Vol. 11, No. 6MOLECULAR AND CELLULAR BIOLOGY, June 1991, p. 3163-31700270-7306/91/063163-08$02.00/0Copyright X 1991, American Society for Microbiology

Multiple Dispersed Spontaneous Mutations: a Novel Pathway ofMutation in a Malignant Human Cell LineJANET HARWOOD, AKIRA TACHIBANA, AND MARK MEUTH*

Clare Hall Laboratories, Imperial Cancer Research Fund, Blanche Lane,South Mimms, Hertfordshire EN6 3LD, United Kingdom

Received 7 January 1991/Accepted 25 March 1991

We analyzed the nature of spontaneous mutations at the autosomal locus coding for adenine phosphoribo-syltransferase in the human colorectal carcinoma cell line SW620 to establish whether distinctive mutationalpathways exist that might underlie the more complex genome rearrangements arising in tumor cells. Pointmutations occur at a low rate in aprt hemizygotes derived from SW620, largely as a result of base substitutionsat G- C base pairs to yield transversions and transitions. However, a novel pathway is evident in the form ofmultiple dispersed mutations in which two errors, separated by as much as 1,800 bp, fall in the same mutantgene. Such mutations could be the result of error-prone DNA synthesis occurring during normal replication orduring long-patch excision-repair of spontaneously arising DNA lesions. This process could also contribute tothe chromosomal instability evident in these tumor cells.

There is increasing evidence that tumor development andprogression is a stepwise process involving accumulation ofphenotypic and genotypic alterations. These alterations in-clude point mutations (for a review, see reference 39) ormore complex DNA rearrangements (such as translocationsor inversions [6, 15]) activating dominant oncogenes anddeletions eliminating tumor suppressor genes (13, 14, 27).Systematic analyses of human colorectal and breast tumorDNAs have uncovered eight or more frequently occurringmutations (2, 12). To explain the accumulation of such largenumbers of mutations, it has been proposed that an acquiredgenetic lability or a mutator phenotype may be acquired asan early event in tumor development (28). Unfortunately,this argument appears to be incompatible with the low rate ofspontaneous mutation found in both normal and malignantcells (9, 20, 21).To study the nature of mutations in tumor cells undergoing

successive chromosomal rearrangements and the factorsgoverning their formation, we analyzed alterations at theautosomal locus coding for the purine salvage enzymeadenine phosphoribosyltransferase (APRT) in the humancolorectal carcinoma cell line SW620. This line was estab-lished from a secondary lymph node tumor and has under-gone numerous chromosome rearrangements (22). To facil-itate selection and analysis of APRT-deficient mutants,hemizygous strains were isolated and characterized. In thiscommunication, we describe the nature of spontaneousmutations arising in these hemizygous strains and show thata novel type is evident in the form of multiple dispersedmutations. Such alterations could be the result of error-prone DNA synthesis occurring during normal replication orlong-patch excision-repair of spontaneously arising DNAlesions and could contribute to the chromosomal instabilityevident in these tumor cells.

* Corresponding author.

MATERIALS AND METHODS

Cell culture. Cultures of SW620 cells were routinely main-tained as monolayers in Dulbecco modified Eagle medium(DMEM; GIBCO)-10% fetal calf serum (FCS; GIBCO).Colonies and single-cell clones were grown to approximately106 cells in DMEM-10% FCS-5% horse serum (HS;GIBCO)-200 ,ug of sodium pyruvate (Sigma) per ml andsubsequently cultured in DMEM-10% FCS. Single-cellclones were obtained by plating 100 ml of cells diluted to10/ml in 96-well plates (Nunc) in DMEM-10% FCS-5%HS-200 ,ug of sodium pyruvate per ml, and cells frompositive wells were picked after 10 to 14 days.Mutant selections. Hemizygous cell strains were isolated

by plating 5 x 105 SW620 cells per 10-cm-diameter platein DMEM-10% dialyzed FCS-5 pug of 8-azaadenine (Sigma)per ml. APRT-deficient mutants were obtained from Luria-Delbruck fluctuation tests in which replica cultures of 103cells were grown to approximately 107 cells. All of thecells from each replica culture were plated in DMEM-10%dialyzed FCS-50 ,ug of 8-azaadenine per ml at a densitynot exceeding 5 x 105/10-cm-diameter dish. Only one colonywas picked from each positive replica after 14 daysin selective medium and transferred to routine culture me-dium.

