infect. Immun. 64:2923–2929.

27. Gros, P., E. Skamene, and A. Forget. 1981. Genetic control of naturalresistance to Mycobacterium bovis (BCG) in mice. J. Immunol. 127:2417–2421.

28. Gruenheid, S., M. Cellier, S. Vidal, and P. Gros. 1995. Identification andcharacterization of a second mouse Nramp gene. Genomics 25:514–525.

29. Gruenheid, S., E. Pinner, M. Desjardins, and P. Gros. 1997. Natural resis-tance to infection with intracellular pathogens: the Nramp1 protein is re-cruited to the membrane of the phagosome. J. Exp. Med. 185:717–730.

30. Gunshin, H., C. R. Allerson, M. Polycarpou-Schwarz, A. Rofts, J. T. Rogers,F. Kishi, M. W. Hentze, T. A. Rouault, N. C. Andrews, and M. A. Hediger.2001. Iron-dependent regulation of the divalent metal ion transporter. FEBSLett. 509:309–316.

31. Gunshin, H., B. Mackenzie, U. V. Berger, Y. Gunshin, M. F. Romero, W. F.Boron, S. Nussberger, J. L. Gollan, and M. A. Hediger. 1997. Cloning andcharacterization of a mammalian proton-coupled metal-ion transporter. Na-ture 388:482–488.

32. Heckert, R. A., S. Elankumaran, A. Milani, and A. Baya. 2001. Detection ofa new Mycobacterium species in wild striped bass in the Chesapeake Bay.J. Clin. Microbiol. 39:710–715.

33. Hedrick, R. P., T. McDowell, and J. Groff. 1987. Mycobacteriosis in culturedstriped bass from California. J. Wildl. Dis. 23:391–395.

34. Hofmann, K., P. Bucher, L. Falquet, and A. Bairoch. 1999. The PROSITEdatabase, its status in 1999. Nucleic Acids Res. 27:215–219.

35. Hoyt, R. E., J. E. Bryant, S. F. Glessner, F. C. Littleton, Jr., R. W. Sawyer,R. J. Newman, D. B. Nichols, A. P. Franco, Jr., and N. R. Tingle, Jr. 1989.M.marinum infections in a Chesapeake Bay community. Va. Med. 116:467–470.

36. Hu, J., N. Bumstead, D. Burke, F. A. P. D. Leon, E. Skamene, P. Gros, andD. Malo. 1995. Genetic and physical mapping of the natural resistance-associated macrophage protein 1 (NRAMP1) in chicken. Mamm. Genome6:809–815.

37. Kishi, F. 1994. Isolation and characterization of human Nramp cDNA.Biochem. Biophys. Res. Commun. 204:1074–1080.

38. Kishi, F., and M. Tabuchi. 1998. Human natural resistance-associated mac-rophage protein 2: gene cloning and protein identification. Biochem. Bio-phys. Res. Commun. 251:775–783.

39. Kumar, S., K. Tamura, I. B. Jakobsen, and M. Nei. 2001. MEGA2: molec-ular evolutionary genetics analysis software. Bioinformatics 17:1244–1245.

40. Lee, P. L., T. Gelbart, C. West, C. Halloran, and E. Beutler. 1998. Thehuman Nramp2 gene: characterization of the gene structure, alternativesplicing, promoter region and polymorphisms. Blood Cells Mol. Dis. 24:199–215.

41. Luna, L. G. (ed.). 1968. Manual of histologic staining methods of the ArmedForces Institute of Pathology, 3rd ed. McGraw-Hill, New York, N.Y.

42. Makui, H., E. Roig, S. T. Cole, J. D. Helmann, P. Gros, and M. F. Cellier.2000. Identification of the Escherichia coli K-12 Nramp orthologue (MntH)as a selective divalent metal ion transporter. Mol. Microbiol. 35:1065–1078.

43. Nigrelli, R. F., and H. Vogel. 1963. Spontaneous tuberculosis in fishes and inother cold-blooded vertebrates with special reference to Mycobacterium for-tuitum Cruz from fish and human lesions. Zoologica (New York) 48:131–143.

44. Pinner, E., S. Gruenheid, M. Raymond, and P. Gros. 1997. Functionalcomplementation of the yeast divalent cation transporter family SMF byNRAMP2, a member of the mammalian natural resistance-associated mac-rophage protein family. J. Biol. Chem. 272:28933–28938.

45. Portnoy, M. E., X. F. Liu, and V. C. Culotta. 2000. Saccharomyces cerevisiaeexpresses three functionally distinct homologues of the nramp family ofmetal transporters. Mol. Cell. Biol. 20:7893–7902.