Southern blot analysis. Genomic DNA was purified fromcell strains on an Applied Biosciences DNA extractor. A10-,ug sample of genomic DNA was digested with restrictionenzymes (BRL) as recommended by the manufacturer be-fore fractionation on 1% Tris-acetate agarose gels. The DNAwas transferred to Biotrace filters (Gelman Sciences) byusing 0.4 M NaOH. Probes were labeled by random priming(11). Filters were hybridized and washed as previouslydescribed (26).DNA sequence analysis of mutant genes. Mutant genes were

analyzed by direct sequencing of the double-stranded prod-ucts obtained from amplification of each exon of the aprtgene. The oligonucleotides used were all 20-mers, beginningat nucleotides 477, 756, 1848, 2251, and 2851 (this nucleotidenumbering conforms to that in reference 16), for extension inthe 5' direction for exons I to V, respectively. For 3'

3163

3164 HARWOOD ET AL.

BamHl

Smal

BamHIEcoRI

BamHI

Taql 0.6kb 2.1 kb

2.7kb

S21

S20

S17

FIG. 1. Restriction endonuclease map of the aprt locus and the surrounding region in SW620. The top portion represents the cloned17.4-kb EcoRI fragment which bears the aprt gene (filled box) and flanking BamHI fragments mapped by Southern blotting. The lower portionrepresents a more detailed map of the structural gene; the exons are represented by open boxes numbered I to V. The polymorphic TaqI siteis boxed. The 2.7-, 2.1-, and 0.6-kb fragments which result from probing of a Southern blot of a TaqI digest of SW620 genomic DNA withthe labeled SmaI-BamHI aprt fragment (map positions 1.1 to 2.8) are indicated. The regions deleted in mutants S21 and S20 (extendingupstream and downstream of aprt, respectively) are indicated, together with the proposed site of the breakpoint of the complex rearrangementin S17. The numbered markers represent kilobase pairs.

extension, 20-mers commencing at nucleotides 736, 1006,2122, 2499, and 2509 were used for exons I to V. Amplifica-tion by polymerase chain reaction (PCR) was accomplishedas described previously (29), except that the deoxynucleo-side triphosphate concentration was 300 ,uM. The PCRproducts were purified by spinning through a Sephadex G50(Pharmacia) column and ethanol precipitated. Approxi-mately 100 ng of the PCR product was used as the templatein the sequencing reaction as described in the Sequenase(USB) protocol, except that the labelling mixture was mod-ified to include dATP and a nested 32P-end-labeled primer.

Fluorescence-activated chromosome sorting. Cultures ofSW620 were treated overnight with colcemid (0.05 ,ug/ml),and chromosomes were prepared by the digitonin-polyaminemethod (5, 40). A final centrifugation (1,500 x g, 1 min) was

used to remove nuclei. The chromosome suspension was

stained with fluorescent dyes (Hoechst 33258 at 2.8 ,ug/mland chromomycin A3 at 75 ,ug/ml), and after equilibrationat 4°C for 2 h, the chromosomes were analyzed on a

dual-beam FACStar Plus cell sorter (Becton Dickinson Im-munocytometry Systems). The primary laser was tuned to351 to 664 nm to excite Hoechst 33258, and the secondarylaser was tuned to 458 nm to excite chromomycin A3.Chromosomes were passed through the sorter at approxi-mately 200/s, and the bivariate distributions were collected.Samples equivalent to 500 chromosomes each were sorted in

sheath fluid (0.1 M NaCl, 10 mM Tris HCI, 1 mM EDTA)from appropriate windows directly into tubes containingPCR buffer (10 ,ul of lOx buffer and 70 ,ul of sterile distilledwater; Promega). No DNA purification procedures wereperformed.

Nucleotide sequence accession number. The accession num-ber of the nucleotide sequence discussed in this report isEMBL Y00486.

RESULTS

Derivation of SW620 strains hemizygous for aprt. To facil-itate analysis of mutations of aprt, hemizygous strains wereobtained from SW620 by selecting for partial resistance tothe adenine analog 8-azaadenine (19). A TaqI polymorphismin intron 2 was used to distinguish the two aprt alleles inSW620 by Southern blot analysis (Fig. 1). These blotsshowed that two different types of strains, distinguishable byretention of one or the other allele, were obtained in theseselections (Fig. 2).As SW620 retains only one apparently intact chromosome

16 (7a), the normal map position for aprt, the presumedhemizygotes were analyzed for retention of this chromo-some. To accomplish this, metaphase chromosomes fromwild-type and mutant strains were fractionated by fluores-

MOL. CELL. BIOL.

MULTIPLE MUTATIONS IN A HUMAN TUMOR CELL LINE 3165

Taql

o CM

2.7kb- *

2.1kbo _ * I

BamHl

o) C\M

LC) rN CO CO)T- T- CM C\ D D- CmU? C/) U) /) I )X :I )0

.k w

TABLE 1. Mutation rates in SW620 hemizygotes retaining eitheraprt allele

Cell strain HUS17 HUS12

Chromosomal location Rearranged Intact 16of aprt allelea

No. of replicate cultures 20 28Mean initial cell no. 20 1,000Mean final cell no. ± (1.6 ± 0.43) x 107 (1.22 + 0.29) x 107SD

No. of cells plated All AllNo. of cultures with 8- 14 12

azaadenine-resistantcolonies

Range of mutants/ 0-17 0-36replica

Mean no. of mutants/ 6.1 3.0replica

Variance 20.1 48.2Variance/mean no. of 3.45 16.1mutants

Mutation rate/cell/ 5.2 x 10-8 3.2 x 10-8generation

a Reference 14a.

0.6kb.s

FIG. 2. Southern blot analysis of genomic DNAs from parentalSW620, hemizygous, and APRT-deficient strains. TaqI and BamHIdigests of hemizygotes HUS12 (with TaqI) and HUS3 (withoutTaqI) are presented, together with mutations derived from theHUS12 strain. In S17, a novel 2.2-kb fragment is gained in TaqIdigests while the 600-bp fragment is lost. No signal is detected withthis probe in S20, as this region of the gene is deleted. The BamHIaprt fragment of S21 shows an increase in size to 2.5 kb as a re-sult of elimination of the 5' BamHI site. S15 has no changes visi-ble on the blots, indicating a point mutation, small deletion, orinsertion.

cence-activated chromosome sorting and further analyzedfor the presence of the TaqI polymorphism in the aprt geneby PCR. Figure 3 shows that a distinguishable chromosome16 was present in the profiles from SW620 and the class ofpartially resistant strains bearing the allele with the TaqI site(represented by HUS12). However, the second type ofhemizygote (HUS17, lacking the intron 2 TaqI site) had nointact chromosome 16 remaining, indicating substantial de-letion or rearrangement of this chromosome, resulting in theloss of one aprt allele. The presence of the allele bearing theTaqI site on chromosomes 16 sorted from both SW620 andthe first hemizygote was confirmed by amplification of theregion bearing the polymorphism and digestion of the prod-uct by TaqI (Fig. 3D). Thus, the hemizygous strain HUS12retains the allele with the TaqI site on an apparently normalchromosome 16, while HUS17 retains the allele on an alteredchromosome.Another chromosome rearrangement was evident in the

profiles from HUS12 (Fig. 3B); however, we were unable todetermine whether this alteration occurred as a result ofdeletion of aprt.

Selection of APRT-deficient strains. To determine whetherthe previous rearrangement of chromosome 16 affects the

mutation rate to complete deficiency at aprt, both strainswere used in Luria-Delbruck fluctuation tests. Table 1 showsthat the rates of mutation were virtually identical in strainsretaining either allele, indicating that previous chromosomerearrangements apparently do not influence the likelihood orthe nature (see below) of further mutations in the hemizy-gous strains. Furthermore, the rates measured are as low as,if not lower than, those observed for diploid human cell lines(9, 37), despite the highly aneuploid karyotype of SW620.Independent drug-resistant strains were selected from thereplica cultures for further analysis of aprt gene structureand sequence.

Southern blot analysis. DNA was purified from 53 isolatesand digested with restriction endonucleases for analysis ofaprt gene structure on Southern blots. Most of the mutants(e.g., S15 in Fig. 2) had no alteration of the pattern of aprtfragments, indicating that the drug resistance was the resultof base substitution or small rearrangements. Five strains(S17, S20, S21, S117, and S119) had aberrant patternsconsistent with the presence of large deletions (>5 kb) ormore complex rearrangements (Fig. 2).DNA sequence analysis. Mutations in APRT-deficient

strains were characterized at the nucleotide level by ampli-fying exon sequences by using the PCR and sequencing thedouble-stranded products (29). The sequences clearlyshowed that the isolates obtained in the selections for partialdrug resistance were hemizygotes, since only mutant se-quences were evident (Fig. 4). These analyses also revealedthat most of the mutations were simple base substitutions,small deletions, or insertions distributed throughout thestructural gene (Tables 2 and 3; Fig. 5A and B). G. C basepairs were the most frequent target of the base substitutions(81%), and transversions constituted the largest class. Mostproduced nonconservative amino acid substitutions, six oc-curred at splice sites, and three gave nonsense codons. Smalldeletions, frameshifts, and duplications represented about20% of the mutations (Fig. SA). Small deletions fell betweenshort direct or inverted repeats. There was no significantdifference between the types of mutations occurring at theG C targets in the two hemizygous strains (Table 3; Fig. 5Aand B).