46. Rhodes, M. W., H. Kator, S. Kotob, P. van Berkum, I. Kaattari, W. Vogel-bein, M. M. Floyd, W. R. Butler, F. D. Quinn, C. Ottinger, and E. Shotts.2001. A unique Mycobacterium species isolated from an epizootic of stripedbass (Morone saxatilis). Emerg. Infect. Dis. 7:896–899.

47. Rhodes, M. W., H. Kator, S. Kotob, P. van Berkum, I. Kaattari, W. Vogel-bein, F. Quinn, M. M. Floyd, W. R. Butler, and C. A. Ottinger. 2003.Mycobacterium shottsii sp. nov., a slowly growing species isolated from Ches-apeake Bay striped bass (Morone saxatilis). Int. J. Syst. Evol. Microbiol.53:421–424.

48. Rodrigues, V., P. Y. Cheah, K. Ray, and W. Chia. 1995. malvolio, the Dro-sophila homologue of mouse NRAMP-1 (Bcg), is expressed in macrophages



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

and in the nervous system and is required for normal taste behaviour. EMBOJ. 14:3007–3020.

49. Saeij, J. P. J., G. F. Wiegertjes, and R. J. M. Stet. 1999. Identification andcharacterization of a fish natural resistance-associated macrophage protein(NRAMP) cDNA. Immunogenetics 50:60–66.

50. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new methodfor reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406–425.

51. Secombes, C. J. 1990. Isolation of salmonid macrophages and analysis oftheir killing activity, p. 137–154. In T. C. Fletcher, D. P. Anderson, B. S.Roberson, and W. B. van Muiswinkel (ed.), Techniques in fish immunology,vol. 1. SOS Publications, Fair Haven, N.J.

52. Sibthorpe, D. 2002. Molecular evolution of the solute carrier family 11(SLC11) protein in the pufferfish, Fugu rubripes. Ph.D. thesis. University ofCambridge, Cambridge, United Kingdom.

53. Stordeur, P., L. F. Poulin, L. Craciun, L. Zhou, L. Schandene, A. de Lava-reille, S. Goriely, and M. Goldman. 2002. Cytokine mRNA quantification byreal-time PCR. J. Immunol. Methods 259:55–64.

54. Su, M. A., C. C. Trenor III, J. C. Fleming, M. D. Fleming, and N. C. Andrews.1998. The G185R mutation disrupts function of the iron transporterNramp2. Blood 6:2157–2163.

55. Tabaska, J. E., and M. Q. Zhang. 1999. Detection of polyadenylation signalsin human DNA sequences. Gene 231:77–86.

56. Tabuchi, M., N. Tanaka, J. Nishida-Kitayama, H. Ohno, and F. Kishi. 2002.Alternative splicing regulates the subcellular localization of divalent metaltransporter 1 isoforms. Mol. Biol. Cell 13:4371–4387.

57. The C. elegans Sequencing Consortium. 1998. Genome sequence of the

nematode C. elegans: a platform for investigating biology. Science 282:2012–2018.

58. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1997. The ClustalXWindows interface: flexible strategies for multiple sequence alignment aidedby quality analysis tools. Nucleic Acids Res. 22:4673–4680.

59. Torres, M. J., A. Criado, J. C. Palomares, and J. Aznar. 2000. Use ofreal-time PCR and fluorimetry for rapid detection of rifampin and isoniazidresistance-associated mutations in Mycobacterium tuberculosis. J. Clin. Mi-crobiol. 38:3194–3199.

60. Tusnady, G. E., and I. Simon. 2001. The HMMTOP transmembrane topol-ogy prediction server. Bioinformatics 17:849–850.

61. Vidal, S. M., D. Malo, K. Vogan, E. Skamene, and P. Gros. 1993. Naturalresistance to infection with intracellular parasites: isolation of a candidatefor Bcg. Cell 73:469–485.

62. Wiegertjes, G. F., R. J. M. Stet, H. K. Parmentier, and W. B. van Muiswinkel.1996. Immunogenetics of disease resistance in fish: a comparative approach.Dev. Comp. Immunol. 20:365–381.

63. Wittwer, C. T., M. G. Herrmann, A. A. Moss, and R. P. Rasmussen. 1997.Continuous fluorescence monitoring of rapid cycle DNA amplification. Bio-Techniques 22:130–131, 134–138.

64. Zeligman, I. 1972. Mycobacterium marinum granuloma. A disease acquiredin the tributaries of Chesapeake Bay. Arch. Dermatol. 106:26–31.

65. Zhang, L., T. Lee, Y. Wang, and T. W. Soong. 2000. Heterologous expression,functional characterization and localization of two isoforms of the monkeyiron transporter Nramp2. Biochem. J. 349:289–297.

Editor: F. C. Fang



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Mycobacterium-Inducible Nramp in Striped Bass (Morone saxatilis)†

Documents

Transcript of Mycobacterium-Inducible Nramp in Striped Bass (Morone saxatilis)†