VOL. 11, 1991

3166 HARWOOD ET AL.

A D L 1 2 3 4 5 6 7 8 9

* 4p

*A3wA, .4p _.

...4jlt*

Atf.

1;3 1 3B Le >

Ch, rmcmy 1r1 F1 u r s:c e

B

v*.

-.4~.

CD I QQ 2c1[a 2 .11aa Sol

Ctr-D mo)myc1 r- F1U

C

I

U a DO0 -

oI

$4

$4

cz _

L

_

I

.I

_ j:

'AXi..

FIG. 3. Fluorescence-activated cell sorting of chromosomesfrom wild-type and hemizygous strains. Profiles of the sortedchromosomes from SW620 (A), HUS12 (B), and HUS17 (C) areshown. The arrows indicate the position of chromosome 16; theopen triangle indicates the position of the rearranged chromosome inthe hemizygote HUS12. Note the absence of a sorted chromosome16 from HUS17. (D) TaqI-digested PCR products of the regioncontaining the TaqI polymorphism in chromosomes 16 and 13(negative control) sorted from SW620 and HUS12. Lanes: L, 123-bpladder; 1, a reaction without DNA; 2, PCR product from SW620chromosome 16; 3, SW620 chromosome 13 product; 4, HUS12chromosome 16 product; 5, HUS12 chromosome 13 product; 6,product from SW620 genomic DNA (positive control); 7, 8, and 9,TaqI digests of lanes 2, 4, and 6.

The distribution of mutations in the exons of aprt is notsignificantly different from that expected on the basis of thesize of the exon. Recurring mutations were found at severalsites within exons 3 and 5 (Table 3; Fig. 5A and B). The sitesof the small deletions appear to be particularly prevalentamong the recurrent mutations. S19 (which eliminates aninverted repeat) is also the site of a frameshift (S118) and twoadditional transversions (S18 and S27). Frameshifts in S24and S28 fall at the site of the 4-bp duplication in S18, and a3-bp deletion can be found at the same site in S37, S104, andS122.

Multiple mutations. Multiple mutations (those in whichmore than one alteration occurs in a single mutant gene)were observed in six strains (Fig. SB). In S13 and S37,thenucleotides affected were in tandem; in S102 the alterations(a transversion and a frameshift) were only 5 bp apart. Incontrast, the mutations in S18 (a transversion and a du-plication), S37 (a frameshift and a 3-bp deletion), and S114(atransition and a transversion) were hundreds of bases apart.

DISCUSSION

We examined the molecular basis of spontaneous muta-tion at an autosomal selectable locus in a malignant humantumor cell line to determine any distinctive pathway thatcould account for the genetic instability of such cells. Therate of these mutations at this autosomal locus is very low,comparable with mutation rates in chromosomally stable celllines. This low rate may be a result of analysis of events at ahemizygous locus where more frequent multilocus deletionsor sequence rearrangements may be lethal to cells (10, 34).Nevertheless, the low incidence of errors shows that repli-cational fidelity is high in this malignant cell line. Consistentwith this explanation, most mutations arising at aprt weresimple base substitutions, predominantly at G. C base pairs,

I

11

_ _:£ Q

$4-CU

I

Ia

a

$4

I

CHr-a mamcm ri FL

MOL. CELL. BIOL.

I13A3 _

-i - -t--- r------r-----

-1 a, LI .1 LI 2 E lz, LI

4 C30

-00.

zoo,

I 00.

MULTIPLE MUTATIONS IN A HUMAN TUMOR CELL LINE 3167

sequenc(

A C G Tii.: .N

of .."i. ...

}t.:

_..

exon 3

s1 9sequence

Ct A C GTGA_1

T

cc~~~_

^ _

J =

G.G_T

wild typesequence

A C G T ,'* _.s: :.

_

*_ ,vS

-:

*:

-i.

volsb 3F

._#_b

-.._

.

.__\ e ,G

,' A10C

C

C

G

TC

\

'C/IGiG

/A

GG

I

A

C

C

C

G

GTC

C

T

C

C

C

G

T

FIG. 4. Mutant nucleotide sequences in DNA amplified fromAPRT-deficient strains. S27 has a G C--C G transversion, andS19 has an 11-bp deletion. The altered sequences are boxed.

TABLE 2. Mutation pattern in a human malignant cell linecompared with that in CHO cellsa

Change No. (%) of % ofChange ~~~human SW620 cells CHO cells

TransitionG C- A T 11(21) 25A T--G C 1(2) 10

TransversionG C-*T A 5 (9) 12G C-*C G 10 (19) 10A T-C -G 3 (6) 2A T-T -A 2 (4) 2

Frameshift-1 3 (6) 6-2 2(4) 1

Duplication 1 (2) 6

Deletion<40 bp 4 (8) 12>40 bp 4 (8) 8

Insertion 0 (<2) 1

Complex rearrangement 1 (2) <1Multiple mutations 6 (11) 1

a Reference 29. The number of CHO mutants analyzed at the sequencelevel was 89 compared with 53 for SW620.

while about 25% were small deletions, frameshifts, or dupli-cations falling in regions rich in short direct or invertedrepeats. This pattern of mutation is similar, in these re-spects, to that determined for the hamster aprt locus (29;Table 2) and can be attributed to spontaneously occurringDNA lesions and replication errors (23). In contrast to germline mutations (4), the substitutions at G C base pairs inSW620 do not appear to be a result of 5-methylcytosinedeamination, as there is a notable lack of errors at CpGdinucleotides.The distinctive feature of the spontaneous spectrum in

SW620 cells is the relatively high frequency of isolates withmultiple mutations (Table 2). Furthermore, this frequencymay be an underestimate, since we sequenced only theexons of the mutant genes. These mutations include all typesof changes and appear to fall into two classes: tandem (ornearly tandem, separated by no more than 5 bp) and widelydispersed (separated by hundreds of base pairs). Tandemmutations are rare among spontaneous events analyzed inother systems, accounting for -1% of mutations at the aprtlocus of CHO cells (29) and 1 to 2% of mutations ofintegrated shuttle vector-borne targets in mouse cells (1, 18).These mutations can be induced by DNA-damaging agents,such as UV (8, 32) or y radiation (24). Thus, spontaneouslesions similar to those induced by these agents mightconceivably lead to the tandem mutations found in SW620.Widely dispersed mutations have not been previously ob-served among spontaneous events at chromosomal loci.Such mutations can be induced in CHO cells by the drasticmeasure of a growth-inhibiting imbalance of DNA precursorpools (30, 31); however, SW620 cells are clearly not growthlimited by DNA precursor pool imbalances.The overall low rate of mutation at aprt would make

recovery of multiple independent mutations at this target

exon 3

wild typeS27G%\ sequence

G > A C G TA \ AGGIo -

m-o_.

G -I m0'.

T 404o_**sam

C , / _

cIf.

VOL. 11, 1991

3168 HARWOOD ET AL.

TABLE 3. Base substitution and frameshift mutationsa

Strain Map site (bp) Substitution Mutant sequence Alteration

TransitionsS36 866 T A--C G CTCCT C CCGCG Phe- SerS107 1931 G C--A T GACAG/ A CCTAG Gly->AspS101 2064 G C-A T GGGAA A GTAAG SpliceS14,31 2340 C G->T A CCAGG T TGAGC Ala-->ValS2 2393 G C-3-A * T TCGTC A TGGAT Val-MetS124 2414 G C-*A T CCACT A GTG/GT Gly->SerS25 2647 G C->A T CCCAG/ A AACCA SpliceSll 2650 C G-*T. A AG/GAA T CATGA Thr->IleS11O 2700 G C-*A T TCCTG A AGTGC Glu-'LysS22 2704 G * C-A * T GGAGT A CGTGA Cys->TyrS8 2737 G C--*A * T TAAGG A CAGGG Gly--Asp

TransversionsS120 663 A T- T* A TATTC T G/GTGC Arg-TrpS26 665 G C-3T A TTCAG/ T TGCAC SpliceS16 896 A T->C * G GCGAC C CCTGA His--ProS6 930 C G--A T GACTA A ATCGC Tyr--stopS12, 15 942 G C->C G G/GCGA C TGCCA SpliceS39 1952 T- A--A T CTTCC A CTTT Leu->HisS106 1961 C G->G C TGGCC G CTCCC Pro->ArgS27 1969 G C->C G CCCTG C CCCAG Ala--ProS29 1981 G * C--T A AGCTT T GACTG Gly->stopS34 2002 C G-*G *C TCATC G GAAA Arg--GlyS121 2015 A T->C G GGGGA C GCTGC Lys--ThrS30 2023 G C-*C G TGCCA C GCCCC Gly--ArgS1ll 2059 G C- C G AGTAC C GGAAG Gly->ArgS33 2399 G C->C G TGGAT C ATCTG Asp->HisS1 2647 G C--T A CCCA T/ GAACC SpliceS123 2654 G C-->C G ACCAT C AACGC Met-dIleS5 2700 G C->T A TCCTG T AGTGC Glu- stopS23 2768 C G- )G * C TTCTT G TCTCT Phe--LeuS105 2773 T A->G C CTCTC G CCTGC Leu- Arg

FrameshiftsS35 641 -C GACTT CCCACS118 1979 -T GGAGCT GACTS28 2663 -C GCTGC TGTGAS24 2666 -TG GCCTG AGCTGS109 2730 -CT CCTCG TAAGGa Mutant nucleotides are in boldface, and the positions of the frameshifts are indicated by gaps in the sequences. The sequences were determined as described

in the legend to Fig. 5.

unlikely and suggests that the multiple errors are generatedas a result of a single initiating event. For example, aspontaneously arising DNA lesion encountered by the DNAreplication complex could induce transient loss of replica-tional fidelity, leaving mutations over a long tract of DNA.Alternatively, these cells may correct spontaneous DNAdamage or mispairs formed during DNA replication byexcision of long patches of DNA, followed by an error-pronefilling process. The long patch size, which may be as great as1,800 bp (Fig. 5B), is inferred from the distance separatingthe mutations. In Escherichia coli, an apparently error-freelong-patch repair pathway is known to correct replicationmismatches (25). More recently, mismatch correction assaysperformed with extracts prepared from HeLa cells indicaterepair patches of approximately 1,000 bp (17, 38). Thesimilarity of the patch sizes found in our in vivo analysisraises the possibility that such repair pathways are errorprone in some cell lines.

Error-prone DNA synthesis has been proposed to explainmultiple substitutions found among high-frequency transfec-tion-induced mutations of a simian virus 40-based shuttlevector target (36), although such mutations are not frequent

in a stable shuttle vector system replicating in host cells overa long period (21a). Inducible error-prone responses tocertain types ofDNA damage have also been reported (7, 33,35).

Error-prone DNA synthesis would lead not only to multi-ple dispersed mutations but possibly also to chromosomalrearrangements through production of long single-strandedregions (or multiple smaller gaps) that could facilitate illegit-imate strand exchanges or generate double-strand breaks. Atdiploid loci, such lesions could contribute to the grosschromosomal abnormalities evident in tumor cells. Therehave been numerous proposals that a genetic lability (evi-dent in the form of highly aneuploid karyotypes) underliesthe process of tumor progression (28) and metastasis (3).Measurements of mutation rates in normal and malignantcell lines have not been entirely consistent with this hypoth-esis, as in many cases mutation rates in transformed ormalignant cells are no higher than those of their normalcounterparts (9, 20, 21). However, the overall mutation rateat a given genetic marker may be less important than thetypes of mutations occurring, particularly if the mutational

MOL. CELL. BIOL.

MULTIPLE MUTATIONS IN A HUMAN TUMOR CELL LINE 3169

A 2eletionsS4. exon 2

Wild type

Mutant

S19. exon 3

Wild type

Mutant

S37. S104. S122 exonS5

Wild type

Mutant

DupllicatonS18W exon 5

Wild type

Mutant

B MultiRle mutationsMutant map site

tandem:S32

859AGGACCCC GCCTCCTTCCGCGCCGCCATCG GCCTCCTG

AGGACCCC GCCTCCTGG

1965

CCCTC CCTGGCCCAGG AGCTr

CCCTC AGCTT

2762CCTGTACCC TTCTTC TCTCTCCT

CCTGTACCC 1TC TCTCTCCT

2661

CGCTG CCTG TGAGC

CGCTG CCTG CCTG TGAGC_,0 _:,

alteration mutant sequence

G914, 915 -G CCACGA GGCCG

G:C-> A:T A

S13 1951,1953c c

-C GCTTCT T GG

G

Si 02 2059 G:C->C:G AGTAC C GGAAG TAA gly->arg2064 trameshift A

dispersed:

S1 14 660 T.A->C:G TGGTA CTCAG/G phe->leu2059 G:C->C:G AGTAC C GGAAG gly->arg

CS37 910 -c CGACCACGGG

2763 -TTC TACCC TTCTCT

S18 1969 G:C->C;G CCCTG C CCCAG ala->pro2661 duplication CGCTG CCTG CCTGTG

FIG. 5. Sequence analysis of mutant aprt alleles derived fromthe SW620 hemizygotes HUS12 (mutants S1 to S35) and HUS17(SlOl to S118). Mutant genes were analyzed by direct sequencing ofthe double-stranded products obtained from amplification of eachexon of the aprt gene. The map sites of the mutations correspond tothe published human aprt sequence (16). All five exons from eachmutant strain were analyzed. (A) Spontaneously occurring deletionsand duplications. Deleted or duplicated nucleotides are in boldface,and the position of each deletion or duplication is indicated by a gap.

The arrows represent direct and inverted repeats. (B) Multiplemutations.

events have a greater probability of initiating genome rear-

rangement.

ACKNOWLEDGMENTS

We are grateful to Tomas Lindahl, Rick Wood, and David Lanefor discussions and critical comments regarding the manuscript.

REFERENCES1. Ashman, C. R., and R. L. Davidson. 1987. Sequence analysis of

spontaneous mutations in a shuttle vector gene integrated intomammalian chromosomal DNA. Proc. Natl. Acad. Sci. USA84:3354-3358.

2. Callahan, R., and G. Campbell. 1989. Mutations in humanbreast cancer: an overview. J. Natl. Cancer Inst. 81:1780-1786.

3. Cifone, M. A., and I. J. Fidler. 1981. Increasing metastatic

potential is associated with increasing genetic instability ofclones isolated from murine neoplasms. Proc. Natl. Acad. Sci.USA 78:6949-6952.

4. Cooper, D. N., and H. Youssoufian. 1988. The CpG dinucleotideand human genetic disease. Hum. Genet. 78:151-155.

5. Cotter, F., S. Nasipuri, E. Lam, and B. D. Young. 1989. Genemapping by enzymatic amplification from flow sorted chromo-somes. Genomics 5:470-474.

6. Croce, C. M. 1987. Role of chromosome translocations inhuman neoplasia. Cell 49:155-156.

7. DasGupta, U. B., and W. C. Summers. 1978. Ultraviolet reacti-vation of herpes simplex virus is mutagenic and inducible inmammalian cells. Proc. Natl. Acad. Sci. USA 75:2378-2381.

7a.Davis, R. Unpublished data.8. Drobetsky, E. A., A. J. Grosovsky, and B. W. Glickman. 1987.

The specificity of UV-induced mutations at an endogenouslocus in mammalian cells. Proc. Natl. Acad. Sci. USA 84:9103-9107.

9. Elmore, E., T. Kakunaga, and J. C. Barrett. 1983. Comparisonof spontaneous mutation rates of normal and chemically trans-formed human skin fibroblasts. Cancer Res. 43:1650-1655.

10. Evans, H. H., J. Mencl, M.-F. Horng, M. Ricanati, C. Sanchez,and J. Hozier. 1986. Locus specificity in the mutability ofL5178Y mouse lymphoma cells: the role of multilocus lesions.Proc. Natl. Acad. Sci. USA 83:4379-4383.

11. Feinberg, A. P., and B. Vogelstein. 1983. A technique forradiolabeling DNA restriction endonuclease fragments to highspecific activity. Anal. Biochem. 132:6-13.

12. Frearon, E. R., and B. Vogelstein. 1990. A genetic model forcolorectal tumorigenesis. Cell 61:759-767.

13. Friend, S. H., R. Bernards, S. Rogelj, R. A. Weinberg, J. M.Rapaport, D. M. Albert, and T. P. Dryja. 1986. A human DNAsegment with properties of the gene that predisposes to retino-blastoma and osteosarcoma. Nature (London) 323:643-646.

14. Fung, Y.-K. T., A. L. Murphree, A. T'Ang, J. Qian, S. H.Hinrichs, and W. F. Benedict. 1987. Structural evidence for theauthenticity of the human retinoblastoma gene. Science 236:1657-1661.

14a.Harwood, J., et al. Unpublished data.15. Hermans, A., N. Heisterkamp, M. von Lindern, S. van Baal, D.

Meijer, D. van der Plas, L. Weidemann, J. Groffen, D. Bootsma,and G. Grosveld. 1987. Unique fusion of bcr and c-abl genes inPhiladelphia chromosome positive acute lymphoblastic leuke-mia. Cell 51:33-40.

16. Hidaka, Y., S. A. Tarle, T. E. O'Toole, W. N. Kelley, and T. D.Palella. 1987. Nucleotide sequence of the human APRT gene.Nucleic Acids Res. 15:9086.

17. Holmes, J., S. Clark, and P. Modrich. 1990. Strand specificmismatch correction in nuclear extracts of human and Droso-phila melanogaster cell lines. Proc. Natl. Acad. Sci. USA87:5837-5841.

18. Ikehata, H., T. Akagi, H. Kimura, S. Akasaka, and T. Kato.1989. Spectrum of spontaneous mutations in a cDNA of thehuman hprt gene integrated in chromosomal DNA. Mol. Gen.Genet. 219:349-358.

19. Jones, G. E., and P. A. Sargent. 1974. Mutants of culturedChinese hamster cells deficient in adenine phosphoribosyl trans-ferase. Cell 2:43-54.

20. Kaden, D., I. K. Gadi, L. Bardwell, R. Gelman, and R. Sager.1989. Spontaneous mutation rates of tumorigenic and nontum-origenic Chinese hamster embryo fibroblast cell lines. CancerRes. 49:3374-3379.

21. Kendal, W. S., and P. Frost. 1986. Metastatic potential andspontaneous mutation rates: studies with two murine cell linesand their recently induced metastatic variants. Cancer Res.46:6131-6135.

21a.Klinedinst, D., and N. Drinkwater. Personal communication.22. Liebovitz, A., J. C. Stinson, W. B. McCombs, C. E. McCoy,

K. C. Mazur, and M. D. Mabry. 1976. Classification of humancolorectal adenocarcinoma cell lines. Cancer Res. 36:4562-4567.

23. Meuth, M. 1990. The structure of mutation in mammalian cells.Biochim. Biophys. Acta 1032:1-17.

VOL . 1 l, 1991

3170 HARWOOD ET AL.

24. Miles, C., and M. Meuth. 1989. DNA sequence determination ofy radiation-induced mutations of the hamster APRT locus.Mutat. Res. 227:97-102.

25. Modrich, P. 1989. Methyl-directed DNA mismatch correction.J. Biol. Chem. 264:6597-6600.

26. Nalbantoglu, J., 0. Goncalves, and M. Meuth. 1983. Structure ofmutant alleles at the aprt locus of Chinese hamster ovary cells.J. Mol. Biol. 167:575-594.

27. Nigro, J. M., S. J. Baker, A. C. Preisinger, J. M. Jessup, R.Hostetter, K. Cleary, S. H. Bigner, N. Davidson, S. Baylin, P.Devilee, T. Glover, F. S. Collins, A. Weston, R. Modali, C. C.Harris, and B. Vogelstein. 1989. Mutations in the p53 gene occurin diverse human tumour types. Nature (London) 342:705-707.

28. Nowell, P. C. 1976. The clonal evolution of tumour cell popula-tions. Science 194:23-28.

29. Phear, G., W. Armstrong, and M. Meuth. 1989. The molecularbasis of spontaneous mutation at the aprt locus of hamster cells.J. Mol. Biol. 209:577-582.

30. Phear, G., and M. Meuth. 1989. The genetic consequences ofDNA precursor pool imbalance: sequence analysis of mutationsinduced by excess thymidine at the hamster APRT locus.Mutat. Res. 214:201-206.

31. Phear, G., J. Nalbantoglu, and M. Meuth. 1987. Next-nucleotideeffects in mutations driven by DNA precursor pool imbalancesat the aprt locus of Chinese hamster ovary cells. Proc. Natl.Acad. Sci. USA 84:4450-4454.

32. Romak, S., P. Leong, H. Sockett, and F. Hutchinson. 1989. DNAbase sequence changes induced by ultraviolet light mutagenesisof a gene on a chromosome in Chinese hamster ovary cells. J.

Mol. Biol. 209:195-204.33. Ronai, Z., M. E. Lambert, and I. B. Weinstein. 1990. Inducible

cellular responses to ultraviolet irradiation and other mediatorsof DNA damage in mammalian cells. Cell Biol. Toxicol. 6:105-126.

34. Sargent, G., G. Phear, and M. Meuth. 1989. Deletion formationin mammalian cells: molecular analysis of breakpoints andjunctions in the hamster aprt locus. New Biol. 1:205-213.

35. Sarkar, S., U. B. Dasgupta, and W. C. Summers. 1984. Error-prone mutagenesis detected in mammalian cells by a shuttlevector containing the supF gene of Escherichia coli. Mol. Cell.Biol. 4:2227-2230.

36. Seidman, M. M., A. Bredberg, S. Seetharam, and K. H. Krae-mer. 1987. Multiple point mutations in a shuttle vector propa-gated in human cells: evidence for an error-prone DNA poly-merase activity. Proc. Natl. Acad. Sci. USA 84:4944-4988.

37. Seshadri, R., R. J. Kutlaca, K. Trainor, C. Matthews, and A. A.Morely. 1987. Mutation rate of normal and malignant humanlymphocytes. Cancer Res. 47:407-409.

38. Thomas, D. C., J. D. Roberts, and T. A. Kunkel. 1991. Hetero-duplex repair in extracts of human HeLa cells. J. Biol. Chem.266:3744-3751.

39. Varmus, H. E. 1984. The molecular genetics of cellular onco-genes. Annu. Rev. Genet. 18:553-612.

40. Young, B. D., M. A. Ferguson-Smith, R. Sillar, and E. Boyd.1981. High resolution analysis of human peripheral lymphocytechromosomes by flow cytometry. Proc. Natl. Acad. Sci. USA78:7727-7731.

MOL. CELL. BIOL.